Name: recombinant protein expression, crystallization, and biophysical studies of a bacillus-conserved nucleotide pyrophosphorylase, bcmazg
Uploaded: 2017-05-16T13:00:00.000+00:00
Duration: 12 min 23 s
Description: Watch this Scientific Journal Video about Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG at JoVE.com

מערכי האפקט של קרני הרנטגן נאספו ב- beamline 7A של מעבדת ה- Pohang Accelerator (קוריאה). מחקר זה נתמך על ידי תוכנית המחקר הבסיסי למדע, אשר ניתנה באמצעות הקרן הלאומית למחקר של קוריאה (NRF), הממומנת על ידי משרד המדע, ICT &amp; תכנון עתידי (2015R1A1A01057574 ל- MH).

1. Recombinant חלבון ייצור וטיהור של rBC1531 <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכנת חלבון BC1531 רקומביננטי (rBC1531) - ביטוי פלסמיד <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכינו DNA גנומי של B. cereus 10 . </li><li style=";text-align:right;direction:rtl"> להגביר את הגן bc1531 מתבנית של ד chenus גנומי על ידי תגובת שרשרת פולימראז (PCR), באמצעות פריימרים קדימה ויופעת (ראה את רשימת החומרים) כדי ליצור BAM HI ו סאל אני הגבלת אתרי אנזים, בהתאמה 10 . </li><li style=";text-align:right;direction:rtl"> לעכל את המוצר PCR ו שונה וקטור pET49b (pET49bm) באמצעות BAM HI ו Sal I, כמתואר 11 . </li><li style=";text-align:right;direction:rtl"> מערבבים את המוצר PCR מעוכל וקטור (יחס 3: 1) משלב 1.1.3 באמצעות ליגז T4 DNA בתגובה 10 μL, כמתואר 11 . לדגור על 18 מעלות צלזיוס למשך 30 דקות. </li><li style=";text-align:right;direction:rtl"> פיפטה 3 μL של התגובה קשירת לתוך 50 μL של chemicaLly המוסמכת E. coli DH5α תאים בצינור. מערבבים בעדינות על ידי pipetting מעלה ומטה ומניחים על קרח במשך 30 דקות. הלם חום עבור 45 s ב 42 ° C. הוסף 1 מ&quot;ל של Luria-Bertani (LB) בינוני לגדל את התאים תוך רועד במרץ (250 סל&quot;ד, 37 מעלות צלזיוס, 45 דקות). </li><li style=";text-align:right;direction:rtl"> קח 100 μL של תאים שהשתנו משלב 1.1.6 ולהפיץ אותם על צלחות LB אגר עם 100 מיקרוגרם / קנמיצין מ&quot;ל (קאן). לדגור על ~ 18 שעות ב 37 ° C. </li><li style=";text-align:right;direction:rtl"> בחר מושבות באמצעות טיפ סטרילי לגדול התאים 3 מ&quot;ל של מדיום LB עם 100 מיקרוגרם / מ&quot;ל ​​קן; לנער במרץ (250 סל&quot;ד, 37 מעלות צלזיוס, 18 שעות). </li><li style=";text-align:right;direction:rtl"> הכן DNA פלסמיד באמצעות שיטה ליקוי SDS אלקליין, כמתואר 10 . </li><li style=";text-align:right;direction:rtl"> אישור רצף נוקליאוטידים של ביטוי rBC1531-ביטוי באמצעות רצף DNA 12 . </li></ol></li><li style=";text-align:right;direction:rtl"> Overexpression של חלבון rBC1531 <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> Re- להפוך את coli BL21 (DE3) זן עם rBC1531-expRession פלסמיד, כמתואר צעדים 1.1.5-1.1.6, עבור overexpression. </li><li style=";text-align:right;direction:rtl"> בחר מושבה לגדל אותו 10 מ&quot;ל של LB בינוני המכיל 50 מיקרוגרם / מ&quot;ל ​​קן (LB + קאן); לנער במרץ 18 שעות על 37 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> לחסן 10 מ&quot;ל של תרבות לילה ב 1 L של LB + קאן בינוני לגדול ב 37 ° C עד OD 600 (צפיפות אופטית ב 600 ננומטר) מגיע ~ 0.7. </li><li style=";text-align:right;direction:rtl"> לצלול את התרבות במים קרים כקרח במשך 15 דקות ~ כדי לקרר את הטמפרטורה ל 18 מעלות צלזיוס ולהוסיף isopropyl β-D-1-thiogalactopyranoside (IPTG) לתרבות בריכוז סופי של 1 מ&quot;מ על ביטוי חלבון רקומביננטי. לגדל את התרבות ב 18 מעלות צלזיוס עבור ~ ~ 18-18 נוספים. </li></ol></li><li style=";text-align:right;direction:rtl"> טיהור של rBC1531 <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> קציר התאים על ידי צנטריפוגה (5,000 xg, 4 ° C, 30 דקות). מחק את supernatant בזהירות כדי לא להפריע לתאים. Re- להשעות את התאים 50 מ&quot;ל של פוספט שנאגרו מלוחים (PBS) פתרון המכיל 10 imidazole מ&quot;מ. </li><li style=";text-align:right;direction:rtl"> Lyse התאים פעמיים על ידי sonication על הקרח כדי למנוע את חימום יתר של lysates התא (זמן: 2 דקות 30 S, מחזור על: 5 S, מחזור הנחה: 10 S, משרעת: 38%). </li><li style=";text-align:right;direction:rtl"> נקה לייסט התא על ידי צנטריפוגה (~ 25,000 XG, 4 ° C, 30 דקות). </li><li style=";text-align:right;direction:rtl"> מערבבים 3 מ&quot;ל של חרוזים ניקל 60 מ&quot;ל של PBS המכיל 10 מ&quot;מ imidazole וכוח הכבידה חיץ נוסף ליישב את חרוזי ניקל equilibrated ב 2.5 x 10 ס&quot;מ טור כרומטוגרפיה זכוכית. </li><li style=";text-align:right;direction:rtl"> פיפטה כדי להעביר את supernatant מ צעד 1.3.3 לעמוד עם חרוזי ניקל מראש equilibrated ו דגירה על 4 מעלות צלזיוס למשך 2 שעות על גלגל מסתובב במהירות נמוכה (~ 20 סל&quot;ד). </li><li style=";text-align:right;direction:rtl"> אפשר supernatant לניקוז על ידי כוח הכבידה ולשטוף את חרוזי ניקל בעמודה שלוש פעמים עם 100 מ&quot;ל של PBS המכיל 10 imidazole מ&quot;מ. </li><li style=";text-align:right;direction:rtl"> חלבון RBC1531 Elute על ידי החלת 4 x 5 מ&quot;ל של PBS המכיל 250 מ&quot;מ imidazole. </li><li style=";text-align:right;direction:rtl"> קח 15 μL של elution מ צעד 1.3.7 ולהפעיל אותו על 15% SDS-PAGE. לדמיין את להקות חלבון בהג&#39;ל באמצעות מכתים כחול קומסי 10 . </li></ol></li><li style=";text-align:right;direction:rtl"> הסרת תגי הזיקה של חלבון rBC1531 על ידי פרוטאוליזה thrombin <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> פיפטה שברים צינור דיאליזה (משקל מולקולרי לחתוך: 3 kDa) ומניחים את הצינור בכוס המכיל 4 L של חיץ תואמת thrombin cleavage (20 מ&quot;מ HEPES, pH 7.4, 150 מ&quot;מ NaCl, ו 1.5 מ&quot;מ β-mercaptoethanol) ב 4 ° C במשך הלילה. </li><li style=";text-align:right;direction:rtl"> פיפטה את השברים ולהעביר אותם צינור חרוטי. </li><li style=";text-align:right;direction:rtl"> למדוד את ספיגת ב 280 ננומטר ולהעריך את ריכוז החלבון rBC1531, כמתואר 13 . </li><li style=";text-align:right;direction:rtl"> קח 50 מיקרוגרם של rBC1531 בצינור 0.5 מ&quot;ל ולהוסיף כמויות שונות של thrombin ( כלומר, 2, 1, 0.6, ו 0.3 יחידות). דגירה של תגובות rBC1531 ו thrombin ב 20 מעלות צלזיוס במשך 3 שעות כדי