Os conjuntos de dados de difracção de raios X foram recolhidos na linha 7A do Laboratório de Aceleração de Pohang (Coreia). Este estudo foi apoiado pelo Programa de Investigação Científica Básica administrado através da Fundação Nacional de Investigação da Coreia (NRF), financiado pelo Ministério da Ciência, TIC e Planeamento do Futuro (2015R1A1A01057574 a MH).

1. Produção e Purificação de Proteína Recombinante de rBC1531 <ol><li> Preparaï¿½o de um plasmï¿½eo de expressï¿½ da proteï¿½a BC1531 recombinante (rBC1531) <ol><li> Preparar DNA genômico de B. cereus 10 . </li><li> Amplificar o gene bc1531 a partir de um molde de ADN genómico de B. cereus por reacção em cadeia com polimerase (PCR), utilizando iniciadores directos e inversos (ver a Lista de Materiais) para criar locais de enzimas de restrição Bam HI e Sal I, respectivamente 10 . </li><li> Digerir o produto de PCR e um vector pET49b modificado (pET49bm) utilizando Bam HI e Sal I, como descrito 11 . </li><li> Mistura-se o produto de PCR digerido e o vector (razão 3: 1) do passo 1.1.3 utilizando ADN-ligase de T4 numa reacção de 10 μL, tal como descrito 11 . Incubar a 18 ° C durante 30 min. </li><li> Pipetar 3 μL da reação de ligação em 50 μL deLmente células E. coli DH5α competentes num tubo. Misture suavemente pipetando para cima e para baixo e coloque em gelo por 30 min. Choque térmico durante 45 s a 42 ° C. Adicionar 1 mL de meio Luria-Bertani (LB) e crescer as células enquanto agita vigorosamente (250 rpm, 37 ° C, 45 min). </li><li> Tomar 100 μL das células transformadas do passo 1.1.6 e espalhá-las sobre as placas LB-agar com 100 μg / mL de canamicina (Kan). Incubar durante ~ 18 h a 37 ° C. </li><li> Escolher as colï¿½ias utilizando uma ponta estï¿½il e cultivar as cï¿½ulas em 3 mL de meio LB com 100 ï¿½ / mL de Kan; Agitar vigorosamente (250 rpm, 37 ° C, 18 h). </li><li> Preparar o ADN plasmídico utilizando um método de lise alcalino-SDS, como descrito 10 . </li><li> Confirmar a sequência nucleotídica da construção da expressão de rBC1531 utilizando sequenciação de ADN 12 . </li></ol></li><li> A sobre-expressão da proteína rBC1531 <ol><li> Re-transformar a estirpe E. coli BL21 (DE3) com rBC1531-expPlasmï¿½eo de ressï¿½io, tal como descrito nos passos 1.1.5-1.1.6, para sobre-expressï¿½. </li><li> Selecione uma colônia e cresça em 10 mL de meio LB contendo 50 μg / mL de Kan (LB + Kan); Agitar vigorosamente durante 18 h a 37 ° C. </li><li> Inocular 10 mL de cultura durante a noite em 1 L de meio LB + Kan e crescer a 37 ° C até a DO 600 (densidade óptica a 600 nm) atingir ~ 0,7. </li><li> Submergir a cultura em água gelada durante ~ 15 min para arrefecer a temperatura para 18 ° C e adicionar isopropil β-D-1-tiogalactopiranósido (IPTG) à cultura a uma concentração final de 1 mM para a expressão da proteína recombinante. Cultivar a cultura a 18 ° C durante um período adicional de ~ 16-18 h. </li></ol></li><li> Purificação de rBC1531 <ol><li> Colher as células por centrifugação (5.000 xg, 4 ° C, 30 min). Descartar o sobrenadante com cuidado para não perturbar as células. Re-suspender as células em 50 ml de solução salina tamponada com fosfato (PBS) contendo imidazole 10 mM. </li><li> Lyse as células duas vezes por sonicação em gelo para evitar o excesso de aquecimento dos lisados ​​celulares (tempo: 2 min 30 s, ciclo em: 5 s, ciclo off: 10 s, amplitude: 38%). </li><li> Limpar o lisado celular por centrifugação (~ 25 000 xg, 4 ° C, 30 min). </li><li> Misture 3 mL de esferas de níquel e 60 mL de PBS contendo imidazole 10 mM e extraia o tampão extra para depositar as esferas de níquel equilibradas numa coluna de cromatografia de vidro 2,5 x 10 cm. </li><li> Pipetar para transferir o sobrenadante do passo 1.3.3 para a coluna com esferas de níquel pré-equilibradas e incubar a 4 ° C durante 2 h num rolo de fiar a uma velocidade baixa (~ 20 rpm). </li><li> Deixar o sobrenadante drenar por gravidade e lavar as esferas de níquel na coluna três vezes com 100 mL de PBS contendo imidazole 10 mM. </li><li> Eluir a proteína rBC1531 aplicando 4 x 5 mL de PBS contendo imidazole 250 mM. </li><li> Tomar 15 μL da eluição do passo 1.3.7 e executá-la em SDS-PAGE a 15%. Visualize as bandas de proteínasO gel usando coloraï¿½o azul de Coomassie 10 . </li></ol></li><li> A remoção dos marcadores de afinidade da proteína rBC1531 por proteólise de trombina <ol><li> Pipetar as fracções em tubo de diálise (peso molecular cortado: 3 kDa) e colocar o tubo num copo contendo 4 L de tampão compatível com a clivagem da trombina (HEPES 20 mM, pH 7,4, NaCl 150 mM e P-mercaptoetanol 1,5 mM) A 4 ° C durante a noite. </li><li> Pipetar as frações e transferi-los para um tubo cônico. </li><li> Medir a absorvância a 280 nm e estimar a concentração de proteína rBC1531, conforme descrito 13 . </li><li> Tomar 50 μg de rBC1531 num tubo de 0,5 ml e adicionar várias quantidades de trombina ( ie, 2, 1, 0,6 e 0,3 unidades). Incubar as reacções rBC1531 e trombina a 20 ° C durante ~ 3 h para determinar a menor quantidade de trombina necessária para clivar o marcador de afinidade N-terminal. </li><li> Executar o rBC1531 e reações de trombina em um 15%SDS-PAGE e determinam a quantidade mais baixa de trombina ( por exemplo, 0,3 unidades de trombina por 50 μg de rBC1531) que digerem