This research was supported by start-up funds from Northwestern University and a National Science Foundation CAREER Award (IOS-1751035), both granted to E.C.A.

<ol>
	<li>Fr&#233;zal, L., F&#233;lix, M. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C.+elegans+outside+the+Petri+dish.">C. elegans outside the Petri dish.</a> eLife. 4, 05849 (2015).</li><li>Sivasundar, A., Hey, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sampling+from+natural+populations+with+RNAI+reveals+high+outcrossing+and+population+structure+in+Caenorhabditis+elegans.">Sampling from natural populations with RNAI reveals high outcrossing and population structure in Caenorhabditis elegans.</a> Current Biology: CB. 15 (17), 1598-1602 (2005).</li><li>Kiontke, K. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+phylogeny+and+molecular+barcodes+for+Caenorhabditis,+with+numerous+new+species+from+rotting+fruits.">A phylogeny and molecular barcodes for Caenorhabditis, with numerous new species from rotting fruits.</a> BMC Evolutionary Biology. 11, 339 (2011).</li><li>Petersen, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ten+years+of+life+in+compost:+temporal+and+spatial+variation+of+North+German+Caenorhabditis+elegans+populations.">Ten years of life in compost: temporal and spatial variation of North German Caenorhabditis elegans populations.</a> Ecology and Evolution. 5 (16), 3250-3263 (2015).</li><li>Richaud, A., Zhang, G., Lee, D., Lee, J., F&#233;lix, M. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+local+coexistence+pattern+of+selfing+genotypes+in+Caenorhabditis+elegans+natural+metapopulations.">The local coexistence pattern of selfing genotypes in Caenorhabditis elegans natural metapopulations.</a> Genetics. 208 (2), 807-821 (2018).</li><li>Ferrari, C., Salle, R., Callemeyn-Torre, N., Jovelin, R., Cutter, A. D., Braendle, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ephemeral-habitat+colonization+and+neotropical+species+richness+of+Caenorhabditis+nematodes.">Ephemeral-habitat colonization and neotropical species richness of Caenorhabditis nematodes.</a> BMC Ecology. 17 (1), 43 (2017).</li><li>Crombie, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deep+sampling+of+Hawaiian+Caenorhabditis+elegans+reveals+high+genetic+diversity+and+admixture+with+global+populations.">Deep sampling of Hawaiian Caenorhabditis elegans reveals high genetic diversity and admixture with global populations.</a> eLife. 8, 50465 (2019).</li><li>Crombie, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Local+adaptation+and+spatiotemporal+patterns+of+genetic+diversity+revealed+by+repeated+sampling+of+Caenorhabditis+elegans+across+the+Hawaiian+Islands.">Local adaptation and spatiotemporal patterns of genetic diversity revealed by repeated sampling of Caenorhabditis elegans across the Hawaiian Islands.</a> bioRxiv. , (2021).</li><li>Noble, L. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selfing+is+the+safest+sex+for+Caenorhabditis+tropicalis.">Selfing is the safest sex for Caenorhabditis tropicalis.</a> eLife. 10, 62587 (2021).</li><li>Cutter, A. D., Morran, L. T., Phillips, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Males,+Outcrossing,+and+Sexual+Selection+in+Caenorhabditis+Nematodes.">Males, Outcrossing, and Sexual Selection in Caenorhabditis Nematodes.</a> Genetics. 213 (1), 27-57 (2019).</li><li>Petersen, C., Dirksen, P., Schulenburg, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Why+we+need+more+ecology+for+genetic+models+such+as+C.+elegans.">Why we need more ecology for genetic models such as C. elegans.</a> Trends in Genetics: TIG. 31 (3), 120-127 (2015).</li><li>Haber, M., Sch&#252;ngel, M., Putz, A., M&#252;ller, S., Hasert, B., Schulenburg, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+history+of+Caenorhabditis+elegans+inferred+from+microsatellites:+evidence+for+spatial+and+temporal+genetic+differentiation+and+the+occurrence+of+outbreeding.">Evolutionary history of Caenorhabditis elegans inferred from microsatellites: evidence for spatial and temporal genetic differentiation and the occurrence of outbreeding.</a> Molecular Biology and Evolution. 22 (1), 160-173 (2005).</li><li>Barri&#232;re, A., F&#233;lix, M. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+C.+elegans+and+Related+Nematodes.">Isolation of C. elegans and Related Nematodes.</a> WormBook. , (2018).</li><li>Poullet, N., Braendle, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sampling+and+isolation+of+C.+elegans+from+the+natural+habitat.">Sampling and isolation of C. elegans from the natural habitat.</a> Methods in Molecular Biology. 1327, 221-229 (2015).</li><li>Di Bernardo, M., Crombie, T. A., Cook, D. E., Andersen, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=easyFulcrum:+An+R+package+to+process+and+analyze+ecological+sampling+data+generated+using+the+Fulcrum+mobile+application.">easyFulcrum: An R package to process and analyze ecological sampling data generated using the Fulcrum mobile application.</a> PloS one. 16 (10), 0254293 (2021).</li><li>. Mobile data collection &amp; workflow automation in NCAP Available from: <a target="_blank" href="https://www.fulcrumapp.com/">https://www.fulcrumapp.com/</a> (2021)</li><li>. Nematode Isolation Application Available from: <a target="_blank" href="https://www.fulcrumapp.com/apps/nematode-isolation">https://www.fulcrumapp.com/apps/nematode-isolation</a> (2021)</li><li>. Nematode Field Sampling Application Available from: <a target="_blank" href="https://www.fulcrumapp.com/apps/nematode-field-sampling">https://www.fulcrumapp.com/apps/nematode-field-sampling</a> (2021)</li><li>. JOVE wild_isolate-genotyping-template Available from: <a target="_blank" href="https://docs.google.com/spreadsheets/d/1oEP40jy6_K6Wkwn7Qm4iF58rTUe4JWk2zhJ20-keoOk/edit">https://docs.google.com/spreadsheets/d/1oEP40jy6_K6Wkwn7Qm4iF58rTUe4JWk2zhJ20-keoOk/edit</a> (2021)</li><li>. Nucleotide BLAST: Search nucleotide databases using a nucleotide query Available from: <a target="_blank" href="https://blast.ncbi.nim.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch">https://blast.ncbi.nim.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch</a> (2021)</li><li>Andersen, E. C., Bloom, J. S., Gerke, J. P., Kruglyak, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+variant+in+the+neuropeptide+receptor+npr-1+is+a+major+determinant+of+Caenorhabditis+elegans+growth+and+physiology.">A variant in the neuropeptide receptor npr-1 is a major determinant of Caenorhabditis elegans growth and physiology.</a> PLoS Genetics. 10 (2), 1004156 (2014).</li><li>Tuli, M. A., Daul, A., Schedl, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=WormBook:+Caenorhabditis+Nomenclature.">WormBook: Caenorhabditis Nomenclature.</a> WormBook. , (2018).</li><li>Stiernagle, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=WormBook:+Maintenance+of+C.+Elegant.">WormBook: Maintenance of C. Elegant.</a> WormBook. , (2006).</li></ol>

The authors report no conflicts of interest.