לקבוע את הכמות המינימלית של thrombin נדרש לדבוק תג זיקה N- מסוף. </li><li style=";text-align:right;direction:rtl"> הפעל את rBC1531 ותגובות טרומבין על 15%SDS-PAGE ולקבוע את הכמות הנמוכה ביותר של thrombin ( למשל, 0.3 יחידות של תרומבין לכל 50 מיקרוגרם של rBC1531) כי מעכל לחלוטין את תג זיקה N- מסוף לייצר RBC1531 ללא תג. </li><li style=";text-align:right;direction:rtl"> הוסף 10 מ&quot;ג של חלבון rBC1531 ו 60 יחידות של טרומבין לצינור 15 מ&quot;ל ו דגירה על 20 מעלות צלזיוס למשך 3 ~ שעה לתגובה thrombin- proteolysis. </li><li style=";text-align:right;direction:rtl"> החלת תקני סינון ג&#39;ל על עמודה בגודל כרומטוגרפיה (SEC) כדי להכין עקומה סטנדרטית של משקולות מולקולריות וכרכים elution, כמתואר 13 . </li><li style=";text-align:right;direction:rtl"> מניחים את החלבון rBC1531 מתעכל thrombin משלב 1.4.6 בצינור צנטריפוגלי מסנן (משקל מולקולרי לחתוך: 3 kDa) ו צנטריפוגות ב 3000 גרם ב 4 ° C כדי לצמצם נפח של פחות מ 5 מ&quot;ל. </li><li style=";text-align:right;direction:rtl"> החל את חלבון rBC1531 מרוכזים בעמודה SEC ולאסוף 60 שברים eluted ב 0.5 מ&quot;ל לכל צינור 13 . </li><li style=";text-align:right;direction:rtl"> קח 15 μL של כל חלק, להפעיל אותם על SDS-PAGE 15%, ו staiN ג &#39;ל באמצעות תמיסת מכתים קומאסי (0.15% (w / v) קומאסי כחול מבריק, 40% (v / v) מתנול, ו 10% (v / v) חומצה אצטית קרחוני) כמתואר 10 . </li><li style=";text-align:right;direction:rtl"> פיפטה שברים המכילים rBC1531 ולאסוף אותם בצינור אחד. </li></ol></li></ol> 2. התגבשות הקרנה ואופטימיזציה של rBC1531 <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> תנאי הקרנה עבור התגבשות חלבון rBC1531 <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לרכז את rBC1531 משלב 1.4.11 עד ~ 18.5 מ&quot;ג / מ&quot;ל ​​באמצעות צינור מסנן צנטריפוגלי, כמתואר בשלב 1.4.8. </li><li style=";text-align:right;direction:rtl"> הוסף 50 μL של פתרון התגבשות כל התגבשות (ראה סעיף 2.2) 14 בארות של 96-היטב יושב טיפות התגבשות. מקום 0.5 μL של 18.5 מ&quot;ג / מ&quot;ל ​​פתרון חלבון rBC1531 על מיטת ישיבה. מערבבים את פתרון החלבון עם 0.5 μL של פתרון טוב, חוזר על התהליך עבור הצלחת כולה. </li><li style=";text-align:right;direction:rtl"> מכסים את הצלחת עם סרט דבק ברור.מניחים את צלחות 96 גם על 18 מעלות צלזיוס ולאפשר דיפוזיה אדי. </li><li style=";text-align:right;direction:rtl"> סרוק את הטיפות בהגדלה 20-40X באמצעות מיקרוסקופ אור כדי לפקח על היווצרות קריסטל מדי יום במשך 2-3 שבועות. </li><li style=";text-align:right;direction:rtl"> איסוף נתונים עקיפה רנטגן 12 באמצעות גבישים חלבון rBC1531 שהתקבלו. </li></ol></li><li style=";text-align:right;direction:rtl"> אופטימיזציה של התנאים rBC1531 התגבשות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן 500 μL של הפתרון התגבשות הראשונית שנבחרה במצב ( למשל, 0.1 C נתרן Cacodylate, pH 6.5 ו 1.0 M ציטרט ציטראט) ולמלא צלחת התגבשות 24 גם לירידה טיפה. </li><li style=";text-align:right;direction:rtl"> הוסף 0.5 μL של 18.5 מ&quot;ג / מ&quot;ל ​​פתרון חלבון rBC1531 למיטה יושבת, לערבב עם 0.5 μL של פתרון טוב, לכסות את הצלחת מיד עם סרט דבק ברור. מניחים את הצלחת על 18 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> לצפות צמיחה גביש תחת מיקרוסקופ אור במשך שבוע. </li><li style=";text-align:right;direction:rtl"> לייעל את התנאים התגבשות שונים על ידי שינוי ה- pH ( כלומר., PH 5.5-6.8) של 0.1 m cacodylate ו על ידי שינוי ריכוז המלח ( כלומר, 0.9-1.2 M) של ציטרט נתרן כדי להשיג גבישים בודדים. צג הצמיחה גביש ~ 1 בשבוע ולאסוף נתונים עקיפה X- רנטגן 12 . </li></ol></li></ol> 3. אפיון של Triphosphatase Nucleoside (NTPase) פעילות של rBC1531 <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ואלידציה של מחקר קולורימטרי המבוסס על פוספט אי-אורגני <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן מלאי של pyrophosphate (100 מ&quot;מ) ו לדלל אותו לריכוז הסופי של 0.1, 0.25, 0.5, 1.0, 5.0, 10, 50, 100, ו 250 מיקרומטר μL 200 של חיץ התגובה (20 מ&quot;מ HEPES, pH 7.4; 150 MM NaCl, ו 2 מ&quot;מ MgCl 2 ) לשכפל 96 צלחות היטב. השתמש בצלחת הראשונה כביקורת (זה אינו מכיל pyrophosphatase). ודא כי הצלחת השנייה מכילה pyrophosphatase כצלחת עובד, בהתאם להוראות בשלב 3.1.2. </li><li style=";text-align:right;direction:rtl"> הוסף 0.01 יחידה של Saccharomyces cerevisiae p אורגנייםYrophosphatase (1 μL) על הבארות של צלחת עובד ו דגירה על 20 מעלות צלזיוס למשך 30-60 דקות. </li><li style=";text-align:right;direction:rtl"> הכן תמיסת חומצה molybdate על ידי ערבוב molybdate אמוניום (0.86% v / v) ו חומצה אסקורבית (14% v / v) פתרונות ביחס של 7: 3. הוסף 16 μL של תמיסת חומצה מוליבדט לשני בארות עבודה ובקרה לחכות 15 דקות. </li><li style=";text-align:right;direction:rtl"> קרא את הצפיפות האופטית ב 690 ננומטר (OD 690nm ). </li></ol></li><li style=";text-align:right;direction:rtl"> Assay NTPase <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכנת מלאי של 100 מ&quot;מ nucleoside triphosphate (NTP) המצע לדלל את הריכוז הרצוי ( למשל, 0, 0.2, 4.4, 11, 22, 44, 88, או 132 מיקרומטר) ב μL 180 של חיץ assay (20 מ&quot;מ HEPES, PH 7.4, 150 מ&quot;מ NaCl, ו 2 מ&quot;מ MgCl 2 ). </li><li style=";text-align:right;direction:rtl"> הוסף 20 מיקרוגרם של rBC1531 (1.5 מ&quot;מ) ואת מצעים NTP מ 3.2.1 עד 200 μL לכל תגובה צלחת 96-היטב פיפטה למעלה ולמטה כדי לערבב היטב. מכסים את הצלחת עם המכסה ומניחים אותו 37 ° C חממה למשך 30 דקותכדי לבצע את התגובה המצע הידרוליזה. </li><li style=";text-align:right;direction:rtl"> מעבירים את הצלחת לאמבט מים 70 מעלות צלזיוס ומאפשרים לעמוד במשך 15 דקות כדי לעצור את תגובות rBC1531 בתיווך קטליטי. </li><li style=";text-align:right;direction:rtl"> הוסף 0.01 יחידה של S. cerevisiae pyrophosphatase אנאורגני (1 μL) היטב כל צלחת התגובה (מ 3.2.3 צעד) ו דגירה על 20 מעלות צלזיוס למשך 30 דקות. הוסף 16 μL של תמיסת חומצה מוליבדט לצלחת תגובה לפתח את הצבע (~ 15 דקות). קרא ב OD 690nm . </li><li style=";text-align:right;direction:rtl"> ניתוח באמצעות משוואת Michaelis-Menten, כמתואר 12 . </li></ol></li></ol>