completamente o marcador de afinidade N-terminal e produzem um rBC1531 livre de marcadores. </li><li> Adicionar 10 mg de proteína rBC1531 e 60 unidades de trombina a um tubo de 15 mL e incubar a 20 ° C durante ~ 3 h para a reacção de proteólise de trombina. </li><li> Aplicar padrões de filtração de gel a uma coluna de cromatografia de exclusão de tamanho (SEC) para preparar uma curva padrão de pesos moleculares e volumes de eluição, conforme descrito 13 . </li><li> Colocar a proteína rBC1531 digerida com trombina do passo 1.4.6 num tubo de filtro centrífugo (peso molecular cortado: 3 kDa) e centrifugar a 3000 g a 4 ° C para reduzir até um volume inferior a 5 mL. </li><li> Aplicar a proteína rBC1531 concentrada na coluna SEC e recolher 60 fracções eluídas em 0,5 mL por tubo 13 . </li><li> Tomar 15 μL de cada fração, executá-los em uma SDS-PAGE a 15%, e staiN o gel utilizando uma solução de coloração com Coomassie (azul brilhante de Coomassie 0,15% (p / v), metanol a 40% (v / v) e ácido acético glacial a 10% (v / v) como descrito 10 . </li><li> Pipetar as frações que contêm rBC1531 e coletá-las em um tubo. </li></ol></li></ol> 2. Triagem de Cristalização e Optimização de rBC1531 <ol><li> Condições de rastreio para a cristalização da proteína rBC1531 <ol><li> Concentrar o rBC1531 do passo 1.4.11 até ~ 18,5 mg / mL usando um tubo de filtro centrífugo, como descrito no passo 1.4.8. </li><li> Adicionar 50 μL de cada solução de rastreio de cristalização (ver secção 2.2) 14 aos poços de placas de cristalização de 96 poços sentadas. Colocar 0,5 μL da solução de proteína rBC1531 de 18,5 mg / mL numa cama sentada. Misturar a solução de proteína com 0,5 μL da solução do poço, repetindo o processo para toda a placa. </li><li> Cubra a placa com filme adesivo transparente.Colocar as placas de 96 poços a 18 ° C e permitir a difusão de vapor. </li><li> Digitalize as gotas com uma ampliação de 20-40X usando um microscópio de luz para monitorar a formação de cristais diariamente durante 2-3 semanas. </li><li> Recolher dados de difracção de raios X 12 utilizando os cristais de proteína rBC1531 obtidos. </li></ol></li><li> Otimização das condições de cristalização de rBC1531 <ol><li> Preparar 500 μL da solução de condição de cristalização inicial seleccionada ( eg, cacodilato de sódio 0,1 M, pH 6,5 e citrato de sódio 1,0 M) e encher uma placa de cristalização de 24 poços para a gota sentada. </li><li> Adicionar 0,5 μL da solução de proteína rBC1531 a 18,5 mg / mL a um leito sentado, misturar com 0,5 μL da solução do poço e cobrir imediatamente a placa com película adesiva transparente. Colocar a placa a 18 ° C. </li><li> Observe o crescimento do cristal sob um microscópio de luz por uma semana. </li><li> Otimizar várias condições de cristalização variando o pH ( ie, PH 5,5-6,8) de cacodilato 0,1 M e alterando a concentração de sal ( isto é, 0,9-1,2 M) de citrato de sódio para se obter cristais singulares. Monitorar o crescimento do cristal durante ~ 1 semana e coletar dados de difração de raios-X 12 . </li></ol></li></ol> 3. Caracterização da Actividade Nucleósido Trifosfatase (NTPase) de rBC1531 <ol><li> Validação do estudo colorimétrico inorgânico dependente de fosfato <ol><li> Preparar uma reserva de pirofosfato (100 mM) e dilui-la até concentrações finais de 0,1, 0,25, 0,5, 1,0, 5,0, 10, 50, 100 e 250 μM em 200 μL de tampão de reacção (HEPES 20 mM, pH 7,4; 150 MM de NaCl e 2 mM de MgCl2) em placas de 96 poços em duplicado. Utilizar a primeira placa como controlo (isto não contém pirofosfatase). Certifique-se de que a segunda placa contém pirofosfatase como placa de trabalho, conforme indicado no passo 3.1.2. </li><li> Adicionar 0,01 unidades de Saccharomyces cerevisiae p inorgânicoYrophosphatase (1 μL) aos poços da placa de trabalho e incubar a 20 ° C durante 30-60 min. </li><li> Preparar solução de ácido molibdato misturando soluções de molibdato de amónio (0,86% v / v) e ácido ascórbico (14% v / v) numa proporção de 7: 3. Adicione 16 μL de solução de ácido molibdato aos poços de trabalho e controle e aguarde 15 min. </li><li> Ler a densidade óptica a 690 nm (OD 690 nm). </li></ol></li><li> Ensaio colorimétrico de NTPase <ol><li> Preparar uma reserva de substrato de nucleósido trifosfato (NTP) 100 mM e diluir até à concentração desejada ( eg 0, 0,2, 4,4, 11, 22, 44, 88 ou 132 μM) em 180 μL de tampão de ensaio (HEPES 20 mM, PH 7,4, NaCl 150 mM e MgCl2 2 mM). </li><li> Adicionar 20 μg de rBC1531 (1,5 mM) e os substratos NTP do passo 3.2.1 até 200 μL por reacção numa placa de 96 poços e pipetar para cima e para baixo para misturar bem. Cobrir a placa com a sua tampa e colocá-lo em uma incubadora a 37 ° C por 30 minPara realizar a reacção de hidrólise do substrato. </li><li> Transferir a placa para um banho de água a 70 ° C e deixar em repouso durante 15 minutos para parar as reacções catalíticas mediadas por rBC1531. </li><li> Adicionar 0,01 unidade de pirofosfatase inorgânica de S. cerevisiae (1 μL) a cada poço da placa de reacção (do passo 3.2.3) e incubar a 20 ° C durante 30 min. Adicionar 16 μL de solução de ácido molibdato à placa de reação para desenvolver a cor (~ 15 min). Ler a OD 690nm . </li><li> Analise usando a equação de Michaelis-Menten, como descrito 12 . </li></ol></li></ol>