This protocol contains critical steps that must be executed with caution. For example, it is important that the field and isolation teams are careful to select the correct collection project in the application prior to collecting samples from the field or isolating nematodes from the samples in the laboratory. In the event that the wrong collection project is selected, the errant data records are best corrected in the Fulcrum database using the record editing tools online. This process can be tedious for many misplaced records. However, the database retains any changes to records so that a complete auditing of collection and isolation records is possible. The other critical steps in this protocol involve the handling of samples from the field and the nematodes isolated from those samples. To ensure Caenorhabditis nematodes survive the sampling and shipment steps, the temperature of samples should be maintained between 4 &#176;C and 25 &#176;C. Temperatures above 25 &#176;C can cause sterility in C. elegans14. Ensure samples are transferred from collection bags to collection plates within five days whenever possible to minimize the loss to nematodes. After nematodes are isolated, it is critical that they are genotyped and cryopreserved before they perish. It is difficult to find living nematodes on S-plates that are more than two to three weeks old because fungal and bacterial contamination can make the S-plates inhospitable.
This protocol can be modified easily to accommodate different types of data that researchers may want to collect while in the field. For example, it is easy to customize the &#39;Nematode field sampling&#39; application with new data entry fields using Fulcrum&#39;s online GUI for application editing. Moreover, the data analysis package, easyFulcrum, can accommodate these edits when processing the new data15. Another modification users may find appealing is to use a different sampling method in the field. Rather than sampling discrete substrates, researchers may desire to sample larger areas containing multiple substrate types. These larger samples are best processed in the laboratory using the Baermann funnel or tray extraction methods13. Importantly, the use of C-labels and S-labels still apply for these techniques and are therefore compatible with mobile applications.
The primary limitations of this protocol relate to the handling time of nematodes prior to isolation in the laboratory. First, the lag time between sample collection and nematode isolation makes it impossible to record the developmental stages of nematodes on a given sample at the time of collection. Second, the frequency of males and outcrossing in nature are key evolutionary questions for selfing Caenorhabditis nematodes10. This method is not well suited to addressing these questions because nematodes are likely to have gone through multiple generations prior to isolation. Delayed isolation means that direct evidence of male frequency in nature is impossible. Furthermore, the multi-generational delay during the genotyping steps means that genomic evidence of outcrossing (heterozygosity) will be eroded before a nematode strain can be sequenced. To identify heterozygosity in nature, the offspring produced by a nematode directly isolated from nature are used for sequencing2. Another potential limitation of this protocol is that it is biased toward the identification of selfing Caenorhabditis. This is because isolated nematodes of selfing species have a greater chance of proliferating than obligate outcrossers, which will only proliferate if a fertilized female is isolated.
This collection method is based on existing collection protocols13,14. The major advancement of this technique is the use of mobile technology and customized software to facilitate the organization of vast quantities of ecological and molecular data associated with large-scale collection projects. The ecological data generated using this collection protocol can be used to address outstanding questions for natural populations of Caenorhabditis species. For example, data generated with this method have been used to discover niche preferences for the species across the Hawaiian Islands. Moreover, by sequencing the genomes of cryopreserved nematodes, researchers can investigate how patterns of genetic variation are correlated with ecological data. Research of this kind can uncover signatures of local adaptation in Caenorhabditis populations and provide important insights into the relevance of genetic variation in natural contexts8. To gain a functional understanding of many genes in Caenorhabditis nematodes, ecological studies are likely required11. Even for C. elegans a large fraction of genes lacks functional annotations, despite it being the first multicellular animal to be sequenced and one of the most thoroughly studied animals on Earth. This collection protocol was developed to help address this knowledge gap by facilitating the collection of wild Caenorhabditis nematodes and the study of their ecology and natural genetic diversity.

