We thank Mariko L. Bennett, Liana Nicole Bonanno, and Spyros Darmanis for their help during the development of this protocol. We also thank the Stanford Shared FACS Facility, particularly Meredith Weglarz and Lisa Nichols; Yen Tran, Michael Eckart from Stanford Protein and Nucleic Acid Facility (PAN) for their great support for the filming. This work is funded by the JPB Foundation and Vincent J. Coates Foundation.

All procedures involving rodents conformed to Stanford University guidelines, which comply with national and state laws and policies. All animal procedures were approved by Stanford University's Administrative Panel on Laboratory Animal Care.
NOTE: All solution and buffer compositions are provided in Table of Materials.
1. Preparation on the Day of Cell Isolation
<ol>
	<li>Prepare the following reagents and chill them on ice: medium A (50 mL), magnetic-activated cell sorting (MCS) buffer (30 mL), FACS buffer (25 mL), phosphate-buffered saline (PBS; 30 mL), DNase (320 &#181;L), and RNase inhibitor (30 &#181;L). 
	NOTE: The volumes provided here are sufficient to isolate microglia from 4 brain regions (e.g., cortex, cerebellum, hippocampus and striatum) of a single mouse brain hemisphere. Scale up if more tissues are used.</li>
	<li>Place four clean 2 mL Dounce homogenizers on ice and add 2 mL of medium A with 80 &#181;L of DNase (12,500 units/mL) and 5 &#181;L of RNase inhibitor into each Dounce homogenizer. Chill the pistons in 15 mL tubes.</li>
	<li>Label four 6 cm Petri dishes with brain regions for tissue collection and add 200 &#181;L of cold medium A into each dish on ice. Add about 5 mL of medium A into a 6 cm Petri dish for dissection. 
	NOTE: Prior to use, make sure all reagents are sterile and suitable for RNA applications. Bench and dissection tools need to be clean and sprayed with RNase decontamination solution (Table of Materials).</li>
</ol>
2. Brain Region Dissection
NOTE: This step should take ~30 min.
<ol>
	<li>Inject 400&#8722;500 &#181;L of ketamine/xylazine (24 mg/mL ketamine and 2.4 mg/mL xylazine) into the peritoneum of a juvenile to adult stage mouse (&#62;1 month old). 
	NOTE: A male mouse is used here for illustration, but either gender is suitable.</li>
	<li>Wait for 5 min and pinch a hind paw to ensure lack of retraction.</li>
	<li>Immediately use a 26 G x 3/8 needle to perform transcardial perfusion with 20&#8722;30 mL of ice-cold PBS until buffer runs out with no visible blood.</li>
	<li>Decapitate the mouse with a pair of surgical scissors. Use small scissors to cut open the skin to expose the underneath skull, and then cut through the sagittal suture, lambdoidal suture and coronal suture. Use forceps to pull off both sides of parietal bone and interparietal bone without damaging the tissue, and carefully move the brain into the dissection Petri dish with medium A.</li>
	<li>Use a pre-chilled blade to cut the brain through midline into two hemispheres. 
	NOTE: The four brain regions described here from a single hemisphere yield sufficient numbers of microglia for single-cell or bulk RNA-seq applications. The other hemisphere can be used for immunohistochemistry or RNA in situ validation.</li>
	<li>Separate the cerebellum from the cortical lobe and the brain stem with #55 forceps and transfer the tissue into a collection Petri dish.</li>
	<li>Use #55 forceps to carefully dissect out the hippocampus and the striatum from the cortex and transfer each tissue into a collection Petri dish.</li>
</ol>
3. Mechanical Tissue Dissociation
NOTE: Keep cells and reagents cool all the time except during staining steps. This step should take ~30 min.
<ol>
	<li>Chop each brain tissue with a razor blade into &#60;1 mm3 fine pieces.</li>
	<li>Use 1 mL pipette (with tips cut off) to transfer tissue pieces into the pre-chilled Dounce homogenizers, each containing 2 mL of medium A with DNase and RNase inhibitor.</li>
	<li>Homogenize the tissue by slowly twisting the piston in and out of the Dounce homogenizer for 6&#8722;10 full strokes, until no visible chunks are present. 
	NOTE: Douncing kills neurons and most other glial cells but leave microglial cells rather intact. Both insufficient and over-douncing can lead to low yield of cells.</li>
	<li>Transfer dissociated tissues into 50 mL tubes through 70 &#181;m strainers.</li>
	<li>Rinse each Dounce homogenizer and piston with a total of 6 mL of cold medium A and filter the rinsing solution through the same strainer into the corresponding tube.</li>
	<li>Transfer the single cell suspensions (about 8 mL each) into 15 mL conical tubes and centrifuge at 400 x g for 5 min at 4 &#176;C with brake = 5.</li>
</ol>
4. Myelin Removal
NOTE: This step should take ~60 min.
<ol>
	<li>Prepare 1 large depletion (LD) column (for cortex) and 3 large selection (LS) columns (for the other 3 regions) in a magnetic separator (Table of Materials). Rinse each column with 3 mL of MCS buffer.</li>
	<li>Once centrifugation is finished, pipette out and discard the supernatant without disturbing the pellet. For the cortex and cerebellum tissues, resuspend cells in 850 &#181;L of MCS buffer with 1.8 &#181;L of RNase inhibitor. For hippocampus and striatum tissues, resuspend cells in 400 &#181;L of MCS buffer with 0.9 &#181;L of RNase inhibitor. 
	NOTE: The columns (LD vs. LS) and the volume used for resuspension are optimized based on the amount of myelin present in the tissue. If other brain regions are assayed, these conditions may need to be adjusted depending on the size of the tissue and how much myelin may exist. Effectiveness of myelin removal can be estimated in step 4.9.</li>
	<li>Add 100 &#181;L of myelin removal beads each into cells from cortex and cerebellum and add 50 &#181;L of myelin removal beads each into cells from hippocampus and striatum.</li>
	<li>Gently mix the cells with beads and incubate the tubes on ice for 10 min.</li>
	<li>Bring the volume of the tube with cortical cells to 2 mL with MCS buffer, and all others to 1 mL (i.e., add 1 mL for cortical cells; 500 &#181;L for hippocampal and striatal cells; no need to add buffer to cerebellar cells).</li>
	<li>Once columns are empty of rinsing buffer, place a 15 mL tube below each column. Load cortical cells (2 mL) onto the LD column, and all others (1 mL each) onto the LS columns. Immediately use 1 mL of MCS buffer each to wash the original tubes and load the solution onto the corresponding columns.</li>
	<li>Wash the LD column once with 1 mL of MCS buffer and wash each LS column twice with 1 mL of MCS buffer each wash. Continue to collect the flow-through solution during washing.</li>
	<li>Filter cells into round bottom FACS tubes through 35 &#181;m strainer caps. 
	NOTE: Each tube should collect about 4 mL of single cell suspension depleted of myelin.</li>
	<li>Optionally, take 10 &#181;L of the cell suspension and mix it with 10 &#181;L of 0.4% trypan blue solution. Examine the cells under a 10x bright field microscope to estimate the yield, survival rate and the level of residual myelin. 