<ol>
	<li>Ivanova, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+Bacillus+cereus+and+comparative+analysis+with+Bacillus+anthracis.">Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis.</a> Nature. 423, 87-91 (2003).</li><li>Spencer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacillus+anthracis.">Bacillus anthracis.</a> J Clin Pathol. 56, 182-187 (2003).</li><li>Deli, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LmbE+proteins+from+Bacillus+cereus+are+de-N-acetylases+with+broad+substrate+specificity+and+are+highly+similar+to+proteins+in+Bacillus+anthracis.">LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis.</a> FEBS J. 277, 2740-2753 (2010).</li><li>Gross, M., Marianovsky, I., Glaser, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MazG+--+a+regulator+of+programmed+cell+death+in+Escherichia+coli.">MazG -- a regulator of programmed cell death in Escherichia coli.</a> Mol Microbiol. 59, 590-601 (2006).</li><li>Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=House+cleaning,+a+part+of+good+housekeeping.">House cleaning, a part of good housekeeping.</a> Mol Microbiol. 59, 5-19 (2006).</li><li>Lee, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+Escherichia+coli+MazG,+the+regulator+of+nutritional+stress+response.">Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response.</a> J Biol Chem. 283, 15232-15240 (2008).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimeric+dUTPases,+HisE,+and+MazG+belong+to+a+new+superfamily+of+all-alpha+NTP+pyrophosphohydrolases+with+potential+&amp;#34;house-cleaning&amp;#34;+functions.">Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential &amp;#34;house-cleaning&amp;#34; functions.</a> J Mol Biol. 347, 243-255 (2005).</li><li>Robinson, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+putative+house-cleaning+enzyme+encoded+within+an+integron+array:+1.8+A+crystal+structure+defines+a+new+MazG+subtype.">A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype.</a> Mol Microbiol. 66, 610-621 (2007).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+crystal+structure+of+a+complex+of+Campylobacter+jejuni+dUTPase+with+substrate+analogue+sheds+light+on+the+mechanism+and+suggests+the+&amp;#34;basic+module&amp;#34;+for+dimeric+d(C/U)TPases.">The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the &amp;#34;basic module&amp;#34; for dimeric d(C/U)TPases.</a> J Mol Biol. 342, 1583-1597 (2004).</li><li>Green, M., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning: A laboratory Manual. 1, (2012).</li><li>Brown, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Gene cloning an introduction. , (1986).</li><li>Kim, M. I., Hong, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Bacillus-conserved+MazG+protein,+a+nucleotide+pyrophosphohydrolase.">Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase.</a> Biochem Biophys Res Commun. 472, 237-242 (2016).</li><li>Sheehan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Physical biochemistry: Principles and applications. , (2009).</li><li>Lesley, S. A., Wilson, I. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+and+crystallization+at+the+joint+center+for+structural+genomics.">Protein production and crystallization at the joint center for structural genomics.</a> J Struct Funct Genomics. 6, 71-79 (2005).</li><li>Jeon, Y. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+biochemical+characterization+of+bacterial+YpgQ+protein+reveals+a+metal-dependent+nucleotide+pyrophosphohydrolase.">Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase.</a> J Struct Biol. 195, 113-122 (2016).</li></ol>

Os autores não têm nada a revelar.