<ol>
	<li>Ivanova, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+Bacillus+cereus+and+comparative+analysis+with+Bacillus+anthracis.">Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis.</a> Nature. 423, 87-91 (2003).</li><li>Spencer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacillus+anthracis.">Bacillus anthracis.</a> J Clin Pathol. 56, 182-187 (2003).</li><li>Deli, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LmbE+proteins+from+Bacillus+cereus+are+de-N-acetylases+with+broad+substrate+specificity+and+are+highly+similar+to+proteins+in+Bacillus+anthracis.">LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis.</a> FEBS J. 277, 2740-2753 (2010).</li><li>Gross, M., Marianovsky, I., Glaser, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MazG+--+a+regulator+of+programmed+cell+death+in+Escherichia+coli.">MazG -- a regulator of programmed cell death in Escherichia coli.</a> Mol Microbiol. 59, 590-601 (2006).</li><li>Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=House+cleaning,+a+part+of+good+housekeeping.">House cleaning, a part of good housekeeping.</a> Mol Microbiol. 59, 5-19 (2006).</li><li>Lee, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+Escherichia+coli+MazG,+the+regulator+of+nutritional+stress+response.">Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response.</a> J Biol Chem. 283, 15232-15240 (2008).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimeric+dUTPases,+HisE,+and+MazG+belong+to+a+new+superfamily+of+all-alpha+NTP+pyrophosphohydrolases+with+potential+&amp;#34;house-cleaning&amp;#34;+functions.">Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential &amp;#34;house-cleaning&amp;#34; functions.</a> J Mol Biol. 347, 243-255 (2005).</li><li>Robinson, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+putative+house-cleaning+enzyme+encoded+within+an+integron+array:+1.8+A+crystal+structure+defines+a+new+MazG+subtype.">A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype.</a> Mol Microbiol. 66, 610-621 (2007).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+crystal+structure+of+a+complex+of+Campylobacter+jejuni+dUTPase+with+substrate+analogue+sheds+light+on+the+mechanism+and+suggests+the+&amp;#34;basic+module&amp;#34;+for+dimeric+d(C/U)TPases.">The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the &amp;#34;basic module&amp;#34; for dimeric d(C/U)TPases.</a> J Mol Biol. 342, 1583-1597 (2004).</li><li>Green, M., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning: A laboratory Manual. 1, (2012).</li><li>Brown, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Gene cloning an introduction. , (1986).</li><li>Kim, M. I., Hong, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Bacillus-conserved+MazG+protein,+a+nucleotide+pyrophosphohydrolase.">Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase.</a> Biochem Biophys Res Commun. 472, 237-242 (2016).</li><li>Sheehan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Physical biochemistry: Principles and applications. , (2009).</li><li>Lesley, S. A., Wilson, I. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+and+crystallization+at+the+joint+center+for+structural+genomics.">Protein production and crystallization at the joint center for structural genomics.</a> J Struct Funct Genomics. 6, 71-79 (2005).</li><li>Jeon, Y. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+biochemical+characterization+of+bacterial+YpgQ+protein+reveals+a+metal-dependent+nucleotide+pyrophosphohydrolase.">Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase.</a> J Struct Biol. 195, 113-122 (2016).</li></ol>