The last two decades have brought an increased interest in the ecology of Caenorhabditis nematodes. From these studies, we know that the free-living Caenorhabditis species can be isolated from ephemeral micro-habitats in both temperate and tropical regions, where they feed on microbial blooms associated with decomposing plant material, sometimes in sympatry1,2,3,4,5,6,7,8. We have also learned that convergent evolution of self-fertilization has occurred in the genus three times, and selfing is the dominant mode of reproduction for C. briggsae, C. elegans, and C. tropicalis9,10. Among these selfers, C. elegans is one of the most widely studied animals on Earth and has been used by researchers to make critical advances in biology. Importantly, the other selfing Caenorhabditis species share many of C. elegans experimental advantages and are rapidly advancing comparative studies in the genus. However, the cryptic nature of these nematodes in the wild makes it difficult to study their ecology and natural diversity, which is critical for understanding the biological functions of their genes and the ways in which evolution has shaped genetic diversity among the species10,11.
The greatest challenge to studying the ecology of selfing Caenorhabditis nematodes in the wild is their small size; adult nematodes are often 1 mm in length or less. This challenge requires that researchers sample substrates from the wild and attempt to separate nematodes of interest from the substrates in the laboratory without the ability to observe animals in the wild. Because even trained experts find it difficult to discriminate selfing Caenorhabditis nematodes from other free-living nematodes under the microscope, nematodes are typically removed from the substrate, isolated, and left to proliferate before they are identified by sequence identity using established molecular barcodes3,12,13,14. The time and effort required to process each nematode in this way present an organizational challenge, as researchers must be able to trace the identity of each nematode isolated in the laboratory back to the exact substrate and associated ecological data sampled in the field. Here, we describe a step-by-step process to efficiently collect and identify selfing Caenorhabditis nematodes from the field and faithfully link these isolates with their associated spatial and ecological data at a high scale.
This collection method increases the scale and accuracy of ecological surveys by using mobile data collection platforms, cloud-based databases, and the R software environment. Fulcrum is a customizable data-collection platform that works with most mobile devices and allows users to build custom applications to gather and organize location-based data (https://www.fulcrumapp.com). This protocol provides detailed instructions on how to use customized data-collection applications to organize spatially explicit ecological data from the field and accurately link those data with the identity of nematodes isolated in the laboratory. The protocol also explains how to efficiently identify selfing&#160;Caenorhabditis nematodes using established molecular barcodes. The data from these methods can be processed simply and reproducibly with the accompanying R software package easyFulcrum15 to explore the ecology and genetic diversity of natural Caenorhabditis populations.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Adhesive labels</td>
			<td>Avery</td>
			<td>61533</td>
			<td>Printing the C-labels and S-labels</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Thomas Scientific</td>
			<td>C748D75</td>
			<td>agarose gel preparation</td>
		</tr>
		<tr>
			<td>Backpack</td>
			<td></td>
			<td></td>
			<td>A backpack for each team member to hold equipment, samples, food, and water for the day.</td>
		</tr>
		<tr>
			<td>Cardboard boxes</td>
			<td>Fisher Scientific</td>
			<td>AS261</td>
			<td>Storage of S-plates</td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>NA</td>
			<td>NA</td>
			<td>Neamtode lysis, SSU and ITS2 PCR</td>
		</tr>
		<tr>
			<td>Collection bags</td>
			<td>Zip-lock</td>
			<td>NA</td>
			<td>Collection of substrates</td>
		</tr>
		<tr>
			<td>Digital temperature/humidity meter</td>
			<td>Preciva</td>
			<td>HT-86</td>
			<td>Measurement of ambient temperature and humidity</td>
		</tr>
		<tr>
			<td>Disecting scope</td>
			<td>NA</td>
			<td>NA</td>
			<td>Nematode isolation, lysis</td>
		</tr>
		<tr>
			<td>Disposible reservoirs</td>
			<td>USA Scientific</td>
			<td>1306-1010</td>
			<td>Aliquoting PCR master mixes and loading dye</td>
		</tr>
		<tr>
			<td>DNA ladder, 1 KB plus</td>
			<td>Thermo Scientific</td>
			<td>SM0243</td>
			<td>Visualizing SSU and ITS2 PCR products</td>
		</tr>
		<tr>
			<td>dNTPs</td>
			<td>Thomas Scientific</td>
			<td>CB4430-2</td>
			<td>PCR master mix component</td>
		</tr>
		<tr>
			<td>easyFulcrum R package</td>
			<td>NA</td>
			<td>NA</td>
			<td>An R package for processing collection data http://andersenlab.org/easyfulcrum/articles/easyFulcrum.html</td>
		</tr>
		<tr>
			<td>EDTA solution (0.5 M pH 8.0)</td>
			<td>NA</td>
			<td>NA</td>
			<td>See supplemental table 3 for recipe</td>
		</tr>
		<tr>
			<td>Ethanol (95%)</td>
			<td>NA</td>
			<td>NA</td>
			<td>Plating out samples, spoon sterilization</td>
		</tr>
		<tr>
			<td>Ethidium bromide solution (10 mg/mL)</td>
			<td>VWR</td>
			<td>97064-602</td>
			<td>Visualizing SSU and ITS2 PCR products</td>
		</tr>
		<tr>
			<td>External battery charger for mobile device</td>
			<td>NA</td>
			<td>NA</td>
			<td>External battery charger and charging cable for iPhone or Android</td>
		</tr>
		<tr>
			<td>Flask (500 mL)</td>
			<td>Fisher Scientific</td>
			<td>FB501500</td>
			<td>agarose gel preparation</td>
		</tr>
		<tr>
			<td>Food</td>
			<td>NA</td>
			<td>NA</td>
			<td>Pack accordingly</td>
		</tr>
		<tr>
			<td>Gel electrophoresis apparatus</td>
			<td>Thermo Scientific</td>
			<td>B2</td>
			<td>Visualizing SSU and ITS2 PCR products</td>
		</tr>
		<tr>
			<td>Gel electrophoresis power supply</td>
			<td>BioRad</td>
			<td>1645050</td>
			<td>Visualizing SSU and ITS2 PCR products</td>
		</tr>
		<tr>
			<td>Gel loading dye, 6x</td>
			<td>NEB</td>
			<td>B7022S</td>
			<td>Visualizing SSU and ITS2 PCR products</td>
		</tr>
		<tr>
			<td>ITS2 primer set</td>
			<td>NA</td>
			<td>NA</td>
			<td>oECA1687 = forward primer CTGCGTTACTTACCACGAATTG 
			CARAC, oECA202 = reverse primer GCGGTATTTGCTACTACCAYYAM 
			GATCTGC</td>
		</tr>
		<tr>
			<td>ITS2 sequencing primer</td>
			<td>NA</td>
			<td>NA</td>
			<td>oECA306 = forward primer CACTTTCAAGCAACCCGAC</td>
		</tr>
		<tr>
			<td>Lysis buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>Nematode lysis, see protocol for recipe</td>
		</tr>
		<tr>
			<td>Microwave</td>
			<td>NA</td>
			<td>NA</td>
			<td>agarose gel preparation</td>
		</tr>
		<tr>
			<td>Mobile device</td>
			<td>NA</td>
			<td>NA</td>
			<td>Charged phone in airplane mode. The Fulcrum app GPS positions are inaccurate compared to the GPS positions extracted from pictures. This setting ensures that you use less power and get more precise GPS measurements.</td>
		</tr>
		<tr>
			<td>NGMA plates, 10 cm</td>
			<td>Fisher Scientific</td>
			<td>FB0875713</td>
			<td>C-plates, see Andersen et al. 2014 for NGMA plate protocol.</td>
		</tr>
		<tr>
			<td>NGMA plates, 3.5 cm</td>
			<td>Greiner Bio-One</td>
			<td>5662-7102Q</td>
			<td>S-plates, see Andersen et al. 2014 for NGMA plate protocol.</td>
		</tr>
		<tr>
			<td>Non-contact infrared thermometer</td>
			<td>Etekcity</td>
			<td>B00837ZGRY</td>
			<td>Measurement of substrate temperature</td>
		</tr>
		<tr>
			<td>Paper towels</td>
			<td>NA</td>
			<td>NA</td>
			<td>Paper towels for absorbing excess moisture in a bagged sample.</td>
		</tr>
		<tr>
			<td>Parafilm</td>
			<td>Fisher Scientific</td>
			<td>13-374-12</td>
			<td>Plate sealing</td>
		</tr>
		<tr>
			<td>PCR adhesive foil</td>
			<td>VWR</td>
			<td>60941-126</td>
			<td>PCR adhesive foil</td>
		</tr>
		<tr>
			<td>PCR buffer (10x)</td>
			<td>Thomas Scientific</td>
			<td>CB3702-7</td>
			<td>PCR master mix component</td>
		</tr>
		<tr>
			<td>PCR plates (96-well)</td>
			<td>Thomas Scientific</td>
			<td>1149K04</td>
			<td>SSU and ITS2 PCRs</td>
		</tr>
		<tr>
			<td>Pencil</td>
			<td>NA</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Plastic spoons</td>
			<td>NA</td>
			<td>NA</td>
			<td>Plating out samples</td>
		</tr>
		<tr>
			<td>Platinum pick</td>
			<td>NA</td>
			<td>NA</td>
			<td>Nematode isolation, lysis</td>
		</tr>
		<tr>
			<td>Pre-labeled ziplock collection bags</td>
			<td>NA</td>
			<td>NA</td>
			<td>Bundles of zip-lock plastic bags pre-labelled with C-label barcodes. Each bundle should contain 25 barcoded bags wrapped with a rubber band.</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Sigma</td>
			<td>3115879001</td>
			<td>Nematode lysis, added to lysis buffer just prior to use</td>
		</tr>
		<tr>
			<td>R software</td>
			<td>NA</td>
			<td>NA</td>
			<td>R software: A language and environment for statistical computing https://www.R-project.org/</td>
		</tr>
		<tr>
			<td>Soft cooler bag and ice pack</td>
			<td>NA</td>
			<td>NA</td>
			<td>Collection coolers and cooler packs to keep samples cool when ambient temperature is above 25 &#176;C.</td>
		</tr>
		<tr>
			<td>Spare batteries</td>
			<td>NA</td>
			<td>NA</td>
			<td>Extra batteries for sampling equipment</td>
		</tr>
		<tr>
			<td>SSU primer set</td>
			<td>NA</td>
			<td>NA</td>
			<td>oECA1271 = forward primer TACAATGGAAGGCAGCAGGC, oECA1272 = reverse primer CCTCTGACTTTCGTTCTTGATTAA</td>
		</tr>
		<tr>
			<td>Strip tube caps (12-well)</td>
			<td>Thomas Scientific</td>
			<td>1159V29</td>
			<td>Nematode lysis</td>
		</tr>
		<tr>
			<td>Strip tubes (12-well)</td>
			<td>Thomas Scientific</td>
			<td>1159V31</td>
			<td>Nematode lysis</td>
		</tr>
		<tr>
			<td>TAE buffer (1x)</td>
			<td>NA</td>
			<td>NA</td>
			<td>Visualizing SSU and ITS2 PCR products. See supplemental table 3 for recipe</td>
		</tr>
		<tr>
			<td>Taq polymerase</td>
			<td>Thomas Scientific</td>
			<td>C775Y45</td>
			<td>PCR master mix component</td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td>NA</td>
			<td>NA</td>
			<td>Neamtode lysis, SSU and ITS2 PCR</td>
		</tr>
		<tr>
			<td>Water</td>
			<td>NA</td>
			<td>NA</td>
			<td>Pack accordingly</td>
		</tr>
	</tbody>
</table>