	NOTE: A successful preparation should generate over 90% live cells (round in shape and excluding the blue dye) with little to no myelin debris.</li>
	<li>Pellet cells in the FACS tubes at 400 x g for 5 min at 4 &#176;C, with brake = 5. Slowly pour out supernatant and dab the edge of the tube on tissue paper. Resuspend cells in each tube with 300 &#181;L of FACS buffer. 
	NOTE: If MCS sorting is preferred, CD11b beads can be used to select microglia and other myeloid cells following myelin removal. These cells can then be used for non-plate-based scRNA-seq as well as bulk RNA-seq. The caveat of this alternative approach is that CD11b beads do not separate microglia from other related immune cells which are also positive for this antigen.</li>
</ol>
5. Staining for Fluorescence-activated Cell Sorting
NOTE: This step should take ~40 min.
<ol>
	<li>Add 5 &#181;L of mouse Fc receptors block reagent (Table of Materials) into each tube. Incubate for 5 min on ice.</li>
	<li>Add 1 &#181;L of CD45-PE-Cy7 and 1 &#181;L of CD11b-BV421 into each tube. 
	NOTE: Antibodies with other conjugated fluorophores may be used. Antibodies against TMEM119, a specific marker for homeostatic microglia9, can also be included, but it is recommended to be used together with CD45 and CD11b, because certain microglia subpopulations may lose TMEM119 surface expression.</li>
	<li>Incubate the tubes on a shaker for 10 min at room temperature (RT).</li>
	<li>Add 2 mL of FACS buffer to wash.</li>
	<li>Pellet cells at 4 &#176;C, 400 x g for 5 min. Slowly pour out supernatant and dab the edge of the tube on tissue paper. Resuspend cells in each tube using 400 &#181;L of FACS buffer with 1 &#181;L of RNase inhibitor and 0.5 &#181;L of propidium iodide (PI, 1:1,000 dilution).</li>
</ol>
6. Index FACS Sorting
NOTE: This step should take ~1 h.
<ol>
	<li>Following standard FACS procedure, draw gates based on scatter (excluding debris), single cells, live cells (PI negative), microglia and myeloid cells (CD45+, CD11b+). 
	NOTE: Typical microglial cells express CD45 at lower levels compared with other border-associated macrophages, such as perivascular and meningeal macrophages, and therefore gating on CD45 low CD11b+ should be sufficient if the focus of the research is gene expression profiles in these classical microglia1,2. However, certain subsets of microglia may have higher CD45 expression and this is particularly true during development or in disease conditions. To ensure unbiased analysis of microglial gene expression, CD45 high and CD45 low immunophenotypes can be recorded through index sorting setting and both populations collected for sequencing and downstream analysis. In addition, TMEM119 surface expression may be used to target the homeostatic microglial population (see step 5.2) and analyzed together with CD45 levels and the sequencing results.</li>
	<li>Sort single microglia (with a 100 &#181;m nozzle) into 96-well polymerase chain reaction (PCR) plates, containing 4 &#181;L of lysis buffer each well (see the published protocol14 for details). 
	NOTE: The External RNA Control Consortium (ERCC) RNA spike-in mix (Table of Materials) can be added at 1:2.4 x 107 in the lysis buffer for quality control and normalization purposes2.</li>
	<li>Briefly vortex the plates and spin down using a bench-top centrifuge.</li>
	<li>Immediately freeze the samples on dry ice. Store the plates at -80 &#176;C until library preparation. 
	NOTE: Alternatively, more cells can be collected into 1.5 mL tubes with RNA extraction buffer for bulk RNA-seq. According to authors' experience, 3,000 cells are sufficient to generate good quality libraries following the published protocol2,14.</li>
</ol>
7. Single-cell RNA-sequencing Library Preparation
NOTE: Here, the published protocol14 is followed to generate scRNA-seq libraries with the aid of liquid handling robotics and a few modifications. In this article, the procedure is only briefly described, and the differences are highlighted. Processing 4 plates simultaneously takes about 2.5 days.
<ol>
	<li>Thaw plates on ice and perform reverse transcription with Oligo-dT30VN primer (in the lysis buffer) to generate cDNA with thermal cyclers (Table 1): 42 &#176;C 90 min; 70 &#176;C 5 min; 4 &#176;C hold. Then amplify cDNA with an additional exonuclease digestion step at the beginning (Table 2) using the PCR master mix and in situ PCR (ISPCR) primers (Table of Materials) and the following PCR condition: 37 &#176;C 30 min; 95 &#176;C 3 min; 23 cycles of 98 &#176;C 20 s, 67 &#176;C 15 s, 72 &#176;C 4 min; 72 &#176;C 5 min.</li>
	<li>Purify cDNA using 18 &#181;L of magnetic beads per well (0.7:1 ratio). Incubate the plate on a magnetic stand for 5 min and wash samples twice with freshly made 80% ethanol, 80 &#181;L per well each time. After drying the plate for 15-20 min, elute cDNA with 20 &#181;L of elution buffer per well. 
	NOTE: For quality control, use a fragment analyzer (high sensitivity next-generation sequencing [NGS] fragment analysis, 1&#8722;6,000 bp) to check size distributions and concentrations of cDNA, and only further process samples with a smear between 500&#8722;5,000 bp, and higher than 0.05 ng/&#181;L.</li>
	<li>To generate libraries, mix 0.4 &#181;L of each cDNA sample with 1.2 &#181;L of Tn5 tagmentation reagents from the library preparation kit (Table of Materials) in a 384-well plate with the aid of a nanoliter pipetting machine, at 55 &#176;C 10 min. 
	NOTE: Here, 1/12.5 of the suggested reaction volume (5 &#181;L sample and 15 &#181;L of tagmentation reagents) is added in order to reduce cost and meanwhile increase throughput. A nanoliter pipetting machine (Table of Materials) is used to transfer reagents (this and following steps) from and to 384-well plates.</li>
	<li>Add 0.4 &#181;L of neutralization buffer to stop the tagmentation reaction at RT for 5 min.</li>
	<li>Add 384 indexes (Table of Materials, 0.4 &#181;L forward and 0.4 &#181;L reverse), 1.2 &#181;L of PCR mix to samples (2 &#181;L each), and amplify the libraries using the following condition: 72 &#176;C 3 min; 95 &#176;C 30 s; 10 cycles of 95 &#176;C 10 s, 55 &#176;C 30 s, 72 &#176;C 1 min; 72 &#176;C 5 min.</li>
	<li>Pool all individual libraries (take 1 &#181;L each) from the same 384-well plate together, and use magnetic beads (Table of Materials, 0.7:1 ratio) to purify the final pooled libraries.</li>
	<li>Use a fluorometer (Table of Materials) to measure the concentrations and a bioanalyzer (Table of Materials) to examine the size distributions of pooled libraries before sequencing. Target the sequencing depth at 1 million raw reads per cell.</li>
	<li>Follow standard bioinformatic procedures to filter and trim sequencing reads and perform alignment2. Use the count table and meta data as inputs to do clustering analysis with the Seurat package15.</li>
</ol>