למחברים אין מה לחשוף.

Studies of true pathogens are limited due to safety restrictions and regulations. Alternatively, pathogens can be studied using evolutionarily related non-pathogens or less pathogenic species. The ba1554 gene is considered a critical gene in B. anthracis. Fortunately, an identical gene is present in nonclinical B. cereus. Thus, without serious safety concerns, recombinant BC1531 protein can be used for biophysical and enzymatic characterization. Here, we described detailed procedures, moving fr...

ביטוי חלבון רקומביננטי נעשה שימוש נרחב כדי להתגבר על בעיות הקשורות מקורות חלבון טבעי, כגון כמויות חלבון מוגבל זיהום מזיק. יתר על כן, במחקרים על גנים וחלבונים פתוגניים, ניתן לנצל זן מעבדה חלופי שאינו דורש אמצעי בטיחות נוספים. לדוגמה, Bacillus cereus הוא מודל שימושי לחקר Bacillus anthracis בשל הקשר האבולוציוני הקרוב שלהם 1 . B. anthracis הוא פתוגן מחייב שגורם לאנתרקס משאיפה קטלנית בבני אדם ובעלי חיים, והוא עשוי לשמש כ bioweapon 2 . לפיכך, מחקרים מעבדה על B. anthracis מוסדרים בקפדנות על ידי המרכזים האמריקאים לבקרת מחלות, המחייבים פרקטיקות של רמה 3 (BSL-3) של בטיחות ביולוגית, אשר קובעות כי אזור המעבדה יופרד עם לחץ שלילי בחדר. בניגוד ל- B. anthracis </eM&gt;, B. cereus מסווג כסוכן BSL-1 ולכן יש חששות בטיחות מינימליים. B. cereus הוא פתוגן אופורטוניסטי אשר, עם זיהום, גורם הרעלת מזון שניתן לטפל ללא סיוע רפואי. עם זאת, מכיוון שב &#39;cereus חולק גנים קריטיים רבים עם B. anthracis , ניתן לבדוק את הפונקציות של חלבונים אנתראקיס באמצעות ההומולוגים המתאימים של B. cereus 1 . Ba1554 - ba1558 אשכול גנים של B. anthracis הוא שמר מאוד עם bc1531 - bc1535 אשכול של B. cereus , וכן עם bt1364-bt1368 אשכול של Bacillus thuringiensis , במונחים של ארגון גנים ורצף. יתר על כן, הגנים הראשונים ( ba1554 , bc1531 , bt1364 ) של אשכולות בהתאמה משומרים לחלוטין ( כלומר, 100% רצף נוקלאוטיד זהות), implyiNg תפקיד קריטי של המוצר הגן במינים Bacillus . בשל מיקומה של אשכולות גנים אלה, ba1554 זוהה בטעות כווסת שעתוק משוער 3 . עם זאת, רצף חומצות אמינו ניתוח של המוצר ba1554 מציין כי היא שייכת למשפחת MazG, אשר יש פעילות pyrophosphohydrolase נוקלאוטיד אינו קשור עם גורם שעתוק פעילות 4 , 5 . למרות חלבונים השייכים למשפחת MazG הם מגוונים ביחס לרצף הכולל אורך, הם חולקים משותף ~ 100-שאריות MazG תחום מאופיין EXXE 12-28 EXXD מוטיב (&quot;X&quot; מייצג שאריות חומצות אמינו, ומספר מציין את מספר שאריות X). תחום ה- MazG לא תמיד מייצג באופן ישיר פעילות קטליטית מסוימת. חבר MazG מ Escherichia coli (EcMazG) בעל שני תחומים MazG, אבל בLy מסוף C- תחום MazG הוא פעיל enzymatically 6 . יתר על כן, הספציפי המצע של אנזימים MazG משתנה מ nonphoside nucleoside שאינם ספציפיים (עבור EcMazG) ספציפיים dCTP / dATP (עבור integrin הקשורים מזג) ו DUTP (עבור dUTPases) 6 , 7 , 8 , 9 . לכן, מנתח biophysicochemical של החלב BA1554 יש צורך לאשר פעילות NTPase שלה לפענח את הספציפיות המצע שלה. כאן, אנו מספקים פרוטוקול צעד אחר צעד כי מעבדות ביותר ללא מתקן BSL-3 יכול לעקוב כדי לאפיין את המוצר חלבון של הגן bc1531 B. cereus , שהוא אורתולוג של B. anthracis ba1554 , ברמה המולקולרית. בקצרה, רקומביננטי BC1531 (rBC1531) התבטא ב coli ו מטוהרים באמצעות תג זיקה. עבור ניסויים קריסטלוגרפיים רנטגן, קריסטליZation התנאים של חלבון rBC1531 הוקרנו אופטימיזציה. כדי להעריך את הפעילות האנזימטית של rBC1531, פעילות NTPase היה פיקוח colorimetrically כדי למנוע רדיואקטיבי שכותרתו נוקליאוטידים כי כבר בשימוש מקובל. לבסוף, ניתוחים של הנתונים biophysicochemical שהושגו אפשרה לנו לקבוע את המדינה oligomerization ופרמטרים קטליטי של rBC1531, כמו גם להשיג נתונים עקיפה רנטגן מן גביש rBC1531.