a highly scalable approach to perform ecological surveys of selfing caenorhabditis nematodes

Caenorhabditis elegans is one of the major model organisms in biology, but only recently have researchers focused on its natural ecology. The relative sparsity of information about C. elegans in its natural context comes from the challenges involved in the identification of the small nematode in nature. Despite these challenges, an increasing focus on the ecology of C. elegans has caused a wealth of new information regarding its life outside of the laboratory. The intensified search for C. elegans in nature has contributed to the discovery of many new Caenorhabditis species and revealed that congeneric nematodes frequently cohabitate in the wild, where they feed on microbial blooms associated with rotting plant material. The identification of new species has also revealed that the androdioecious mating system of males and self-fertilizing hermaphrodites has evolved three times independently within Caenorhabditis. The other two selfing species, C. briggsae and C. tropicalis, share the experimental advantages of C. elegans and have enabled comparative studies into the mechanistic basis of important traits, including self-fertilization. Despite these advances, much remains to be learned about the ecology and natural diversity of these important species. For example, we still lack functional information for many of their genes, which might only be attained through an understanding of their natural ecology. To facilitate ecological research of selfing Caenorhabditis nematodes, we developed a highly scalable method to collect nematodes from the wild. Our method makes use of mobile data collection platforms, cloud-based databases, and the R software environment to enhance researchers&#39; ability to collect nematodes from the wild, record associated ecological data, and identify wild nematodes using molecular barcodes.