Studies of true pathogens are limited due to safety restrictions and regulations. Alternatively, pathogens can be studied using evolutionarily related non-pathogens or less pathogenic species. The ba1554 gene is considered a critical gene in B. anthracis. Fortunately, an identical gene is present in nonclinical B. cereus. Thus, without serious safety concerns, recombinant BC1531 protein can be used for biophysical and enzymatic characterization. Here, we described detailed procedures, moving fr...

A expressão de proteína recombinante é amplamente utilizada para superar problemas associados a fontes de proteína naturais, tais como quantidades limitadas de proteínas e contaminação prejudicial. Além disso, nos estudos de genes patogénicos e proteínas, uma estirpe laboratorial alternativa que não requer precauções adicionais de segurança pode ser utilizada. Por exemplo, Bacillus cereus é um modelo útil para estudar Bacillus anthracis devido à sua estreita relação evolutiva 1 . B. anthracis é um agente patogénico obrigatório que provoca o antraz mortal por inalação em seres humanos e gado e pode potencialmente ser utilizado como arma biológica 2 . Assim, os estudos laboratoriais sobre B. anthracis são rigorosamente regulados pelos Centros de Controle de Doenças dos Estados Unidos, exigindo práticas de nível 3 de biossegurança (BSL-3), que determinam que a área do laboratório seja segregada com pressão negativa. Em contraste com B. anthracis </eM&gt;, B. cereus é categorizado como um agente BSL-1 e, portanto, tem preocupações mínimas de segurança. B. cereus é um patógeno oportunista que, após a infecção, provoca intoxicação alimentar que pode ser tratada sem assistência médica. No entanto, uma vez que B. cereus partilha muitos genes críticos com B. anthracis , as funções das proteínas de B. anthracis podem ser estudadas utilizando os correspondentes homólogos de B. cereus 1 . O agrupamento de genes ba1554 - ba1558 de B. anthracis é altamente conservado com o agrupamento bc1531 - bc1535 De B. cereus , bem como com o grupo bt1364-bt1368 de Bacillus thuringiensis , em termos de organização e sequência de genes. Além disso, os primeiros genes ( ba1554 , bc1531 e bt1364 ) dos respectivos clusters são absolutamente conservados ( isto é, 100% de identidade de sequência de nucleótidos), implyiUm papel crítico do produto gênico nas espécies de Bacillus . Devido à sua localização nestes agrupamentos de genes, ba1554 foi mal identificado como um suposto transcrição regulador [ 3] . No entanto, a análise da sequência de aminoácidos do produto ba1554 indica que pertence à família MazG, que tem actividade de nucleótido pirofosfoidrolase e não está associada à actividade do factor de transcrição 4 , 5 . Embora as proteínas pertencentes à família MazG sejam diversas em relação à sequência e ao comprimento globais, partilham um domínio MazG comum de ~ 100 resíduos caracterizado por um motivo EXXE 12-28 EXXD (&quot;X&quot; significa qualquer resíduo de aminoácido e o número Indica o número de resíduos X). O domínio MazG nem sempre representa diretamente uma determinada atividade catalítica. Um membro MazG de Escherichia coli (EcMazG) possui dois domínios MazG, mas emO domínio MazG C-terminal é enzimaticamente activo 6 . Além disso, a especificidade do substrato de enzimas MazG varia de nucleosídeos trifosfatos não específicos (para EcMazG) para dCTP / dATP específicos (para integrados MazG) e dUTP (para dUTPases) 6 , 7 , 8 , 9 . Por conseguinte, são necessárias análises biofísicoquímicas da proteína BA1554 para confirmar a sua actividade NTPase e para decifrar a sua especificidade de substrato. Aqui, fornecemos um protocolo passo a passo que a maioria dos laboratórios sem uma instalação BSL-3 pode seguir para caracterizar o produto proteico do gene B. cereus bc1531 , que é um ortholog de B. anthracis ba1554 , a nível molecular. Resumidamente, BC1531 recombinante (rBC1531) foi expresso em E. coli e purificado utilizando um marcador de afinidade. Para experimentos cristalográficos de raios X,Zação da proteína rBC1531 foram selecionadas e otimizadas. Para avaliar a actividade enzimática de rBC1531, a actividade de NTPase foi monitorizada colorimetricamente para evitar nucleótidos marcados radioactivamente que foram convencionalmente utilizados. Finalmente, as análises dos dados biofísico-químicos obtidos nos permitiram determinar o estado de oligomerização e os parâmetros catalíticos de rBC1531, bem como obter dados de difração de raios X a partir do cristal rBC1531.