<table><tbody><tr><td>&lt;em&gt;Bacillus cereus&lt;/em&gt; ATCC14579</td><td>Korean Collection for Tissue Culture</td><td>3624</td><td></td></tr><tr><td>Genomic DNA prep kit</td><td>GeneAll</td><td>106-101</td><td>Genomic DNA preparation</td></tr><tr><td>Forward primer</td><td>Macrogen</td><td>GAAGGATCCGGAAGCAAAAA&lt;br/&gt; CGATGAAAGATATGCA</td><td>&lt;em&gt;Bam&lt;/em&gt;HI site is underlined</td></tr><tr><td>Reverse primer</td><td>Macrogen</td><td>CTTGTCGACTTATTCTTTCTCT&lt;br/&gt; CCCTCATCAATACGTG</td><td>&lt;em&gt;Sal&lt;/em&gt;I site is underlined</td></tr><tr><td>nPfu-Forte</td><td>Enzynomics</td><td>P410</td><td>PCR polymerase</td></tr><tr><td>&lt;em&gt;Bam&lt;/em&gt;HI</td><td>Enzynomics</td><td>R003S</td><td></td></tr><tr><td>&lt;em&gt;Sal&lt;/em&gt;I</td><td>Enzynomics</td><td>R009S</td><td></td></tr><tr><td>pET49b expression vector</td><td>Novagen</td><td>71463</td><td>Expression vector was modified to add affinity tags and BamHI/SalI sites&lt;sup&gt;10&lt;/sup&gt;</td></tr><tr><td>T4 DNA ligase</td><td>Enzynomics</td><td>M001S</td><td></td></tr><tr><td>Dialysis memebrane</td><td>Thermofisher</td><td>18265017</td><td></td></tr><tr><td>Dry block heater</td><td>JSR</td><td>JSBL-02T</td><td></td></tr><tr><td>LB broth (Luria-Bertani)</td><td>LPS solution</td><td>LB-05</td><td></td></tr><tr><td>LB Agar, Miller (Luria-Bertani)</td><td>Becton, Dickinson and Company</td><td></td><td></td></tr><tr><td>Kanamycin</td><td>LPS solution</td><td>KAN025</td><td></td></tr><tr><td>Mini-prep kit</td><td>Favorgen</td><td>FAPDE300</td><td>Plasmid DNA preparation</td></tr><tr><td>BL21(DE3) Competent cell</td><td>Novagen</td><td>69450-3CN</td><td></td></tr><tr><td>Isopropyl &amp;beta;-D-1-thiogalactopyranoside (IPTG)</td><td>Fisher BioReagents</td><td>50-213-378</td><td></td></tr><tr><td>Sodium chloride</td><td>Daejung</td><td>7548-4100</td><td>PBS material</td></tr><tr><td>Potassium chloride</td><td>Daejung</td><td>6566-4405</td><td>PBS material</td></tr><tr><td>Potassium phosphate</td><td>Bio Basic Inc</td><td>PB0445</td><td>PBS material</td></tr><tr><td>Sodium phosphate</td><td>Bio Basic Inc</td><td>S0404</td><td>PBS material</td></tr><tr><td>Imidazole</td><td>Bio Basic Inc</td><td>IB0277</td><td></td></tr><tr><td>Sonicator</td><td>Sonics</td><td>VCX 130</td><td></td></tr><tr><td>Ni-NTA agaros</td><td>Qiagen</td><td>30210</td><td>Nickel bead</td></tr><tr><td>Rotator</td><td>Finepcr</td><td>AG</td><td></td></tr><tr><td>Precision Plus Protein Dual Color Standards</td><td>Bio-rad</td><td>1610374</td><td>SDS-PAGE protein standard</td></tr><tr><td>Coonmassie Brilliant Blue R-250</td><td>Fisher BioReagents</td><td>BP101-25</td><td>Coomassie staining solution</td></tr><tr><td>Methyl alcohol</td><td>Samchun chemical</td><td>M0585</td><td>Coomassie staining solution</td></tr><tr><td>Acetic acid</td><td>Daejung</td><td>1002-4105</td><td>Coomassie staining solution</td></tr><tr><td>Dialysis memebrane</td><td>Thermofisher</td><td>68035</td><td></td></tr><tr><td>2-Mercaptoethanol</td><td>Sigma-aldrich</td><td>M6250</td><td></td></tr><tr><td>Thrombin</td><td>Merckmillipore</td><td>605157-1KUCN</td><td>Prepare aliquots of 20 &amp;mu;L (1 Unit per &amp;mu;L) and store at 70 &amp;deg;C and thaw before use</td></tr><tr><td>Superdex 200 16/600</td><td>General Electric</td><td>28989335</td><td>Size exclusion chromatography</td></tr><tr><td>Gel filtration standard</td><td>Bio-rad</td><td>151-1901</td><td></td></tr><tr><td>Centrifugal filter</td><td>Amicon</td><td>UFC800396</td><td></td></tr><tr><td>Crystralization plates</td><td>Hampton research</td><td>HR3-083</td><td>96-well sitting drop plate</td></tr><tr><td>The JCSG core suite I-IV</td><td>Qiagen</td><td>130924-130927</td><td>Crystallization secreening solution</td></tr><tr><td>Microscope</td><td>Nikon</td><td>SMZ745T</td><td></td></tr><tr><td>Cryschem plates</td><td>Hampton research</td><td>HR3-158</td><td>24-well sitting drop plate</td></tr><tr><td>Inorganic pyrophosphatase</td><td>Sigma</td><td>10108987001</td><td></td></tr><tr><td>Ammonium molybdate solution</td><td>Sigma</td><td>13106-76-8</td><td></td></tr><tr><td>L-ascorbic acid</td><td>Sigma</td><td>50-81-7</td><td></td></tr><tr><td>NTP substrate</td><td>Startagene</td><td>200415-51</td><td></td></tr><tr><td>Spectrophotometer</td><td>Biotek</td><td>SynergyH1</td><td>microplate reader</td></tr><tr><td>GraphPad Prism 5</td><td>GraphPad</td><td>Prism 5 for Window</td><td></td></tr></tbody></table>