This protocol has been used to collect Caenorhabditis nematodes from multiple locations, including Hawaii and California. The isolation success rate for Caenorhabditis nematodes varies with collection location, climate, sampling experience, and substrate types sampled. The protocol has been used to extensively sample the Hawaiian Islands, where nine collection projects have been conducted over multiple years and seasons. The isolation success rates for selfing Caenorhabditis species are nearly identical for C. briggsae (162 of 4,506 samples, 3.6%) and C. elegans (163 of 4,506 samples, 3.6%), and much lower for C. tropicalis (26 of 4,506 samples, 0.58%)8. Each of the selfing species is enriched on rotting fruit and flower substrates relative to the other substrate categories. Sample rotting fruit and flower substrates if the researcher is attempting to maximize the success rate rather than characterize substrate preferences. However, the success rate varies with the quality of the substrate selected. For example, among fruit and flower substrates, those substrates that are too dry, wet, or fresh will likely not yield Caenorhabditis nematodes.
The scalability of this collection protocol is evident from the number of collections a single pair of researchers can collect from the wild. For example, in October of 2018, a pair of researchers using this collection protocol was able to collect a total of over 1,000 samples in 7 days from multiple locations on two Hawaiian Islands. This field team shipped the samples overnight to the laboratory, where a team of eight researchers isolated over 2,000 nematodes from the samples as they arrived. A key advantage of this protocol is that it minimizes the cost associated with sampling in remote locations by reducing the equipment and personnel required in the field. Using this protocol, a small field team can focus on sampling while the isolation team can process the samples at their home institution using fragile and heavy equipment like dissecting microscopes and agar plates for isolating nematodes. Moreover, the implementation of the mobile data-collection application allows all the field data associated with the samples to be linked directly to the C-label, which enables the isolation team to work independently from the field team while processing samples.
Researchers that use this collection protocol must consider the effort that is required to isolate nematodes prior to a collection project. The isolation and identification steps are rate-limiting, and a small collection team can quickly overwhelm isolators with samples. Moreover, the laboratory space required to process many collections can interfere with ongoing research (Figure 3). Additionally, some isolated nematodes require additional effort to genotype. For example, approximately 2% of isolates fail to amplify with the SSU PCR primer set after the first lysis attempt and must be re-lysed to ensure that the lysis material is suitable for amplification with the ITS2 primer set (Figure 8). Furthermore, approximately 3% of isolates fail to produce quality sequences after an initial round of Sanger sequencing. For these isolates, another round of lysis, ITS2 PCR, and Sanger sequencing is often required, which can increase handing time for the isolation team. Importantly, sequence identity alone is not sufficient evidence to justify a new Caenorhabditis species (Figure 7). To properly justify raising an isolate as a new Caenorhabditis species, additional effort must be made to perform mating experiments and establish a typed specimen13. A formal morphological description of the typed specimen is also preferred but not required3. Together, these considerations suggest that researchers adopting this collection protocol will benefit from trial tests of the isolation and identification steps to ensure resources are properly allocated before a collection project begins. Importantly, even small collection projects can benefit from this protocol because the process is highly reproducible, and the data can easily be audited for quality control purposes across laboratory groups.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/63486/63486fig01.jpg" /> 
Figure 1: Substrate examples. (A) An ideal rotting fruit is shown in the center of the image (1), the fruit is almost unrecognizable. Less rotted fruit is shown nearby; avoid sampling freshly fallen fruits (2). (B) An ideally decomposed flower is shown at the top (3). Avoid sampling freshly fallen flowers (4). (C) The dark leaf litter under the top layer of dry leaves is ideal when sampling for selfing Caenorhabditis nematodes (5). Avoid sampling dry leaf litter (6). <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/63486/63486fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/63486/63486fig02.jpg" /> 
Figure 2: The Nematode Field Sampling mobile application. (A) The initial screen after opening the Nematode Field Sampling application on an Apple device in Fulcrum. The red arrow in the lower right points to the + button used to create a new collection record. (B) An example of a new collection record shown on an Apple device. The red arrow points to the &#39;Project&#39; field at the top of the collection record screen. Be sure to select the correct project when sampling in the field. The project field will default to the last project used when creating subsequent collection records. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/63486/63486fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/63486/63486fig03.jpg" /> 
Figure 3: Collection bags and collection plates organized prior to plating out samples. This figure shows the samples in C-labeled collection bags on the left. Each collection bag has a matching C-labeled 10 cm plate on top of it. On the right are 10 cm collection plates that contain sample material after it was transferred from the collection bags. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/63486/63486fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/63486/63486fig04.jpg" /> 
Figure 4: A collection plate (C-plate) with properly a transferred sample. A 10 cm C-plate with decomposing fruit placed on the edge of the bacterial lawn. The C-label is attached to the plate lid. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/63486/63486fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/63486/63486fig05.jpg" /> 
Figure 5: The Nematode isolation mobile application. (A) The application selection screen in the Fulcrum mobile application. The red arrow points to the Nematode Isolation application. (B) The initial screen after opening the Nematode Isolation application on an Apple device in Fulcrum. The red arrow in the lower right points to the + button used to create a new isolation record. (C) An example of a new isolation record shown on an Apple device. The red arrow points to the &#39;Project&#39; field at the top of the isolation record screen. Be sure to select the correct project when isolating. The project field will default to the last project used when creating subsequent isolation records. (D) After tapping the Select field under C-label, users will tap the search button (red arrow) to find the C-label from which they are isolating nematodes. (E) After the C-label is selected, users will photograph the C-plate using the device camera. (F) Users then input whether there are nematodes on the C-plate or not. S-labels are added to the isolation record if there are nematodes to be isolated. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/63486/63486fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/63486/63486fig06.jpg" /> 
Figure 6: NCBI BLAST results page. (1) The drop-down menu used to view the BLAST results for all sequences. (2) The description of the current sequence selected from the drop-down. In this case the results for S-label S-05554 are shown. (3) The top BLAST hit for S-05554 is shown. The purple text indicates the link to visualize this alignment has been clicked. Please be sure to inspect the alignments by eye to identify possible new Caenorhabditis species, see step 9.8 above. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/63486/63486fig06large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/63486/63486fig07.jpg" /> 
Figure 7: NCBI BLAST alignment visualization examples. (A) An example of an isolate&#39;s ITS2 query sequence aligned to a C. kamaaina subject sequence. (1) The percent identity of the alignment (89%), which is low for a top BLAST hit. (2) A mismatch between the query and subject sequence (G to A). (3) A four base pair gap in the subject sequence made by the alignment algorithm; gaps in the query or subject indicate poor alignment. (4) A generalized region in the center of the alignment with many mismatches and gaps. A region like this one suggests that the query sequence might come from a new Caenorhabditis species. Shown is an actual alignment example of a new species, C. oiwi, that was discovered in 2017. (B) An example of a good alignment between an isolate&#39;s ITS2 query sequence and a subject sequence. (5) The percent identity of the alignment (99%), which usually means the query sequence comes from an isolate of the same species as the subject. (6) A central region of the alignment with perfect identity. A region like this one suggests that the query isolate is likely the same species as the subject. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/63486/63486fig07large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 8" class="xfigimg" src="/files/ftp_upload/63486/63486fig08.jpg" /> 
Figure 8: SSU and ITS2 PCR products. The top gel shows PCR products generated with the SSU primer set for 12 representative samples. A DNA ladder is included on the left as a reference. The SSU PCR products for Caenorhabditis nematodes are approximately 500 bp in length. Samples 2-12 amplified with the SSU primer set but sample one did not. The absence of a 500 bp SSU amplicon for sample one suggests that the lysis material was of poor quality and the sample must be re-lysed. The bottom gel shows PCR products generated with the ITS2 primer set for the same 12 Samples shown in the top gel. The ladder and samples are in the same orientation for both gels. Six of the 12 samples did not amplify with the ITS2 primer set. The samples with SSU and ITS2 bands are Sanger sequenced and identified by sequence similarity using the NCBI BLAST algorithm. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/63486/63486fig08large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Supplemental File 1: C-labels. A PDF file containing 2500 unique C-labels. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/63486/C-labels.pdf" target="_blank">Please click here to download this File.</a>
Supplemental File 2: S-labels. A PDF file containing 5000 unique S-labels. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/63486/S-labels.pdf" target="_blank">Please click here to download this File.</a>
Supplemental Table 1: Field Materials. A packing list of materials used in the field to sample nematodes. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/63486/Supplemental_Table_1.xlsx" target="_blank">Please click here to download this Table.</a>
Supplemental Table 2: PCR recipes and thermocycler conditions. A table of PCR recipes and thermocycler conditions for the ITS2 and SSU PCRs. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/63486/Supplemental_Table_2.xlsx" target="_blank">Please click here to download this Table.</a>
Supplemental Table 3: Electrophoresis buffer recipes. A recipe for 0.5 M pH 8.0 Ethylenediaminetetraacetic acid solution (EDTA) and the TRIS-acetate-EDTA (TAE) buffer solution. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/63486/Supplemental_Table_3.xlsx" target="_blank">Please click here to download this Table.</a>

Watch this Scientific Journal Video about A Highly Scalable Approach to Perform Ecological Surveys of Selfing Caenorhabditis Nematodes at JoVE.com

A Highly Scalable Approach to Perform Ecological Surveys of Selfing Caenorhabditis Nematodes

This protocol can be used to perform large-scale ecological surveys of selfing Caenorhabditis nematodes. The primary advantage of this method is the efficient organization and analysis of ecological and molecular data associated with the nematodes collected from nature.

A Highly Scalable Approach to Perform Ecological Surveys of Selfing Caenorhabditis Nematodes

Caenorhabditis elegans is one of the major model organisms in biology, but only recently have researchers focused on its natural ecology. The relative ...

a-highly-scalable-approach-to-perform-ecological-surveys-selfing

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

2.5K Views.  Northwestern University. This protocol can be used to perform large-scale ecological surveys of selfing Caenorhabditis nematodes. The primary advantage of this method is the efficient organization and analysis of ecological and molecular data associated with the nematodes collected from nature.