<ol>
	<li>Li, Q., Barres, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglia+and+macrophages+in+brain+homeostasis+and+disease.">Microglia and macrophages in brain homeostasis and disease.</a> Nature Reviews Immunology. 18 (4), 225-242 (2018).</li><li>Li, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Developmental+Heterogeneity+of+Microglia+and+Brain+Myeloid+Cells+Revealed+by+Deep+Single-Cell+RNA+Sequencing.">Developmental Heterogeneity of Microglia and Brain Myeloid Cells Revealed by Deep Single-Cell RNA Sequencing.</a> Neuron. 101 (2), 207-223 (2019).</li><li>Keren-Shaul, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Unique+Microglia+Type+Associated+with+Restricting+Development+of+Alzheimer's+Disease.">A Unique Microglia Type Associated with Restricting Development of Alzheimer's Disease.</a> Cell. 169 (7), 1276-1290 (2017).</li><li>Bohlen, C. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diverse+Requirements+for+Microglial+Survival,+Specification,+and+Function+Revealed+by+Defined-Medium+Cultures.">Diverse Requirements for Microglial Survival, Specification, and Function Revealed by Defined-Medium Cultures.</a> Neuron. 94 (4), 759-773 (2017).</li><li>Guerreiro, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TREM2+variants+in+Alzheimer's+disease.">TREM2 variants in Alzheimer's disease.</a> New England Journal of Medicine. 368 (2), 117-127 (2013).</li><li>Jonsson, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Variant+of+TREM2+associated+with+the+risk+of+Alzheimer's+disease.">Variant of TREM2 associated with the risk of Alzheimer's disease.</a> New England Journal of Medicine. 368 (2), 107-116 (2013).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA-sequencing+transcriptome+and+splicing+database+of+glia,+neurons,+and+vascular+cells+of+the+cerebral+cortex.">An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex.</a> Journal of Neuroscience. 34 (36), 11929-11947 (2014).</li><li>Colonna, M., Butovsky, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglia+Function+in+the+Central+Nervous+System+During+Health+and+Neurodegeneration.">Microglia Function in the Central Nervous System During Health and Neurodegeneration.</a> Annual Review of Immunology. 35, 441-468 (2017).</li><li>Bennett, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+tools+for+studying+microglia+in+the+mouse+and+human+CNS.">New tools for studying microglia in the mouse and human CNS.</a> Proceedings of the National Academy of Sciences of the United States of America. 113 (12), 1738-1746 (2016).</li><li>Hammond, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-Cell+RNA+Sequencing+of+Microglia+throughout+the+Mouse+Lifespan+and+in+the+Injured+Brain+Reveals+Complex+Cell-State+Changes.">Single-Cell RNA Sequencing of Microglia throughout the Mouse Lifespan and in the Injured Brain Reveals Complex Cell-State Changes.</a> Immunity. 50 (1), 253-271 (2019).</li><li>Van Hove, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single-cell+atlas+of+mouse+brain+macrophages+reveals+unique+transcriptional+identities+shaped+by+ontogeny+and+tissue+environment.">A single-cell atlas of mouse brain macrophages reveals unique transcriptional identities shaped by ontogeny and tissue environment.</a> Nature Neuroscience. 22 (6), 1021-1035 (2019).</li><li>Chen, G., Ning, B., Shi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-Cell+RNA-Seq+Technologies+and+Related+Computational+Data+Analysis.">Single-Cell RNA-Seq Technologies and Related Computational Data Analysis.</a> Frontiers in Genetics. 10, 317 (2019).</li><li>Svensson, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Power+analysis+of+single-cell+RNA-sequencing+experiments.">Power analysis of single-cell RNA-sequencing experiments.</a> Nature Methods. 14 (4), 381-387 (2017).</li><li>Picelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Full-length+RNA-seq+from+single+cells+using+Smart-seq2.">Full-length RNA-seq from single cells using Smart-seq2.</a> Nature Protocols. 9 (1), 171-181 (2014).</li><li>Macosko, E. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+Parallel+Genome-wide+Expression+Profiling+of+Individual+Cells+Using+Nanoliter+Droplets.">Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets.</a> Cell. 161 (5), 1202-1214 (2015).</li><li>Ziegenhain, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+Analysis+of+Single-Cell+RNA+Sequencing+Methods.">Comparative Analysis of Single-Cell RNA Sequencing Methods.</a> Molecular Cell. 65 (4), 631-643 (2017).</li><li>Tabula Muris, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+transcriptomics+of+20+mouse+organs+creates+a+Tabula+Muris.">Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris.</a> Nature. 562 (7727), 367-372 (2018).</li><li>Bohlen, C. J., Bennett, F. C., Bennett, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Culture+of+Microglia.">Isolation and Culture of Microglia.</a> Current Protocols in Immunology. 125 (1), 70 (2018).</li><li>Haimon, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Re-evaluating+microglia+expression+profiles+using+RiboTag+and+cell+isolation+strategies.">Re-evaluating microglia expression profiles using RiboTag and cell isolation strategies.</a> Nature Immunology. 19 (6), 636-644 (2018).</li><li>Collins, H. Y., Bohlen, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Culture+of+Rodent+Microglia+to+Promote+a+Dynamic+Ramified+Morphology+in+Serum-free+Medium.">Isolation and Culture of Rodent Microglia to Promote a Dynamic Ramified Morphology in Serum-free Medium.</a> Journal of Visualized Experiments. (133), e57122 (2018).</li><li>Nikodemova, M., Watters, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+isolation+of+live+microglia+with+preserved+phenotypes+from+adult+mouse+brain.">Efficient isolation of live microglia with preserved phenotypes from adult mouse brain.</a> Journal of Neuroinflammation. 9, 147 (2012).</li><li>Swartzlander, D. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concurrent+cell+type-specific+isolation+and+profiling+of+mouse+brains+in+inflammation+and+Alzheimer's+disease.">Concurrent cell type-specific isolation and profiling of mouse brains in inflammation and Alzheimer's disease.</a> Journal of Clinical Investigation Insight. 3 (13), 121109 (2018).</li><li>Hennig, B. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-Scale+Low-Cost+NGS+Library+Preparation+Using+a+Robust+Tn5+Purification+and+Tagmentation+Protocol.">Large-Scale Low-Cost NGS Library Preparation Using a Robust Tn5 Purification and Tagmentation Protocol.</a> G3. 8 (1), 79-89 (2018).</li></ol>