recombinant protein expression, crystallization, and biophysical studies of a bacillus-conserved nucleotide pyrophosphorylase, bcmazg

כדי להתגבר על הגבלות בטיחות ותקנות בעת לימוד גנים וחלבונים מפני פתוגנים אמיתיים, הומולוגים שלהם ניתן ללמוד. Bacillus anthracis הוא פתוגן מחייב שגורם לאנתרקס שאיפה קטלני. Bacillus cereus נחשב מודל שימושי ללימוד ב &#39;אנתרקיס בשל הקשר האבולוציוני הקרוב שלה. אשכול הגנים ba1554 - ba1558 של B. anthracis נשמר מאוד עם אשכול bc1531 - bc1535 ב- B. cereus , וכן עם bt1364-bt1368 באשכול ב- Bacillus thuringiensis, המציין את התפקיד הקריטי של הגנים המשויכים לסוג Bacillus . כתב היד מתאר שיטות להכנת ואפיון של מוצר חלבון של הגן הראשון ( ba1554 ) מקבוצת גנים ב B. anthracis באמצעות חלבון רקומביננטי של אורתולוג ב B. cereus , bc1531.

אפיון של חלבון העניין במחקר זה החל על ידי הכנת כמות מספקת של רקומביננטי B. B. creus bc1531 (rBC1531) חלבון, רצוי יותר ממספר מיליגרם. קטע ה- DNA המקודד את החלבון BC1531 הוכן על ידי PCR באמצעות הדנ&quot;א הגנומי של B. cereus כתבנית, שכן הוא מכיל גנים אורתולוגים זהים ba...

Watch this Scientific Journal Video about Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG at JoVE.com

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Bacillus anthracis הוא הפתוגן המחייב של אנתרקס משאיפת קטלני, ולכן מחקרים על הגנים והחלבונים שלהם מוסדרים בקפידה. גישה חלופית היא ללמוד גנים אורתולוגיים. אנו מתארים מחקרים biophysicochemical של B. אנתרקיס אורת&#39;ולוג ב B. cereus , bc1531, הדורש ציוד ניסיוני מינימלי וחסרים בעיות בטיחות חמורות.

ביטוי חלבון רקומביננטי, התגבשות, מחקרים ביופיסיקליים של א<em&gt; Bacillus</em&gt; -שמר Nucleotide Pyrophosphorylase, BcMazG

To overcome safety restrictions and regulations when studying genes and proteins from true pathogens, their homologues can be studied. Bacillus anthracis ...

recombinant-protein-expression-crystallization-biophysical-studies

Universidad de Cartagena UDEC

Research

JoVE Journal

Biochemistry

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

7.5K Views.  Yonsei University.  Bacillus anthracis הוא הפתוגן המחייב של אנתרקס משאיפת קטלני, ולכן מחקרים על הגנים והחלבונים שלהם מוסדרים בקפידה. גישה חלופית היא ללמוד גנים אורתולוגיים. אנו מתארים מחקרים biophysicochemical של B. אנתרקיס אורת'ולוג ב B. cereus , bc1531, הדורש צי?...

Video: Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a target for future development of inhibitors to decrease the virulence of the pathogen. To perform biophysical and structural characterization as well as inhibitor screening, large amounts of pure and active protein will be needed. We have developed a protocol for efficient production and purification of PPEP-1 by the use of E. coli as the expression host yielding sufficient amounts and purity of protein for crystallization and structure determination. Additionally, using microseeding, highly intergrown crystals of PPEP-1 can be grown to well-ordered crystals suitable for X-ray diffraction analysis. The methods could also be used to produce other recombinant proteins and to study the structures of other proteins producing intergrown crystals.

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

Proline-proline endopeptidase-1 (PPEP-1) is a secreted metalloprotease and promising drug-target from the human pathogen Clostridium difficile. Here we describe all methods necessary for the production and structure determination of this protein.

הפקה, התגבשות וקביעת מבנה<em&gt; C. difficile</em&gt; PPEP-1 באמצעות Microseeding ואבץ-SAD

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a ...