Video: A Highly Scalable Approach to Perform Ecological Surveys of Selfing Caenorhabditis Nematodes

Microfabricated Post-Array-Detectors (mPADs): an Approach to Isolate Mechanical Forces

In this video, we will present our approach to measure cellular traction forces using a microfabricated array of posts.  Traction forces are generated through myosin-actin interactions and play an important role in our physiology.  During development, they enable cells to move from one location to the next in order to form the early structures of tissue.  Traction forces help in the healing processes.  They are necessary for the proper closure of wounds or the migration and crawling of leukocytes through our body.  These same forces can be detrimental to our health in the case of cancer metastasis or vascular growth towards a tumor.  The most common method by which to study cells in vitro has been to use a glass or polystyrene dish.  However, the rigidity of the substrates makes it impossible to physically measure cell traction forces, and there are relatively few methods to study traction forces.  Our lab has developed a technique to overcome these limitations.  The method is based on a vertical array of flexible cantilevers, the stiffness and size scale of which are such that individual cells spread across many cantilevers and deflect them in the process.  The pillars we use are 3 &mu;m in diameter, 10 &mu;m tall, and are configured in a regular array with 9 &mu;m center-to-center spacing.  But these physical dimensions can be readily varied to accommodate a variety of studies.  We start with a silicon master, but the final posts are made out of silicone rubber called poly (dimethyl siloxane), or PDMS.  We can measure the deflections under a microscope and calculate the magnitude and direction of traction forces required to produce the observed deflections.  We call these substrates microfabricated post-array-detectors, or mPADs.  Here, we will show you how we fabricate and use the mPADs to assess modulations of cellular contractility.

Microfabricated Post-Array-Detectors mPADs: an Approach to Isolate Mechanical Forces

In this video, we demonstrate how to fabricate and utilize microfabricated post array detectors (mPADs) to assess modulations of cellular contractility.

In this video, we will present our approach to measure cellular traction forces using a microfabricated array of posts.  Traction forces are generated ...

A Reverse Genetic Approach to Test Functional Redundancy During Embryogenesis

Gene function during embryogenesis is typically defined by loss-of-function experiments, for example by targeted mutagenesis (knockout) in the mouse. In the zebrafish model, effective reverse genetic techniques have been developed using microinjection of gene-specific antisense morpholinos. Morpholinos target an mRNA through specific base-pairing and block gene function transiently by inhibiting translation or splicing for several days during embryogenesis (knockdown). However, in vertebrates such as mouse or zebrafish, some gene functions can be obscured by these approaches due to the presence of another gene that compensates for the loss. This is especially true for gene families containing sister genes that are co-expressed in the same developing tissues. In zebrafish, functional compensation can be tested in a relatively high-throughput manner, by co-injection of morpholinos that target knockdown of both genes simultaneously. Likewise, using morpholinos, a genetic interaction between any two genes can be demonstrated by knockdown of both genes together at sub-threshold levels. For example, morpholinos can be titrated such that neither individual knockdown generates a phenotype. If, under these conditions, co-injection of both morpholinos causes a phenotype, a genetic interaction is shown. Here we demonstrate how to show functional redundancy in the context of two related GATA transcription factors. GATA factors are essential for specification of cardiac progenitors, but this is revealed only by the loss of both Gata5 and Gata6. We show how to carry out microinjection experiments, validate the morpholinos, and evaluate the compensated phenotype for cardiogenesis.

Gene function can be obscured in loss-of-function experiments if there is compensation by another gene. The zebrafish model provides a relatively high-throughput means to reveal such functional redundancy in living embryos.

Gene function during embryogenesis is typically defined by loss-of-function experiments, for example by targeted mutagenesis (knockout) in the mouse. In ...

Chromatographic Purification of Highly Active Yeast Ribosomes

Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers. Particularly troublesome is the fact that lysis of cells releases a large number of proteases and nucleases which can degrade ribosomes. Thus, it is important to separate ribosomes from these enzymes as quickly as possible. Unfortunately, conventional differential ultracentrifugation methods leaves ribosomes exposed to these enzymes for unacceptably long periods of time, impacting their structural integrity and functionality. To address this problem, we utilize a chromatographic method using a cysteine charged Sulfolink resin. This simple and rapid application significantly reduces co-purifying proteolytic and nucleolytic activities, producing high yields of intact, highly biochemically active yeast ribosomes. We suggest that this method should also be applicable to mammalian ribosomes. The simplicity of the method, and the enhanced purity and activity of chromatographically purified ribosome represents a significant technical advancement for the study of eukaryotic ribosomes.

Contamination of preparations of eukaryotic ribosomes purified by traditional methods by co-purifying nucleases and proteases negatively impacts on downstream biochemical and structural analyses. A rapid and simple chromatographic purification method is used to solve this problem using yeast ribosomes as a model system.

Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers.  ...

Vampiric Isolation of Extracellular Fluid from Caenorhabditis elegans

The genetically tractable model organism C. elegans has provided insights into a myriad of biological questions, enabled by its short generation time, ease of growth and small size. This small size, though, has disallowed a number of technical approaches found in other model systems. For example, blood transfusions in mammalian systems and grafting techniques in plants enable asking questions of circulatory system composition and signaling. The circulatory system of the worm, the pseudocoelom, has until recently been impossible to assay directly. To answer questions of intercellular signaling and circulatory system composition C. elegans researchers have traditionally turned to genetic analysis, cell/tissue specific rescue, and mosaic analysis. These techniques provide a means to infer what is happening between cells, but are not universally applicable in identification and characterization of extracellular molecules. Here we present a newly developed technique to directly assay the pseudocoelomic fluid of C. elegans. The technique begins with either genetic or physical manipulation to increase the volume of extracellular fluid. Afterward the animals are subjected to a vampiric reverse microinjection technique using a microinjection rig that allows fine balance pressure control. After isolation of extracellular fluid, the collected fluid can be assayed by transfer into other animals or by molecular means. To demonstrate the effectiveness of this technique we present a detailed approach to assay a specific example of extracellular signaling molecules, long dsRNA during a systemic RNAi response. Although characterization of systemic RNAi is a proof of principle example, we see this technique as being adaptable to answer a variety of questions of circulatory system composition and signaling.

Vampiric Isolation of Extracellular Fluid from Caenorhabditis elegans

The model organism C. elegans uses pseudocoelomic fluid as a passive circulatory system. Direct assay of this fluid has not been previously possible. Here we present a novel technique to directly assay the extracellular space, and use systemic silencing signals during an RNAi response as a proof of principle example.