The authors have nothing to disclose.

Microglia actively interact with other cell types in the CNS, and they are very sensitive to environmental stimuli. In order to minimize inflammatory responses and aberrant changes in their gene expression during the isolation process, this protocol has been streamlined from a previously published method9, and it is now suitable to isolate microglia from multiple regions of a single mouse brain hemisphere in parallel. The tissues and reagents are kept at cold temperature and experiments are perfor...

Microglia, representing 5%&#8722;10% of all neural cells, are resident macrophages scattered throughout the central nervous system (CNS)1. Protected behind blood-brain barrier, typical microglia in a healthy adult brain contain many fine processes that rapidly extend and retract to interact with neurons and other glial cells in the parenchyma. Microglia can also adopt the amoeboid morphology associated with increased phagocytic function during specific developmental stages or upon immune challenges in injury and disease1,2,3,4. Recent exciting discoveries have clearly demonstrated that microglia are by no means passive bystanders to brain-derived or pathological signals, but play pivotal roles in controlling brain development and homeostasis, for instance, by supporting neuronal survival, pruning immature synapses, promoting oligodendrocyte lineage cells differentiation as well as angiogenesis1. As more functions of microglia are elucidated, the excitement is further fueled by human genetics studies, which showed that many neurodegenerative disease risk genes, such as TREM2, are predominantly or exclusively expressed by microglia5,6,7. Given their significance in development and plausible disease-driving roles, tremendous effort has recently been put towards our understanding of microglial gene regulation and function in hope of finding new therapeutic targets for neurodegenerative diseases1,8.
RNA sequencing (RNA-seq) allows unbiased characterization of cell type-specific gene expression, which in turn guides scientists to investigate gene functions in dense cellular networks7. RNA-seq had been mostly done on bulk samples, leading to the discovery of a homeostatic microglial gene signature that distinguishes them from other neural and immune cells9. However, such an approach could overlook molecular and functional differences among microglia, especially those transiently present in development, or associated with aging and disease. Indeed, single-cell RNA-seq (scRNA-seq) offers the sensitivity and resolution that have revolutionized the field by revealing previously underappreciated heterogeneity of microglia in a variety of contexts2,3,10. In addition, due to the presence of other similar immune cells at the CNS-circulation interface, scRNA-seq provides information aiding the design of new tools to separate and functionally dissect these related cells with little prior knowledge2,11.
A diverse array of scRNA-seq platforms have been invented, each suitable for certain applications12. In general, droplet-based methods, such as 10x Genomics, are higher in throughput with (tens of) thousands of cells sequenced in each run, and they are less selective for the input which may contain mixed cell populations requiring broad categorization. Plate-based methods provide higher sensitivity and read depth13,14, usually targeting specific populations from cell sorting to reveal subtle differences or rare transcripts. Given the small percentage of microglial cells, particularly those development- or disease-associated subpopulations, among all CNS cell types, it is often desirable to isolate microglia from a specific region of interest and obtain deep and full-length transcriptomic information in order to understand their heterogeneity.
Here, we provide details on how to isolate microglia from different mouse brain regions dissected from a single hemisphere, which are used for single-cell (or bulk) RNA-seq following a semi-automated plate-based library preparation procedure. The other hemisphere can then be used for histological validation. Streamlined from a previously published method9, this isolation protocol aims to maximize the yield from small amount of starting materials, and meanwhile maintain endogenous microglial gene expression profiles. We use fluorescence-activated cell sorting (FACS) to enrich microglia (or other related immune cells of interest) into 96-well plates and miniaturize the volumes of reagents for library preparation in order to increase throughput. We highlight this sensitive scRNA-seq platform, although other plate-based strategies may be applied. This method can be easily adapted to isolate microglia from other dissected tissues, such as injury or disease foci, and the age of the mouse can vary across almost any postnatal stages. Efficient isolation of regional microglia for single-cell transcriptomics studies will facilitate better understanding of their functions in health and disease.