<table><tbody><tr><td>&lt;em&gt;Bacillus cereus&lt;/em&gt; ATCC14579</td><td>Korean Collection for Tissue Culture</td><td>3624</td><td></td></tr><tr><td>Genomic DNA prep kit</td><td>GeneAll</td><td>106-101</td><td>Genomic DNA preparation</td></tr><tr><td>Forward primer</td><td>Macrogen</td><td>GAAGGATCCGGAAGCAAAAA&lt;br/&gt; CGATGAAAGATATGCA</td><td>&lt;em&gt;Bam&lt;/em&gt;HI site is underlined</td></tr><tr><td>Reverse primer</td><td>Macrogen</td><td>CTTGTCGACTTATTCTTTCTCT&lt;br/&gt; CCCTCATCAATACGTG</td><td>&lt;em&gt;Sal&lt;/em&gt;I site is underlined</td></tr><tr><td>nPfu-Forte</td><td>Enzynomics</td><td>P410</td><td>PCR polymerase</td></tr><tr><td>&lt;em&gt;Bam&lt;/em&gt;HI</td><td>Enzynomics</td><td>R003S</td><td></td></tr><tr><td>&lt;em&gt;Sal&lt;/em&gt;I</td><td>Enzynomics</td><td>R009S</td><td></td></tr><tr><td>pET49b expression vector</td><td>Novagen</td><td>71463</td><td>Expression vector was modified to add affinity tags and BamHI/SalI sites&lt;sup&gt;10&lt;/sup&gt;</td></tr><tr><td>T4 DNA ligase</td><td>Enzynomics</td><td>M001S</td><td></td></tr><tr><td>Dialysis memebrane</td><td>Thermofisher</td><td>18265017</td><td></td></tr><tr><td>Dry block heater</td><td>JSR</td><td>JSBL-02T</td><td></td></tr><tr><td>LB broth (Luria-Bertani)</td><td>LPS solution</td><td>LB-05</td><td></td></tr><tr><td>LB Agar, Miller (Luria-Bertani)</td><td>Becton, Dickinson and Company</td><td></td><td></td></tr><tr><td>Kanamycin</td><td>LPS solution</td><td>KAN025</td><td></td></tr><tr><td>Mini-prep kit</td><td>Favorgen</td><td>FAPDE300</td><td>Plasmid DNA preparation</td></tr><tr><td>BL21(DE3) Competent cell</td><td>Novagen</td><td>69450-3CN</td><td></td></tr><tr><td>Isopropyl &amp;beta;-D-1-thiogalactopyranoside (IPTG)</td><td>Fisher BioReagents</td><td>50-213-378</td><td></td></tr><tr><td>Sodium chloride</td><td>Daejung</td><td>7548-4100</td><td>PBS material</td></tr><tr><td>Potassium chloride</td><td>Daejung</td><td>6566-4405</td><td>PBS material</td></tr><tr><td>Potassium phosphate</td><td>Bio Basic Inc</td><td>PB0445</td><td>PBS material</td></tr><tr><td>Sodium phosphate</td><td>Bio Basic Inc</td><td>S0404</td><td>PBS material</td></tr><tr><td>Imidazole</td><td>Bio Basic Inc</td><td>IB0277</td><td></td></tr><tr><td>Sonicator</td><td>Sonics</td><td>VCX 130</td><td></td></tr><tr><td>Ni-NTA agaros</td><td>Qiagen</td><td>30210</td><td>Nickel bead</td></tr><tr><td>Rotator</td><td>Finepcr</td><td>AG</td><td></td></tr><tr><td>Precision Plus Protein Dual Color Standards</td><td>Bio-rad</td><td>1610374</td><td>SDS-PAGE protein standard</td></tr><tr><td>Coonmassie Brilliant Blue R-250</td><td>Fisher BioReagents</td><td>BP101-25</td><td>Coomassie staining solution</td></tr><tr><td>Methyl alcohol</td><td>Samchun chemical</td><td>M0585</td><td>Coomassie staining solution</td></tr><tr><td>Acetic acid</td><td>Daejung</td><td>1002-4105</td><td>Coomassie staining solution</td></tr><tr><td>Dialysis memebrane</td><td>Thermofisher</td><td>68035</td><td></td></tr><tr><td>2-Mercaptoethanol</td><td>Sigma-aldrich</td><td>M6250</td><td></td></tr><tr><td>Thrombin</td><td>Merckmillipore</td><td>605157-1KUCN</td><td>Prepare aliquots of 20 &amp;mu;L (1 Unit per &amp;mu;L) and store at 70 &amp;deg;C and thaw before use</td></tr><tr><td>Superdex 200 16/600</td><td>General Electric</td><td>28989335</td><td>Size exclusion chromatography</td></tr><tr><td>Gel filtration standard</td><td>Bio-rad</td><td>151-1901</td><td></td></tr><tr><td>Centrifugal filter</td><td>Amicon</td><td>UFC800396</td><td></td></tr><tr><td>Crystralization plates</td><td>Hampton research</td><td>HR3-083</td><td>96-well sitting drop plate</td></tr><tr><td>The JCSG core suite I-IV</td><td>Qiagen</td><td>130924-130927</td><td>Crystallization secreening solution</td></tr><tr><td>Microscope</td><td>Nikon</td><td>SMZ745T</td><td></td></tr><tr><td>Cryschem plates</td><td>Hampton research</td><td>HR3-158</td><td>24-well sitting drop plate</td></tr><tr><td>Inorganic pyrophosphatase</td><td>Sigma</td><td>10108987001</td><td></td></tr><tr><td>Ammonium molybdate solution</td><td>Sigma</td><td>13106-76-8</td><td></td></tr><tr><td>L-ascorbic acid</td><td>Sigma</td><td>50-81-7</td><td></td></tr><tr><td>NTP substrate</td><td>Startagene</td><td>200415-51</td><td></td></tr><tr><td>Spectrophotometer</td><td>Biotek</td><td>SynergyH1</td><td>microplate reader</td></tr><tr><td>GraphPad Prism 5</td><td>GraphPad</td><td>Prism 5 for Window</td><td></td></tr></tbody></table>

recombinant protein expression, crystallization, and biophysical studies of a bacillus-conserved nucleotide pyrophosphorylase, bcmazg