Microcrystallography of Protein Crystals and In Cellulo Diffraction

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in their largest dimension, which used to represent a challenge. We present two alternative workflows for the structure determination of protein microcrystals by X-ray crystallography with a particular focus on crystals grown in vivo. The microcrystals are either extracted from cells by sonication and purified by differential centrifugation, or analyzed in cellulo after cell sorting by flow cytometry of crystal-containing cells. Optionally, purified crystals or crystal-containing cells are soaked in heavy atom solutions for experimental phasing. These samples are then prepared for diffraction experiments in a similar way by application onto a micromesh support and flash cooling in liquid nitrogen. We briefly describe and compare serial diffraction experiments of isolated microcrystals and crystal-containing cells using a microfocus synchrotron beamline to produce datasets suitable for phasing, model building and refinement.
These workflows are exemplified with crystals of the Bombyx mori cypovirus 1 (BmCPV1) polyhedrin produced by infection of insect cells with a recombinant baculovirus. In this case study, in cellulo analysis is more efficient than analysis of purified crystals and yields a structure in ~8 days from expression to refinement.

Microcrystallography of Protein Crystals and In Cellulo Diffraction

A protocol is presented for X-ray crystallography using protein microcrystals. Two examples analyzing in vivo-grown microcrystals after purification or in cellulo are compared.

Microcrystallography של קריסטלים חלבון ו<em&gt; בסולו</em&gt; השתברות

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in ...

Expression and Purification of Mammalian Bestrophin Ion Channels

The human genome encodes four bestrophin paralogs, namely BEST1, BEST2, BEST3, and BEST4. BEST1, encoded by the BEST1 gene, is a Ca2+-activated Cl- channel (CaCC) predominantly expressed in retinal pigment epithelium (RPE). The physiological and pathological significance of BEST1 is highlighted by the fact that over 200 distinct mutations in the BEST1 gene have been genetically linked to a spectrum of at least five retinal degenerative disorders, such as Best vitelliform macular dystrophy (Best disease). Therefore, understanding the biophysics of bestrophin channels at the single-molecule level holds tremendous significance. However, obtaining purified mammalian ion channels is often a challenging task. Here, we report a protocol for the expression of mammalian bestrophin proteins with the BacMam baculovirus gene transfer system and their purification by affinity and size-exclusion chromatography. The purified proteins have the potential to be utilized in subsequent functional and structural analyses, such as electrophysiological recording in lipid bilayers and crystallography. Importantly, this pipeline can be adapted to study the functions and structures of other ion channels.

The purification of ion channels is often challenging, but once achieved, it can potentially allow in vitro investigations of the functions and structures of the channels. Here, we describe the stepwise procedures for the expression and purification of mammalian bestrophin proteins, a family of Ca2+-activated Cl- channels.

ביטוי וטיהור של תעלות יונים Bestrophin מידע יונקים

The human genome encodes four bestrophin paralogs, namely BEST1, BEST2, BEST3, and BEST4. BEST1, encoded by the BEST1 gene, is a Ca2+-activated Cl- ...

Multi-target Parallel Processing Approach for Gene-to-structure Determination of the Influenza Polymerase PB2 Subunit

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States alone, an average of 41,400 deaths and 1.86 million hospitalizations are caused by influenza virus infection each year 1. Point mutations in the polymerase basic protein 2 subunit (PB2) have been linked to the adaptation of the viral infection in humans 2. Findings from such studies have revealed the biological significance of PB2 as a virulence factor, thus highlighting its potential as an antiviral drug target.
The structural genomics program put forth by the National Institute of Allergy and Infectious Disease (NIAID) provides funding to Emerald Bio and three other Pacific Northwest institutions that together make up the Seattle Structural Genomics Center for Infectious Disease (SSGCID). The SSGCID is dedicated to providing the scientific community with three-dimensional protein structures of NIAID category A-C pathogens. Making such structural information available to the scientific community serves to accelerate structure-based drug design.
Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for new lead discovery by targeting a pathway or an entire protein family. Emerald Bio has developed a high-throughput, multi-target parallel processing pipeline (MTPP) for gene-to-structure determination to support the consortium. Here we describe the protocols used to determine the structure of the PB2 subunit from four different influenza A strains.

Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for lead discovery. The following article highlights how the Seattle Structural Genomics Center for Infectious Disease utilizes a multi-target approach for gene-to-structure determination of the PB2 influenza A subunit.

גישת עיבוד מקביל רב היעד לקביעת גנטי למבנה של פולימראז שפעת PB2 מקטע

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States ...

Immunology and Infection

Engineering Cell-permeable Protein

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can make use of the translocating ability of so-called cell penetrating peptides (CPPs), also designated as protein transduction domains (PTDs). The TAT-CPP derived from the human immunodeficiency virus type 1 (HIV-1) Tat (trans-activator of transcription) protein has been widely used. The positively charged TAT promotes cell permeability thereby overcoming the barriers of the cellular membrane by endocytosis or/and direct membrane penetration2. In combination with a nuclear localization signal (NLS) fusion proteins are able to enter the nucleus exhibiting functionality. Our video presentation demonstrates, as an exemplification for the engineering of cell-permeable proteins, the construction, production and application of a cell-permeable version of the DNA-modifying enzyme Cre.
Cre is a site-specific recombinase that is able to recognize and recombine 34 base pair loxP sites in mammalian cells in vitro and in vivo. Therefore the Cre/loxP system is widely used to conditionally induce mutations in the genome of living cells3,4. The delivery of active Cre recombinase to cells, however, represents a limitation.
We describe the pSESAME vector system, which allows a direct insertion of the gene-of-interest and provides a platform to rapidly clone different domains and tags used within the vector in a convenient and standardized manner. Rearranging of the different tags has been shown to modify the biochemical properties of the fusion proteins providing a possibility to achieve higher yield and better solubility. We demonstrate how to express and purify recombinant cell-permeant proteins in and from E. coli. The functionality of the recombinant Cre protein is finally validated in cell culture by assessing its intracellular recombinase activity.

Protein transduction enables the direct delivery of biologically active proteins into cells. In contrast to conventional methods such as DNA transfection or viral transduction this non-invasive paradigm allows highly efficient cellular manipulation in a titratable manner circumventing cellular toxicity and the risk of oncogenic transformation by permanent genetic modification.

הנדסה Cell-חדיר חלבון

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can ...