<table><tbody><tr><td>5 M Betaine</td><td>Sigma-Aldrich</td><td>Cat# B0300-5VL</td><td></td></tr><tr><td>10 mM dNTP mix</td><td>Thermo Fisher Scientific</td><td>Cat# R0192</td><td></td></tr><tr><td>0.5 M EDTA, pH 8.0</td><td>Thermo Fisher Scientific</td><td>Cat# 15575020</td><td></td></tr><tr><td>10X Hanks&amp;rsquo; Balanced Salt Solution</td><td>Thermo Fisher Scientific</td><td>Cat# 14185-052</td><td></td></tr><tr><td>1 M HEPES</td><td>Thermo Fisher Scientific</td><td>Cat# 15630080</td><td></td></tr><tr><td>1X KAPA HIFI Hotstart Master Mix</td><td>Kapa Biosciences</td><td>Cat# KK2602</td><td></td></tr><tr><td>5 mL Round Bottom Polystyrene Tube, with Cell Strainer Cap</td><td>Corning</td><td>Cat# 352235</td><td></td></tr><tr><td>AATI, High Sensitivity NGS Fragment Analysis Kit (1 bp &amp;ndash; 6,000 bp)</td><td>Advanced Analytical</td><td>Cat# DNF-474-1000</td><td></td></tr><tr><td>Bovine Serum Albumin</td><td>Sigma Aldrich</td><td>Cat# A8806</td><td></td></tr><tr><td>DNase I</td><td>Worthington</td><td>Cat# LS002007</td><td>Working solution: 12500 units/ml</td></tr><tr><td>DTT, Molecular Grade</td><td>Promega</td><td>Cat# P1171</td><td></td></tr><tr><td>ERCC RNA Spike-In Mix</td><td>Thermo Fisher Scientific</td><td>Cat# 4456740</td><td></td></tr><tr><td>Fetal Bovine Serum</td><td>Thermo Fisher Scientific</td><td>Cat# 10437-028</td><td></td></tr><tr><td>Illumina XT Index Kit v2 Set A (96 indexes)</td><td>Illumina</td><td>Cat# FC-131-2001</td><td></td></tr><tr><td>Illumina XT Index Kit v2 Set B (96 indexes)</td><td>Illumina</td><td>Cat# FC-131-2002</td><td></td></tr><tr><td>Illumina XT Index Kit v2 Set C (96 indexes)</td><td>Illumina</td><td>Cat# FC-131-2003</td><td></td></tr><tr><td>Illumina XT Index Kit v2 Set D (96 indexes)</td><td>Illumina</td><td>Cat# FC-131-2004</td><td></td></tr><tr><td>Lambda Exonuclease (5 U/&amp;mu;l)</td><td>New England BioLabs</td><td>Cat# M0262S</td><td></td></tr><tr><td>Mouse Fc block</td><td>BD Pharmingen</td><td>Cat# 553142</td><td></td></tr><tr><td>Myelin removal beads</td><td>Miltenyl Biotec</td><td>Cat# 130-096-433</td><td></td></tr><tr><td>Nextera XT DNA Sample Prep Kit</td><td>Illumina</td><td>Cat# FC-131-1096</td><td></td></tr><tr><td>NextSeq 500/550 High Output Kit v2.5 (150 Cycles)</td><td>Illumina</td><td>Cat# 20024907</td><td></td></tr><tr><td>PBS (10X), pH 7.4</td><td>Thermo Fisher Scientific</td><td>Cat# 70011044</td><td></td></tr><tr><td>PCRClean DX beads</td><td>Aline Biosciences</td><td>Cat# C-1003-50</td><td></td></tr><tr><td>Propidium Iodide</td><td>Thermo Fisher Scientific</td><td>Cat# P3566</td><td>Staining: 1:1000</td></tr><tr><td>Qubit dsDNA HS Assay Kit</td><td>Thermal Fisher Scientific</td><td>Cat# Q32851</td><td></td></tr><tr><td>Rat monoclonal anti mouse/human CD11b, Brilliant Violet 421 (clone M1/70)</td><td>BioLegend</td><td>Cat# 101236; RRID: AB_11203704</td><td>Staining: 1:300</td></tr><tr><td>Rat monoclonal anti mouse CD45, PE/Cy7 (clone 30-F11)</td><td>Thermo Fisher Scientific</td><td>Cat# 25-0451-82; RRID: AB_469625</td><td>Staining: 1:300</td></tr><tr><td>Recombinant RNase Inhibitor</td><td>Takara Bio</td><td>Cat# 2313B</td><td></td></tr><tr><td>SMARTScribe Reverse Transcriptase (100 U/&amp;mu;l)</td><td>Clontech</td><td>Cat# 639538</td><td>Containing 5x First strand buffer</td></tr><tr><td>&lt;strong&gt;Oligonucleotides&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>0.1 &amp;mu;M ISPCR Oligo: 5&#039; - AAGCAGTGGTATCAA&lt;br/&gt;CGCAGAGT-3&#039;</td><td></td><td></td><td>(Picelli et al., 2014)</td></tr><tr><td>Oligo-dT30VN primer: 5&#039; - AAGCAGTGGTATCAACGCA&lt;br/&gt;GAGTACT 30 VN-3&#039;</td><td></td><td></td><td>(Picelli et al., 2014)</td></tr><tr><td>TSO 5&#039; - AAGCAGTGGTATCAACGCAGA&lt;br/&gt;GTACATrGrG+G-3&#039; (&quot;r&quot; is forribobases and &quot;+&quot; is for an LNA base)</td><td></td><td></td><td>(Picelli et al., 2014)</td></tr><tr><td>&lt;strong&gt;Solutions&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>FACS buffer</td><td></td><td></td><td>Recipe: sterile-filtered 1% FBS, 2 mM EDTA, 25 mM HEPES in 1X PBS</td></tr><tr><td>MCS buffer</td><td></td><td></td><td>Recipe: sterile-filtered 0.5% BSA, 2 mM EDTA in 1X PBS</td></tr><tr><td>Medium A</td><td></td><td></td><td>Recipe: 15 mM HEPES, 0.5% glucose in 1X HBSS without phenol red</td></tr><tr><td>&lt;strong&gt;Plates&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>384-well Rigi-Plate PCR Microplates, Axygen Scientific</td><td>VWR</td><td>89005-556</td><td></td></tr><tr><td>Hard-shell 96-well PCR plates</td><td>Bio-Rad</td><td>HSP9631</td><td></td></tr><tr><td>&lt;strong&gt;Others&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Dumont #55 forceps</td><td>Fine Science Tools</td><td>11295-51</td><td></td></tr><tr><td>Dounce homogenizer, 2 ml</td><td>Wheaton</td><td>357422</td><td></td></tr><tr><td>Large depletion column</td><td>Miltenyi Biotec</td><td>130-042-901</td><td></td></tr><tr><td>Large selection column</td><td>Miltenyi Biotec</td><td>130-042-401</td><td></td></tr><tr><td>MACS MultiStand</td><td>Miltenyi Biotec</td><td>130-042-303</td><td></td></tr><tr><td>QuadroMACS Separator</td><td>Miltenyi Biotec</td><td>130-090-976</td><td></td></tr><tr><td>RNAzap</td><td>Thermo Fisher Scientific</td><td>AM9780</td><td></td></tr><tr><td>Strainer (70 &amp;mu;m)</td><td>Falcon</td><td>352350</td><td></td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>BD FACSAria II</td><td>BD Biosciences</td><td>&lt;a href=&quot;http://www.bdbiosciences.com/documents/BD_FACSAria_II_cell_sorter_brochure.pdf&quot; target=&quot;_blank&quot;&gt;http://www.bdbiosciences.com/&lt;/a&gt;</td><td></td></tr><tr><td>Bioanalyzer</td><td>Agilent</td><td>2100</td><td></td></tr><tr><td>Fragment Analyzer</td><td>Agilent</td><td>5300</td><td></td></tr><tr><td>Mosquito HTS nanoliter pipetting robot</td><td>TTP Labtech</td><td>&lt;a href=&quot;https://www.ttplabtech.com/products/liquid-handling/mosquito-hts/&quot; target=&quot;_blank&quot;&gt;https://www.ttplabtech.com/&lt;/a&gt;</td><td></td></tr><tr><td>Qubit 4 Fluorometer</td><td>Thermo Fisher Scientific</td><td>Q33226</td><td></td></tr></tbody></table>