The genetically tractable model organism C. elegans has provided insights into a myriad of biological questions, enabled by its short generation time, ...

A Semi-quantitative Approach to Assess Biofilm Formation Using Wrinkled Colony Development

Biofilms, or surface-attached communities of cells encapsulated in an extracellular matrix, represent a common lifestyle for many bacteria. Within a biofilm, bacterial cells often exhibit altered physiology, including enhanced resistance to antibiotics and other environmental stresses 1. Additionally, biofilms can play important roles in host-microbe interactions. Biofilms develop when bacteria transition from individual, planktonic cells to form complex, multi-cellular communities 2. In the laboratory, biofilms are studied by assessing the development of specific biofilm phenotypes. A common biofilm phenotype involves the formation of wrinkled or rugose bacterial colonies on solid agar media 3. Wrinkled colony formation provides a particularly simple and useful means to identify and characterize bacterial strains exhibiting altered biofilm phenotypes, and to investigate environmental conditions that impact biofilm formation. Wrinkled colony formation serves as an indicator of biofilm formation in a variety of bacteria, including both Gram-positive bacteria, such as Bacillus subtilis 4, and Gram-negative bacteria, such as Vibrio cholerae 5, Vibrio parahaemolyticus 6, Pseudomonas aeruginosa 7, and Vibrio fischeri 8.
The marine bacterium V. fischeri has become a model for biofilm formation due to the critical role of biofilms during host colonization: biofilms produced by V. fischeri promote its colonization of the Hawaiian bobtail squid Euprymna scolopes 8-10. Importantly, biofilm phenotypes observed in vitro correlate with the ability of V. fischeri cells to effectively colonize host animals: strains impaired for biofilm formation in vitro possess a colonization defect 9,11, while strains exhibiting increased biofilm phenotypes are enhanced for colonization 8,12. V. fischeri therefore provides a simple model system to assess the mechanisms by which bacteria regulate biofilm formation and how biofilms impact host colonization.
In this report, we describe a semi-quantitative method to assess biofilm formation using V. fischeri as a model system. This method involves the careful spotting of bacterial cultures at defined concentrations and volumes onto solid agar media; a spotted culture is synonymous to a single bacterial colony. This 'spotted culture' technique can be utilized to compare gross biofilm phenotypes at single, specified time-points (end-point assays), or to identify and characterize subtle biofilm phenotypes through time-course assays of biofilm development and measurements of the colony diameter, which is influenced by biofilm formation. Thus, this technique provides a semi-quantitative analysis of biofilm formation, permitting evaluation of the timing and patterning of wrinkled colony development and the relative size of the developing structure, characteristics that extend beyond the simple overall morphology.

We provide a simple, semi-quantitative method to investigate biofilm formation in vitro. This method takes advantage of the Zeiss stemi 2000-C Dissecting Microscope (with camera attachment) to monitor both the timing and pattern of biofilm formation, as assessed by the development of wrinkled colonies.

Biofilms, or surface-attached communities of cells encapsulated in an extracellular matrix, represent a common lifestyle for many bacteria. Within a ...

Visualizing Bacteria in Nematodes using Fluorescent Microscopy

Symbioses, the living together of two or more organisms, are widespread throughout all kingdoms of life. As two of the most ubiquitous organisms on earth, nematodes and bacteria form a wide array of symbiotic associations that range from beneficial to pathogenic 1-3. One such association is the mutually beneficial relationship between Xenorhabdus bacteria and Steinernema nematodes, which has emerged as a model system of symbiosis 4. Steinernema nematodes are entomopathogenic, using their bacterial symbiont to kill insects 5. For transmission between insect hosts, the bacteria colonize the intestine of the nematode's infective juvenile stage 6-8. Recently, several other nematode species have been shown to utilize bacteria to kill insects 9-13, and investigations have begun examining the interactions between the nematodes and bacteria in these systems 9.
We describe a method for visualization of a bacterial symbiont within or on a nematode host, taking advantage of the optical transparency of nematodes when viewed by microscopy. The bacteria are engineered to express a fluorescent protein, allowing their visualization by fluorescence microscopy. Many plasmids are available that carry genes encoding proteins that fluoresce at different wavelengths (i.e. green or red), and conjugation of plasmids from a donor Escherichia coli strain into a recipient bacterial symbiont is successful for a broad range of bacteria. The methods described were developed to investigate the association between Steinernema carpocapsae and Xenorhabdus nematophila 14. Similar methods have been used to investigate other nematode-bacterium associations 9,15-18and the approach therefore is generally applicable.
The method allows characterization of bacterial presence and localization within nematodes at different stages of development, providing insights into the nature of the association and the process of colonization 14,16,19. Microscopic analysis reveals both colonization frequency within a population and localization of bacteria to host tissues 14,16,19-21. This is an advantage over other methods of monitoring bacteria within nematode populations, such as sonication 22or grinding 23, which can provide average levels of colonization, but may not, for example, discriminate populations with a high frequency of low symbiont loads from populations with a low frequency of high symbiont loads. Discriminating the frequency and load of colonizing bacteria can be especially important when screening or characterizing bacterial mutants for colonization phenotypes 21,24. Indeed, fluorescence microscopy has been used in high throughput screening of bacterial mutants for defects in colonization 17,18, and is less laborious than other methods, including sonication 22,25-27and individual nematode dissection 28,29.

To study the mutualism between Xenorhabdus bacteria and Steinernema nematodes, methods were developed to monitor bacterial presence and location within nematodes. The experimental approach, which can be applied to other systems, entails engineering bacteria to express the green fluorescent protein and visualizing, using fluorescence microscopy bacteria within the transparent nematode.

 
Symbioses, the living together of two or more organisms, are widespread throughout all kingdoms of life. As two of the most ubiquitous organisms on ...

Prostaglandin Extraction and Analysis in Caenorhabditis elegans

Caenorhabditis elegans is emerging as a powerful animal model to study the biology of lipids1-9. Prostaglandins are an important class of eicosanoids, which are lipid signals derived from polyunsaturated fatty acids (PUFAs)10-14. These signalling molecules are difficult to study because of their low abundance and reactive nature. The characteristic feature of prostaglandins is a cyclopentane ring structure located within the fatty acid backbone. In mammals, prostaglandins can be formed through cyclooxygenase enzyme-dependent and -independent pathways10,15. C. elegans synthesizes a wide array of prostaglandins independent of cyclooxygenases6,16,17. A large class of F-series prostaglandins has been identified, but the study of eicosanoids is at an early stage with ample room for new discoveries. Here we describe a procedure for extracting and analyzing prostaglandins and other eicosanoids. Charged lipids are extracted from mass worm cultures using a liquid-liquid extraction technique and analyzed by liquid chromatography coupled to electrospray ionization tandem mass spectrometry (LC-ESI-MS/MS). The inclusion of deuterated analogs of prostaglandins, such as PGF2 &alpha;-d4 as an internal standard is recommended for quantitative analysis. Multiple reaction monitoring or MRM can be used to quantify and compare specific prostaglandin types between wild-type and mutant animals. Collision-induced decomposition or MS/MS can be used to obtain information on important structural features. Liquid chromatography mass spectrometry (LC-MS) survey scans of a selected mass range, such as m/z 315-360 can be used to evaluate global changes in prostaglandin levels. We provide examples of all three analyses. These methods will provide researchers with a toolset for discovering novel eicosanoids and delineating their metabolic pathways.