Para superar as restrições e regulamentações de segurança ao estudar genes e proteínas de patógenos verdadeiros, seus homólogos podem ser estudados. Bacillus anthracis é um agente patogénico obrigatório que provoca o antraz mortal por inalação. Bacillus cereus é considerado um modelo útil para estudar B. anthracis devido à sua estreita relação evolutiva. O grupo de genes ba1554 - ba1558 de B. anthracis é altamente conservado com o cluster bc1531 - bc1535 em B. cereus , bem como com o cluster bt1364 - bt1368 em Bacillus thuringiensis, indicando o papel crítico dos genes associados no gênero Bacillus . Este manuscrito descreve métodos para preparar e caracterizar um produto proteico do primeiro gene ( ba1554 ) do grupo genético em B. anthracis usando uma proteína recombinante de seu ortholog em B. cereus , bc1531.

A caracterização da proteína de interesse neste estudo começou por preparar uma quantidade suficiente de proteína Bc1531 (rBC1531) recombinante de B. cereus , de preferência mais do que vários miligramas. O fragmento de ADN que codifica a proteína BC1531 foi preparado por PCR utilizando o ADN genómico de B. cereus como molde, uma vez que contém genes ortólogos idênticos a ba1554 . RBC1531 foi sobre-expresso como uma proteína solúvel em c?...

Watch this Scientific Journal Video about Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG at JoVE.com

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Bacillus anthracis é o agente patogénico obrigatório do antraz mortal por inalação, pelo que os estudos dos seus genes e proteínas são rigorosamente regulados. Uma abordagem alternativa é estudar genes ortólogos. Descrevemos estudos biofísico-químicos de um ortólogo de B. anthracis em B. cereus , bc1531, requerendo equipamento experimental mínimo e sem preocupações de segurança graves.

Expressão de Proteína Recombinante, Cristalização e Estudos Biofísicos de<em&gt; Bacillus</em&gt; -conservado Nucleotide Pyrophosphorylase, BcMazG

To overcome safety restrictions and regulations when studying genes and proteins from true pathogens, their homologues can be studied. Bacillus anthracis ...

recombinant-protein-expression-crystallization-biophysical-studies

Universidad de Cartagena UDEC

Research

JoVE Journal

Biochemistry

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

7.4K visualizações.  Yonsei University.  Bacillus anthracis é o agente patogénico obrigatório do antraz mortal por inalação, pelo que os estudos dos seus genes e proteínas são rigorosamente regulados. Uma abordagem alternativa é estudar genes ortólogos. Descrevemos estudos biofísico-químicos de um ortólogo de B. anthracis em B. cereus , bc1531, requerendo equipamento experimental mínimo e sem preocupações de segurança graves. 

Vídeo: Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a target for future development of inhibitors to decrease the virulence of the pathogen. To perform biophysical and structural characterization as well as inhibitor screening, large amounts of pure and active protein will be needed. We have developed a protocol for efficient production and purification of PPEP-1 by the use of E. coli as the expression host yielding sufficient amounts and purity of protein for crystallization and structure determination. Additionally, using microseeding, highly intergrown crystals of PPEP-1 can be grown to well-ordered crystals suitable for X-ray diffraction analysis. The methods could also be used to produce other recombinant proteins and to study the structures of other proteins producing intergrown crystals.

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

Proline-proline endopeptidase-1 (PPEP-1) is a secreted metalloprotease and promising drug-target from the human pathogen Clostridium difficile. Here we describe all methods necessary for the production and structure determination of this protein.

Produção, cristalização e determinação da estrutura de<em&gt; C. difficile</em&gt; PPEP-1 via microdispersão e Zinco-SAD

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a ...

Bioquímica

Microcrystallography of Protein Crystals and In Cellulo Diffraction

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in their largest dimension, which used to represent a challenge. We present two alternative workflows for the structure determination of protein microcrystals by X-ray crystallography with a particular focus on crystals grown in vivo. The microcrystals are either extracted from cells by sonication and purified by differential centrifugation, or analyzed in cellulo after cell sorting by flow cytometry of crystal-containing cells. Optionally, purified crystals or crystal-containing cells are soaked in heavy atom solutions for experimental phasing. These samples are then prepared for diffraction experiments in a similar way by application onto a micromesh support and flash cooling in liquid nitrogen. We briefly describe and compare serial diffraction experiments of isolated microcrystals and crystal-containing cells using a microfocus synchrotron beamline to produce datasets suitable for phasing, model building and refinement.
These workflows are exemplified with crystals of the Bombyx mori cypovirus 1 (BmCPV1) polyhedrin produced by infection of insect cells with a recombinant baculovirus. In this case study, in cellulo analysis is more efficient than analysis of purified crystals and yields a structure in ~8 days from expression to refinement.

Microcrystallography of Protein Crystals and In Cellulo Diffraction

A protocol is presented for X-ray crystallography using protein microcrystals. Two examples analyzing in vivo-grown microcrystals after purification or in cellulo are compared.

Microcristalografia de Cristais de Proteína e<em&gt; Em Cellulo</em&gt; Difração

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in ...