isolation of region-specific microglia from one adult mouse brain hemisphere for deep single-cell rna sequencing

As resident macrophages in the central nervous system, microglia actively control brain development and homeostasis, and their dysfunctions may drive human diseases. Considerable advances have been made to uncover the molecular signatures of homeostatic microglia as well as alterations of their gene expression in response to environmental stimuli. With the advent and maturation of single-cell genomic methodologies, it is increasingly recognized that heterogenous microglia may underlie the diverse roles they play in different developmental and pathological conditions. Further dissection of such heterogeneity can be achieved through efficient isolation of microglia from a given region of interest, followed by sensitive profiling of individual cells. Here, we provide a detailed protocol for the rapid isolation of microglia from different brain regions in a single adult mouse brain hemisphere. We also demonstrate how to use these sorted microglia for plate-based deep single-cell RNA sequencing. We discuss the adaptability of this method to other scenarios and provide guidelines for improving the system to accommodate large-scale studies.

This protocol describes a method to isolate and sort microglia from different brain regions in one adult perfused brain hemisphere, followed by scRNA-seq. We use douncing to create single cell suspension and also as a first step to enrich microglia. Insufficient or over-douncing reduces the yield. In addition, adult mouse brains contain high levels of myelin, which can also reduce sorting efficiency and yield if not removed properly. Therefore, we examine the cell suspension under microscope by using trypan blue and a he...

Watch this Scientific Journal Video about Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing at JoVE.com

Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing

We provide a protocol for isolation of microglia from different dissected regions of an adult mouse brain hemisphere, followed by semi-automated library preparation for deep single-cell RNA sequencing of full-length transcriptomes. This method will help to elucidate functional heterogeneity of microglia in health and disease.

As resident macrophages in the central nervous system, microglia actively control brain development and homeostasis, and their dysfunctions may drive ...

isolation-region-specific-microglia-from-one-adult-mouse-brain

Universidad de Cartagena UDEC

Research

JoVE Journal

Neuroscience

10.7K Views.  Stanford University School of Medicine. We provide a protocol for isolation of microglia from different dissected regions of an adult mouse brain hemisphere, followed by semi-automated library preparation for deep single-cell RNA sequencing of full-length transcriptomes. This method will help to elucidate functional heterogeneity of microglia in health and disease.

Video: Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing

Non-Laser Capture Microscopy Approach for the Microdissection of Discrete Mouse Brain Regions for Total RNA Isolation and Downstream Next-Generation Sequencing and Gene Expression Profiling

As technological platforms, approaches such as next-generation sequencing, microarray, and qRT-PCR have great promise for expanding our understanding of the breadth of molecular regulation. Newer approaches such as high-resolution RNA sequencing (RNA-Seq)1 provides new and expansive information about tissue- or state-specific expression such as relative transcript levels, alternative splicing, and micro RNAs2-4. Prospects for employing the RNA-Seq method in comparative whole transcriptome profiling5 within discrete tissues or between phenotypically distinct groups of individuals affords new avenues for elucidating molecular mechanisms involved in both normal and abnormal physiological states. Recently, whole transcriptome profiling has been performed on human brain tissue, identifying gene expression differences associated with disease progression6. However, the use of next-generation sequencing has yet to be more widely integrated into mammalian studies.
Gene expression studies in mouse models have reported distinct profiles within various brain nuclei using laser capture microscopy (LCM) for sample excision7,8. While LCM affords sample collection with single-cell and discrete brain region precision, the relatively low total RNA yields from the LCM approach can be prohibitive to RNA-Seq and other profiling approaches in mouse brain tissues and may require sub-optimal sample amplification steps. Here, a protocol is presented for microdissection and total RNA extraction from discrete mouse brain regions. Set-diameter tissue corers are used to isolate 13 tissues from 750-&mu;m serial coronal sections of an individual mouse brain. Tissue micropunch samples are immediately frozen and archived. Total RNA is obtained from the samples using magnetic bead-enabled total RNA isolation technology. Resulting RNA samples have adequate yield and quality for use in downstream expression profiling. This microdissection strategy provides a viable option to existing sample collection strategies for obtaining total RNA from discrete brain regions, opening possibilities for new gene expression discoveries.

Non-Laser Capture Microscopy Approach for the Microdissection of Discrete Mouse Brain Regions for Total RNA Isolation and Downstream Next-Generation Sequencing and Gene Expression Profiling  |

RNA expression profiling of discrete mouse brain regions requires a precise and repeatable tissue collection strategy. A protocol that uses both coronal brain sectioning and tissue corer-assisted microdissection is described here. The yield and quality of total RNA obtained from the resulting samples confirms the utility of the outlined method.

As technological platforms, approaches such as next-generation sequencing, microarray, and qRT-PCR have great promise for expanding our understanding of ...