Biology

Production of Recombinant PRMT Proteins using the Baculovirus Expression Vector System

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. PRMTs can either mono- or dimethylate arginine guanidino groups symmetrically or asymmetrically. The enzymology of these proteins is a complex and intensely investigated area that requires milligram quantities of high-quality recombinant protein. The baculovirus expression vector system (BEVS) employing Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and Spodoptera frugiperda 9 (Sf9) insect cells has been used for expression screening and production of many PRMTs, including PRMT 1, 2, and 4 through 9. To simultaneously screen for the expression of multiple constructs of these proteins, including domains and truncated fragments as well as the full-length proteins, we have applied scalable methods utilizing adjustable and programmable multichannel pipettes, combined with 24- and 96-well plates and blocks. Overall, these method adjustments enabled a large-scale generation of bacmid DNA, recombinant viruses, and protein expression screening. Using culture vessels with a high-fill volume of Sf9 cell suspension helped to overcome space limitations in the production pipeline for single batch large-scale protein production. Here, we describe detailed protocols for the efficient and cost-effective expression of functional PRMTs for biochemical, biophysical, and structural studies.

The baculovirus expression vector system (BEVS) is a robust platform for expression screening and production of protein arginine methyltransferases (PRMTs) to be used for biochemical, biophysical, and structural studies. Milligram quantities of material can be produced for the majority of PRMTs and other proteins of interest requiring a eukaryotic expression platform.

ייצור חלבוני PRMT רקומביננטיים באמצעות מערכת וקטור הביטוי של Baculovirus

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. ...

התגבשות חלבוני קרום טרנספורטר ABC בביצלות ליפידיות

ABCG5/G8 Crystallization in a Lipidic Bicelle Environment for X-Ray Crystallography

ATP-binding cassette (ABC) transporters constitute lipid-embedded membrane proteins. Extracting these membrane proteins from the lipid bilayer to an aqueous environment is typically achieved by employing detergents. These detergents disintegrate the lipid bilayer and solubilize the proteins. The intrinsic habitat of membrane proteins within the lipid bilayer poses a challenge in maintaining their stability and uniformity in solution for structural characterization. Bicelles, which comprise a blend of long and short-chain phospholipids and detergents, replicate the natural lipid structure. The utilization of lipid bicelles and detergents serves as a suitable model system for obtaining high-quality diffraction crystals, specifically to determine the high-resolution structure of membrane proteins. Through these synthetic microenvironments, membrane proteins preserve their native conformation and functionality, facilitating the formation of three-dimensional crystals. In this approach, the detergent-solubilized heterodimeric ABCG5/G8 was reintegrated into DMPC/CHAPSO bicelles, supplemented with cholesterol. This setup was employed in the vapor diffusion experimental procedure for protein crystallization.

Author Spotlight: A Bicelle Crystallization Setup for ABC Transporter Membrane Proteins to Advance Drug Development 

This protocol describes a setup for the crystallization of the sterol transporter ABCG5/G8. ABCG5/G8 is reconstituted into bicelles for hanging-drop crystallization. The protocol does not require specialized materials or substrates, making it accessible and easy to adapt in any laboratory for determining the protein structure through X-ray crystallography.

התגבשות ABCG5/G8 בסביבת ביצלה ליפידית לקריסטלוגרפיה של קרני רנטגן

ATP-binding cassette (ABC) transporters constitute lipid-embedded membrane proteins. Extracting these membrane proteins from the lipid bilayer to an ...

אסטרטגיות לביטוי וטיהור מובילי מובילי מומסים

High-Throughput Expression and Purification of Human Solute Carriers for Structural and Biochemical Studies

Solute carriers (SLCs) are membrane transporters that import and export a range of endogenous and exogenous substrates, including ions, nutrients, metabolites, neurotransmitters, and pharmaceuticals. Despite having emerged as attractive therapeutic targets and markers of disease, this group of proteins is still relatively underdrugged by current pharmaceuticals. Drug discovery projects for these transporters are impeded by limited structural, functional, and physiological knowledge, ultimately due to the difficulties in the expression and purification of this class of membrane-embedded proteins. Here, we demonstrate methods to obtain high-purity, milligram quantities of human SLC transporter proteins using&#160;codon-optimized gene sequences. In conjunction with a systematic exploration of construct design and high-throughput expression, these protocols ensure the preservation of the structural integrity and biochemical activity of the target proteins. We also highlight critical steps in the eukaryotic cell expression, affinity purification, and size-exclusion chromatography of these proteins. Ultimately, this workflow yields pure, functionally active, and stable protein preparations suitable for high-resolution structure determination, transport studies, small-molecule engagement assays, and high-throughput in vitro screening.

מחבר זרקור: ביטוי וטיהור של מובילי נשאי מומסים אנושיים באמצעות גנים ממוטבים של קודון 

Structural and biochemical studies of human membrane transporters require milligram quantities of stable, intact, and homogeneous protein. Here we describe scalable methods to screen, express, and purify human solute carrier transporters using codon-optimized genes.

ביטוי חלבון רקומביננטי, התגבשות, מחקרים ביופיסיקליים של א

Summary

Explore More Videos

Chapters in this video

הפקה, התגבשות וקביעת מבנה

Microcrystallography של קריסטלים חלבון ו

ביטוי וטיהור של תעלות יונים Bestrophin מידע יונקים

גישת עיבוד מקביל רב היעד לקביעת גנטי למבנה של פולימראז שפעת PB2 מקטע

הנדסה Cell-חדיר חלבון

ייצור חלבוני PRMT רקומביננטיים באמצעות מערכת וקטור הביטוי של Baculovirus

התגבשות ABCG5/G8 בסביבת ביצלה ליפידית לקריסטלוגרפיה של קרני רנטגן

התגבשות ABCG5/G8 בסביבת ביצלה ליפידית לקריסטלוגרפיה של קרני רנטגן

התגבשות ABCG5/G8 בסביבת ביצלה ליפידית לקריסטלוגרפיה של קרני רנטגן

ביטוי וטיהור בתפוקה גבוהה של נשאי מומסים אנושיים למחקרים מבניים וביוכימיים