Expression and Purification of Mammalian Bestrophin Ion Channels

The human genome encodes four bestrophin paralogs, namely BEST1, BEST2, BEST3, and BEST4. BEST1, encoded by the BEST1 gene, is a Ca2+-activated Cl- channel (CaCC) predominantly expressed in retinal pigment epithelium (RPE). The physiological and pathological significance of BEST1 is highlighted by the fact that over 200 distinct mutations in the BEST1 gene have been genetically linked to a spectrum of at least five retinal degenerative disorders, such as Best vitelliform macular dystrophy (Best disease). Therefore, understanding the biophysics of bestrophin channels at the single-molecule level holds tremendous significance. However, obtaining purified mammalian ion channels is often a challenging task. Here, we report a protocol for the expression of mammalian bestrophin proteins with the BacMam baculovirus gene transfer system and their purification by affinity and size-exclusion chromatography. The purified proteins have the potential to be utilized in subsequent functional and structural analyses, such as electrophysiological recording in lipid bilayers and crystallography. Importantly, this pipeline can be adapted to study the functions and structures of other ion channels.

The purification of ion channels is often challenging, but once achieved, it can potentially allow in vitro investigations of the functions and structures of the channels. Here, we describe the stepwise procedures for the expression and purification of mammalian bestrophin proteins, a family of Ca2+-activated Cl- channels.

Expressão e purificação dos canais de íon Bestrophin mamíferos

The human genome encodes four bestrophin paralogs, namely BEST1, BEST2, BEST3, and BEST4. BEST1, encoded by the BEST1 gene, is a Ca2+-activated Cl- ...

Multi-target Parallel Processing Approach for Gene-to-structure Determination of the Influenza Polymerase PB2 Subunit

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States alone, an average of 41,400 deaths and 1.86 million hospitalizations are caused by influenza virus infection each year 1. Point mutations in the polymerase basic protein 2 subunit (PB2) have been linked to the adaptation of the viral infection in humans 2. Findings from such studies have revealed the biological significance of PB2 as a virulence factor, thus highlighting its potential as an antiviral drug target.
The structural genomics program put forth by the National Institute of Allergy and Infectious Disease (NIAID) provides funding to Emerald Bio and three other Pacific Northwest institutions that together make up the Seattle Structural Genomics Center for Infectious Disease (SSGCID). The SSGCID is dedicated to providing the scientific community with three-dimensional protein structures of NIAID category A-C pathogens. Making such structural information available to the scientific community serves to accelerate structure-based drug design.
Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for new lead discovery by targeting a pathway or an entire protein family. Emerald Bio has developed a high-throughput, multi-target parallel processing pipeline (MTPP) for gene-to-structure determination to support the consortium. Here we describe the protocols used to determine the structure of the PB2 subunit from four different influenza A strains.

Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for lead discovery. The following article highlights how the Seattle Structural Genomics Center for Infectious Disease utilizes a multi-target approach for gene-to-structure determination of the PB2 influenza A subunit.

Abordagem de processamento paralelo multi-alvo para Gene-a-estrutura Determinação da polimerase da gripe PB2 Subunidade

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States ...

Imunologia e Infecção

Engineering Cell-permeable Protein

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can make use of the translocating ability of so-called cell penetrating peptides (CPPs), also designated as protein transduction domains (PTDs). The TAT-CPP derived from the human immunodeficiency virus type 1 (HIV-1) Tat (trans-activator of transcription) protein has been widely used. The positively charged TAT promotes cell permeability thereby overcoming the barriers of the cellular membrane by endocytosis or/and direct membrane penetration2. In combination with a nuclear localization signal (NLS) fusion proteins are able to enter the nucleus exhibiting functionality. Our video presentation demonstrates, as an exemplification for the engineering of cell-permeable proteins, the construction, production and application of a cell-permeable version of the DNA-modifying enzyme Cre.
Cre is a site-specific recombinase that is able to recognize and recombine 34 base pair loxP sites in mammalian cells in vitro and in vivo. Therefore the Cre/loxP system is widely used to conditionally induce mutations in the genome of living cells3,4. The delivery of active Cre recombinase to cells, however, represents a limitation.
We describe the pSESAME vector system, which allows a direct insertion of the gene-of-interest and provides a platform to rapidly clone different domains and tags used within the vector in a convenient and standardized manner. Rearranging of the different tags has been shown to modify the biochemical properties of the fusion proteins providing a possibility to achieve higher yield and better solubility. We demonstrate how to express and purify recombinant cell-permeant proteins in and from E. coli. The functionality of the recombinant Cre protein is finally validated in cell culture by assessing its intracellular recombinase activity.

Protein transduction enables the direct delivery of biologically active proteins into cells. In contrast to conventional methods such as DNA transfection or viral transduction this non-invasive paradigm allows highly efficient cellular manipulation in a titratable manner circumventing cellular toxicity and the risk of oncogenic transformation by permanent genetic modification.

Engenharia de Proteínas Cell-permeáveis

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can ...

Biologia

Production of Recombinant PRMT Proteins using the Baculovirus Expression Vector System

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. PRMTs can either mono- or dimethylate arginine guanidino groups symmetrically or asymmetrically. The enzymology of these proteins is a complex and intensely investigated area that requires milligram quantities of high-quality recombinant protein. The baculovirus expression vector system (BEVS) employing Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and Spodoptera frugiperda 9 (Sf9) insect cells has been used for expression screening and production of many PRMTs, including PRMT 1, 2, and 4 through 9. To simultaneously screen for the expression of multiple constructs of these proteins, including domains and truncated fragments as well as the full-length proteins, we have applied scalable methods utilizing adjustable and programmable multichannel pipettes, combined with 24- and 96-well plates and blocks. Overall, these method adjustments enabled a large-scale generation of bacmid DNA, recombinant viruses, and protein expression screening. Using culture vessels with a high-fill volume of Sf9 cell suspension helped to overcome space limitations in the production pipeline for single batch large-scale protein production. Here, we describe detailed protocols for the efficient and cost-effective expression of functional PRMTs for biochemical, biophysical, and structural studies.