Isolation of Cortical Microglia with Preserved Immunophenotype and Functionality From Murine Neonates

Isolation of microglia from CNS tissue is a powerful investigative tool used to study microglial biology ex vivo. The present method details a procedure for isolation of microglia from neonatal murine cortices by mechanical agitation with a rotary shaker. This microglia isolation method yields highly pure cortical microglia that exhibit morphological and functional characteristics indicative of quiescent microglia in normal, nonpathological conditions in vivo. This procedure also preserves the microglial immunophenotype and biochemical functionality as demonstrated by the induction of morphological changes, nuclear translocation of the p65 subunit of NF-&#954;B (p65), and secretion of the hallmark proinflammatory cytokine, tumor necrosis factor-&#945; (TNF-&#945;), upon lipopolysaccharide (LPS) and Pam3CSK4 (Pam) challenges. Therefore, the present isolation procedure preserves the immunophenotype of both quiescent and activated microglia, providing an experimental method of investigating microglia biology in ex vivo conditions.

One key to successful investigation of microglial biology is the preservation of microglial immunofunction ex vivo during isolation from CNS tissue. Isolating microglia via rotary shaking results in highly pure and immunofunctional cell cultures as assessed by fluorescent imaging, immunocytochemistry, and ELISA following microglia activation with the proinflammatory stimuli lipopolysaccharide (LPS) and Pam3CSK4 (Pam).

Isolation of microglia from CNS tissue is a powerful investigative tool used to study microglial biology ex vivo. The present method details a procedure ...

Immunology and Infection

Dissection and Isolation of Murine Glia from Multiple Central Nervous System Regions

The methods presented here demonstrate laboratory procedures for the dissection of four different regions of the central nervous system (CNS) from murine neonates for the isolation of glial subpopulations. The purpose of the procedure is to dissociate microglia, oligodendrocyte progenitor cells (OPCs), and astrocytes from cortical, cerebellar, brainstem, and spinal cord tissue to facilitate further in vitro analysis. The CNS region isolation procedures allow for the determination of regional heterogeneity among glia in multiple cell culture systems. Rapid CNS region isolation is performed, followed by the mechanical removal of meninges to prevent meningeal cell contamination of glia. This protocol combines gentle tissue dissociation and plating on a specified matrix designed to preserve cell integrity and adherence. Isolating mixed glia from multiple CNS regions provides a comprehensive analysis of potentially heterogenous glia while maximizing the use of individual experimental animals. Additionally, following dissociation of regional tissue, mixed glia are further divided into multiple cell types including microglia, OPCs, and astrocytes for use in either single cell type, cell culture plate inserts, or co-culture systems. Overall, the demonstrated techniques provide a comprehensive protocol of broad applicability for careful dissection of four individual CNS regions from murine neonates and includes methods for the isolation of three individual glia cell types to examine regional heterogeneity in any number of in vitro cell culture systems or assays.

Here we present a protocol for in vitro isolation of multiple glial cell populations from a mouse CNS. This method allows for the segregation of regional microglia, oligodendrocyte precursor cells, and astrocytes to study the phenotypes of each in a variety of culture systems.

The methods presented here demonstrate laboratory procedures for the dissection of four different regions of the central nervous system (CNS) from murine ...

Isolation of Adult Human Astrocyte Populations from Fresh-Frozen Cortex Using Fluorescence-Activated Nuclei Sorting

The complexity of human astrocytes remains poorly defined in primary human tissue, requiring better tools for their isolation and molecular characterization. Fluorescence-activated nuclei sorting (FANS) can be used to successfully isolate and study human neuronal nuclei (NeuN+) populations from frozen archival tissue, thereby avoiding problems associated with handling&#160;fresh tissue. However, efforts to similarly isolate astroglia from the non-neuronal (NeuN-) element are lacking. A recently developed and validated immunotagging strategy uses three transcription factor antibodies to simultaneously isolate enriched neuronal (NeuN+), astrocyte (paired box protein 6 (PAX6)+NeuN-), and oligodendrocyte progenitor (OLIG2+NeuN-) nuclei populations from non-diseased, fresh (unfixed) snap-frozen&#160;postmortem human temporal neocortex tissue.
This technique was shown to be useful for the characterization of cell type-specific transcriptome alterations in primary pathological epilepsy neocortex. Transcriptomic analyses confirmed that PAX6+NeuN- sorted populations are robustly enriched for pan-astrocyte markers and capture astrocytes in both resting and reactive conditions. This paper describes the FANS methodology for the isolation of astrocyte-enriched nuclei populations from fresh-frozen human cortex, including tissue dissociation into single-nucleus (sn) suspension; immunotagging of nuclei with anti-NeuN and anti-PAX6 fluorescently conjugated antibodies; FANS gating strategies and quality control metrics for optimizing sensitivity and specificity during sorting and for confirming astrocyte enrichment; and recommended procurement for downstream transcriptome and chromatin accessibility sequencing at bulk or sn resolution. This protocol is applicable for non-necrotic, fresh-frozen, human cortical specimens with various pathologies and recommended postmortem tissue collection within 24 h.

We have developed a method that enriches for and isolates human astrocyte populations from fresh-frozen tissue for use in downstream molecular analyses.

The complexity of human astrocytes remains poorly defined in primary human tissue, requiring better tools for their isolation and molecular ...

Isolation of Mouse Primary Microglia by Magnetic-Activated Cell Sorting in Animal Models of Demyelination

Microglia, the resident innate immune cells in the brain, are the primary responders to inflammation or injury in the central nervous system (CNS). Microglia can be divided into resting state and activated state and can rapidly change state in response to the microenvironment of the brain. Microglia will be activated under different pathological conditions and exhibit different phenotypes. In addition, there are many different subgroups of activated microglia and great heterogeneity between different subgroups. The heterogeneity mainly depends on the molecular specificity of microglia. Studies have revealed that microglia will be activated and play an important role in the pathological process of inflammatory demyelination. To better understand the characteristics of microglia in inflammatory demyelinating diseases such as multiple sclerosis and neuromyelitis optica spectrum disorder, we propose a perilesional primary microglial sorting protocol. This protocol utilizes columnar magnetic-activated cell sorting (MACS) to obtain highly purified primary microglia and preserve the molecular characteristics of microglia to investigate the potential effects of microglia in inflammatory demyelinating diseases.

Here, we present a protocol to isolate and purify primary microglia in animal models of demyelinating diseases, utilizing columnar magnetic-activated cell sorting.

Microglia, the resident innate immune cells in the brain, are the primary responders to inflammation or injury in the central nervous system (CNS). ...