Prostaglandin Extraction and Analysis in Caenorhabditis elegans

In this paper, we describe an optimized procedure for extracting and analyzing prostaglandins and other eicosanoids from C. elegans using LC-MS/MS.

Caenorhabditis elegans is emerging as a powerful animal model to study the biology of lipids1-9. Prostaglandins are an important class of eicosanoids, ...

A Highly Reproducible and Straightforward Method to Perform In Vivo Ocular Enucleation in the Mouse after Eye Opening

Enucleation or the surgical removal of an eye can generally be considered as a model for nerve deafferentation. It provides a valuable tool to study the different aspects of visual, cross-modal and developmental plasticity along the mammalian visual system1-4.
Here, we demonstrate an elegant and straightforward technique for the removal of one or both eyes in the mouse, which is validated in mice of 20 days old up to adults. Briefly, a disinfected curved forceps is used to clamp the optic nerve behind the eye. Subsequently, circular movements are performed to constrict the optic nerve and remove the eyeball. The advantages of this technique are high reproducibility, minimal to no bleeding, rapid post-operative recovery and a very low learning threshold for the experimenter. Hence, a large amount of animals can be manipulated and processed with minimal amount of effort. The nature of the technique may induce slight damage to the retina during the procedure. This side effect makes this method less suitable as compared to Mahajan et al. (2011)5 if the goal is to collect and analyze retinal tissue. Also, our method is limited to post-eye opening ages (mouse: P10 - 13 onwards) since the eyeball needs to be displaced from the socket without removing the eyelids. The in vivo enucleation technique described in this manuscript has recently been successfully applied with minor modifications in rats and appears useful to study the afferent visual pathway of rodents in general.

A Highly Reproducible and Straightforward Method to Perform In Vivo Ocular Enucleation in the Mouse after Eye Opening

The removal of eyes, also called enucleation, provides a useful strategy to study aspects of visual, cross-modal, and developmental plasticity along the mammalian visual system since it induces irreversible partial (monocular) or complete (binocular) vision loss. Here we describe a highly reproducible and straightforward approach to perform in vivo enucleation.

Enucleation or the surgical removal of an eye can generally be considered as a model for nerve deafferentation. It provides a valuable tool to study the ...

Combined Nucleotide and Protein Extractions in Caenorhabditis elegans

A single biological sample holds a plethora of information, and it is now common practice to simultaneously investigate several macromolecules to capture a full picture of the multiple levels of molecular processing and changes between different conditions. This protocol presents the method of isolating DNA, RNA, and protein from the same sample of the nematode Caenorhabditis elegans to remove the variation introduced when these biomolecules are isolated from replicates of similarly treated but ultimately different samples. Nucleic acids and protein are extracted from the nematode using the acid guanidinium thiocyanate-phenol-chloroform extraction method, with subsequent precipitation, washing, and solubilization of each. We show the successful isolation of RNA, DNA, and protein from a single sample from three strains of nematode and HeLa cells, with better protein isolation results in adult animals. Additionally, guanidinium thiocyanate-phenol-chloroform-extracted protein from nematodes improves the resolution of larger proteins, with enhanced detectable levels as observed by immunoblotting, compared to the traditional RIPA extraction of protein.
The method presented here is useful when investigating samples using a multiomic approach, specifically for the exploration of the proteome and transcriptome. Techniques that simultaneously assess multiomics are appealing because molecular signaling underlying complex biological phenomena is thought to occur at complementary levels; however, it has become increasingly common to see that changes in mRNA levels do not always reflect the same change in protein levels and that the time of collection is relevant in the context of circadian regulations. This method removes any intersample variation when assaying different contents within the same sample (intrasample.)

Combined Nucleotide and Protein Extractions in Caenorhabditis elegans

Here, we present a protocol for the isolation of RNA, DNA, and protein from the same sample, in an effort to reduce variation, improve reproducibility, and facilitate interpretations.

A single biological sample holds a plethora of information, and it is now common practice to simultaneously investigate several macromolecules to capture ...

A Simple Approach to Perform TEER Measurements Using a Self-Made Volt-Amperemeter with Programmable Output Frequency

Transepithelial/endothelial electrical resistance (TEER) has been used since the 1980s to determine confluency and permeability of in vitro barrier model systems. In most cases, chopstick electrodes are used to determine the electric impedance between the upper and lower compartment of a cell culture filter insert system containing cellular monolayers. The filter membrane allows the cells to adhere, polarize, and interact by building tight junctions. This technique has been described with a variety of different cell lines (e.g., cells of the blood-brain barrier, blood-cerebrospinal fluid barrier, or gastrointestinal and pulmonary tract). TEER measurement devices can be readily obtained from different laboratory equipment suppliers. However, there are more cost-effective and customizable solutions imaginable if an appropriate voltammeter is self-assembled. The overall aim of this publication is to set up a reliable device with programmable output frequency that can be used with commercially available chopstick electrodes for TEER measurement.

Here, we demonstrate how to set up an inexpensive volt-amperemeter with programmable output frequency that can be used with commercially available chopstick electrodes for transepithelial/endothelial electrical resistance measurements.

Transepithelial/endothelial electrical resistance (TEER) has been used since the 1980s to determine confluency and permeability of in vitro barrier model ...

A Highly Scalable Approach to Perform Ecological Surveys of Selfing Caenorhabditis Nematodes

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Microfabricated Post-Array-Detectors (mPADs): an Approach to Isolate Mechanical Forces

A Reverse Genetic Approach to Test Functional Redundancy During Embryogenesis

Chromatographic Purification of Highly Active Yeast Ribosomes

Vampiric Isolation of Extracellular Fluid from Caenorhabditis elegans

A Semi-quantitative Approach to Assess Biofilm Formation Using Wrinkled Colony Development

Visualizing Bacteria in Nematodes using Fluorescent Microscopy

Prostaglandin Extraction and Analysis in Caenorhabditis elegans

A Highly Reproducible and Straightforward Method to Perform In Vivo Ocular Enucleation in the Mouse after Eye Opening

Combined Nucleotide and Protein Extractions in Caenorhabditis elegans

A Simple Approach to Perform TEER Measurements Using a Self-Made Volt-Amperemeter with Programmable Output Frequency