The baculovirus expression vector system (BEVS) is a robust platform for expression screening and production of protein arginine methyltransferases (PRMTs) to be used for biochemical, biophysical, and structural studies. Milligram quantities of material can be produced for the majority of PRMTs and other proteins of interest requiring a eukaryotic expression platform.

Produção de Proteínas PRMT Recombinantes utilizando o Sistema Vetorial de Expressão baculovírus

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. ...

Cristalização de proteínas de membrana transportadoras ABC em bicelas lipídicas

ABCG5/G8 Crystallization in a Lipidic Bicelle Environment for X-Ray Crystallography

ATP-binding cassette (ABC) transporters constitute lipid-embedded membrane proteins. Extracting these membrane proteins from the lipid bilayer to an aqueous environment is typically achieved by employing detergents. These detergents disintegrate the lipid bilayer and solubilize the proteins. The intrinsic habitat of membrane proteins within the lipid bilayer poses a challenge in maintaining their stability and uniformity in solution for structural characterization. Bicelles, which comprise a blend of long and short-chain phospholipids and detergents, replicate the natural lipid structure. The utilization of lipid bicelles and detergents serves as a suitable model system for obtaining high-quality diffraction crystals, specifically to determine the high-resolution structure of membrane proteins. Through these synthetic microenvironments, membrane proteins preserve their native conformation and functionality, facilitating the formation of three-dimensional crystals. In this approach, the detergent-solubilized heterodimeric ABCG5/G8 was reintegrated into DMPC/CHAPSO bicelles, supplemented with cholesterol. This setup was employed in the vapor diffusion experimental procedure for protein crystallization.

Autor em destaque: uma configuração de cristalização bicelar para proteínas de membrana transportadora ABC para avançar no desenvolvimento de medicamentos 

This protocol describes a setup for the crystallization of the sterol transporter ABCG5/G8. ABCG5/G8 is reconstituted into bicelles for hanging-drop crystallization. The protocol does not require specialized materials or substrates, making it accessible and easy to adapt in any laboratory for determining the protein structure through X-ray crystallography.

Cristalização ABCG5/G8 em Ambiente Bitela Lipídica para Cristalografia de Raios-X

ATP-binding cassette (ABC) transporters constitute lipid-embedded membrane proteins. Extracting these membrane proteins from the lipid bilayer to an ...

Estratégias para expressar e purificar transportadores de soluto

High-Throughput Expression and Purification of Human Solute Carriers for Structural and Biochemical Studies

Solute carriers (SLCs) are membrane transporters that import and export a range of endogenous and exogenous substrates, including ions, nutrients, metabolites, neurotransmitters, and pharmaceuticals. Despite having emerged as attractive therapeutic targets and markers of disease, this group of proteins is still relatively underdrugged by current pharmaceuticals. Drug discovery projects for these transporters are impeded by limited structural, functional, and physiological knowledge, ultimately due to the difficulties in the expression and purification of this class of membrane-embedded proteins. Here, we demonstrate methods to obtain high-purity, milligram quantities of human SLC transporter proteins using&#160;codon-optimized gene sequences. In conjunction with a systematic exploration of construct design and high-throughput expression, these protocols ensure the preservation of the structural integrity and biochemical activity of the target proteins. We also highlight critical steps in the eukaryotic cell expression, affinity purification, and size-exclusion chromatography of these proteins. Ultimately, this workflow yields pure, functionally active, and stable protein preparations suitable for high-resolution structure determination, transport studies, small-molecule engagement assays, and high-throughput in vitro screening.

Autor em destaque: Expressão e purificação de transportadores de soluto humano usando genes otimizados para códons 

Structural and biochemical studies of human membrane transporters require milligram quantities of stable, intact, and homogeneous protein. Here we describe scalable methods to screen, express, and purify human solute carrier transporters using codon-optimized genes.

Expressão de Proteína Recombinante, Cristalização e Estudos Biofísicos de

Resumo

Explore mais vídeos

Capítulos neste vídeo

Produção, cristalização e determinação da estrutura de

Microcristalografia de Cristais de Proteína e

Expressão e purificação dos canais de íon Bestrophin mamíferos

Abordagem de processamento paralelo multi-alvo para Gene-a-estrutura Determinação da polimerase da gripe PB2 Subunidade

Engenharia de Proteínas Cell-permeáveis

Produção de Proteínas PRMT Recombinantes utilizando o Sistema Vetorial de Expressão baculovírus

Cristalização ABCG5/G8 em Ambiente Bitela Lipídica para Cristalografia de Raios-X

Cristalização ABCG5/G8 em Ambiente Bitela Lipídica para Cristalografia de Raios-X

Cristalização ABCG5/G8 em Ambiente Bitela Lipídica para Cristalografia de Raios-X

Expressão de alto rendimento e purificação de carreadores de solutos humanos para estudos estruturais e bioquímicos