Efficient Extraction of Astrocytes and Microglia from the Adult Mouse Spinal Cord

Isolation of Pure Astrocytes and Microglia from the Adult Mouse Spinal Cord For In Vitro Assays and Transcriptomic Studies

Astrocytes and microglia play pivotal roles in central nervous system development, injury responses, and neurodegenerative diseases. These highly dynamic cells exhibit rapid responses to environmental changes and display significant heterogeneity in terms of morphology, transcriptional profiles, and functions. While our understanding of the functions of glial cells in health and disease has advanced substantially, there remains a need for in vitro, cell-specific analyses conducted in the context of insults or injuries to comprehensively characterize distinct cell populations. Isolating cells from the adult mouse offers several advantages over cell lines or neonatal animals, as it allows for the analysis of cells under pathological conditions and at specific time points. Furthermore, focusing on spinal cord-specific isolation, excluding brain involvement, enables research into spinal cord pathologies, including experimental autoimmune encephalomyelitis, spinal cord injury, and amyotrophic lateral sclerosis. This protocol presents an efficient method for isolating astrocytes and microglia from the adult mouse spinal cord, facilitating immediate or future analysis with potential applications in functional, molecular, or proteomic downstream studies.

Author Spotlight: Isolation of Glial Cells from the Adult Mouse Spinal Cord 

This protocol outlines the isolation of purified astrocytes and microglia from the adult mouse spinal cord, facilitating subsequent applications such as RNA analysis and cell culture. It includes detailed cell dissociation methods and procedures designed to enhance both the quality and yield of isolated cells.

Astrocytes and microglia play pivotal roles in central nervous system development, injury responses, and neurodegenerative diseases. These highly dynamic ...

Isolation of Hypothalamic Microglia from Mice Using MACS for In Vitro Assays

Isolation of Hypothalamic Microglia from Freshly Perfused Adult Mouse Brain by Magnetic-Activated Cell Sorting

Microglia, as the resident macrophages of the brain, are essential for maintaining brain homeostasis. They shape neuronal circuits during development, survey their environment for debris or dead cells, as well as respond to infection and injury in the brain, among many other functions. However, their important role in neurodevelopment and synaptic plasticity and pathophysiology has not been fully defined, highlighting the need for further investigation. To gain a more comprehensive understanding of the role of microglia in these processes, we need to isolate microglia and characterize them genetically, metabolically, and functionally. However, the isolation of microglia from adult mice, especially from small brain structures, is challenging as they represent a small percentage of the total brain cells, and the yield of isolated microglia is often too low. Here, the magnetic isolation of microglia using CD11b+ microbeads allows us to sort microglial cells from the hypothalamus of a freshly perfused adult mouse brain. The current method allows us to achieve relatively high purity and yield in a short period while maintaining cell viability.

Author Spotlight: Investigating the Impact of Nutrition on Mouse Brain Function and Metabolic Disorders 

We describe a protocol for isolating microglial cells from the mouse hypothalamus (or equivalent small brain structures) using magnetically activated cell sorting (MACS), in a relatively short time. The MACS-sorted hypothalamic microglia can be used for ex vivo analysis and can be plated to perform in vitro assays.

Microglia, as the resident macrophages of the brain, are essential for maintaining brain homeostasis. They shape neuronal circuits during development, ...

Electrophysiological Recording of Hippocampal Microglia from Adult Mice

Isolation and Whole-Cell Patch-Clamp Recording of Hippocampal Microglia from Adult Mice

Microglia are resident immune cells in the brain that interact with neurons to maintain the homeostasis of the central nervous system (CNS). Studies show that the microglial surface expresses potassium channels that regulate microglial activation, while abnormalities in these potassium channels can lead to neural diseases. Currently, whole-cell patch-clamp recordings of microglia are mostly performed on cultured primary microglia from fetal or newborn mice due to difficulties in conducting electrophysiological evaluations on acutely isolated microglia. This study introduces an easy-to-follow protocol for isolating hippocampal microglia from adult mice and performing whole-cell patch-clamp recordings on the isolated cells. Briefly, the brain was removed from a mouse after decapitation, the hippocampus was dissected bilaterally, and microglia were isolated using an adult mouse brain dissociation kit. The microglia were then purified using a magnetic-activated cell sorting (MACS) method and seeded onto coverslips. Successful microglial isolation was confirmed by immunofluorescent staining with anti-CD11 and anti-Iba1 antibodies. A cover slip was placed in a recording chamber, and the whole-cell potassium currents of the acutely isolated microglia were recorded under voltage-clamp conditions.

The present protocol describes how to isolate and purify primary hippocampal microglia from adult mice, followed by instructions for conducting whole-cell patch-clamp recordings on these acutely isolated cells.

Microglia are resident immune cells in the brain that interact with neurons to maintain the homeostasis of the central nervous system (CNS). Studies show ...

Biology

Isolation of Microglia from the Cortex of an Adult Mouse Brain

Source: Zhou, L., et al., <a href="https://appjove.unicartagenaproxy.elogim.com/v/60347">Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing.</a> J. Vis. Exp. (2019)
The video demonstrates a technique for isolating microglia from the cortex of an adult mouse brain. First, the cortex undergoes segmentation and homogenization to remove neurons and other glial cells, preserving microglia. Following that, the cell suspension is exposed to anti-myelin magnetic microbeads and a magnetic field, effectively separating microglia and myeloid cells from myelin debris and cells containing myelin.

Izolacja mikrogleju z kory mózgowej dorosłej myszy

All procedures involving sample collection have been performed in accordance with the institute&#39;s IRB guidelines.
1. Mechanical Tissue Dissociation
...

JoVE Encyclopedia of Experiments

Neuronal Culture Techniques

Primary Neuronal Culture

Magnetic Isolation of Microglia from Mouse Pup Brains

Source: Bokobza, C. et al., <a href="https://appjove.unicartagenaproxy.elogim.com/v/62964">Magnetic Isolation of Microglial Cells from Neonate Mouse for Primary Cell Cultures.</a> J. Vis. Exp. (2022)
In this video, we describe a protocol for isolating CD11b cells, including microglia, from mouse pup brains using magnetic-activated cell sorting. The brain tissues are homogenized to obtain single-cell suspensions, which are incubated with anti-CD11b antibody-coated microbeads, followed by a magnetic column-based separation to purify the CD11b+ cell population.

Izolacja magnetyczna mikrogleju z mózgów młodych myszy

Source: Bokobza, C. et al., Magnetic Isolation of Microglial Cells from Neonate Mouse for Primary Cell Cultures. J. Vis. Exp. (2022)
In this video, we ...