Name: selection-dependent and independent generation of crispr/cas9-mediated gene knockouts in mammalian cells
Uploaded: 2017-06-16T15:00:00.000+00:00
Duration: 11 min 35 s
Description: Watch this Scientific Journal Video about Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells at JoVE.com

저자는 Gissell Sanchez, Megan Lee 및 Jason Estep을 실험 지원을 위해, Weifeng Gu와 Xuemei Chen은 시약 공유에 대해 인정하고 싶습니다.

1. 바람직한 제거 주위의 상 동성 영역의 동정 참고 : 선택 기반 편집을 사용하는 경우에만 필요합니다. <ol><li> HDR 템플릿 ( 그림 1A )에서 상 동성 암 역할을 원하는 원하는 deletecus의 양쪽에 두 개의 영역, 처음 1.5-2 킬로바이트를 선택합니다. 복제를 용이하게하기 위해 두 가닥 (BsGI)에서 BsaI 인식 부위가 부족한 부위를 확인하십시오 (GGTCTC). BsaI 사이트가 불가피한 경우, 다른 유형 IIs 제한 효소 (BsmBI, SapI, BbsI)를 사용하여 수용자 플라스미드 (pUC19-BsaI), 저항 마커 기증자 플라스미드 (pGolden-Neo 또는 pGolden-Hygro) 상 동성 암 PCR 제품 오버행. </li></ol> 2. Cas9-sgRNA 발현 플라스미드의 생성 <ol><li> 돌연변이 유발을위한 표적 사이트를 정의하십시오. 단일 절단, 선택없는 방법의 경우, 비 - 후 (non-fu)의 확률을 증가시키기 위해 5 &#39;근위 코딩 엑손을 표적으로한다nctional 돌연변이. 두 컷 방법의 경우, 필요에 따라 많은 유전자를 포함하는 두 개의 사이트를 선택하십시오. 참고 : 우리의 경험에 따르면 최대 53kb의 삭제가 효율적으로 만들어집니다. </li><li> crispr.mit.edu 디자인 툴에 타겟 지역 시퀀스 200 ~ 300 bp를 입력합니다. 선택 기반 복제의 경우, deletion locus ( 그림 1A )의 근위에있는 확인 된 상동 성 영역의 200-300 bp를 사용하십시오. 타겟 지역별로 가장 높은 순위의 sgRNA를 2-3 가지 선택하여 활동 차이를 고려하고 동일한 잠재적 타겟 외 효과를 공유하지 않는 독립 클론을 격리하십시오. </li><li> 발현 플라스미드에 삽입하기 위해 적절한 오버행을 갖는 이중 가닥 올리고 뉴클레오티드를 디자인하기 위해, 말단 PAM 서열 (NGG)을 생략하고 5&#39;-CACC 오버행을 첨부 한 다음 G를 맨 위 가닥 oligo에 첨부한다. 하단 strand oligo의 경우, reverse-complemented 표적 서열에 5&#39;-AAAC 돌출부를 추가하고,이어서 3&#39;-C를 첨부한다.아래 lustrated : <img alt="순서 1" src="/files/ftp_upload/55903/55903seq01.jpg" /></li><li> Zhang 랩 프로토콜 29 에 설명 된대로 골든 게이트 클로닝을 사용하여 pSpCas9 (BB) 플라스미드에 sgRNA에 해당하는 합성 올리고 뉴클레오티드를 삽입합니다. </li></ol> 3. Homology-directed 수리 템플릿 Plasmids의 생성 참고 : 선택 기반 편집을 사용하는 경우에만 필요합니다. 상 동성 지시 한 수선 템플렛 플라스미드는 2 개의 sgRNA 표적 위치의 바로 저쪽에 게놈에 상보적인 2 개의 지역에 의해 측면에 마약 저항 카세트로 이루어져있다 ( 그림 1B ). <ol><li> 1.1 단계에서 확인한 더 넓은 상 동성 영역에서 상 동성 암 ( 그림 1A )으로 사용하기 위해 설계된 Cas9 절단 부위로부터 800-1,000 bp 26을 5 ~ 10 bp 이상 멀리 선택하십시오. sgRNA가 포함되지 않도록하십시오.표적 부위와 그 PAM을 상 동성 암에 삽입하면 이것이 플라스미드 자체의 CRISPR / Cas9 분열을 일으킬 것이다. 상 동성 암이 내부 BsaI 부위를 포함한다면 대체 sgRNA 부위를 사용하십시오. </li><li> PCR은 BsaI 사이트 (GGTCTC)와 상 동체 영역의 양쪽 끝 부분에 독특한 오버행을 도입하는 추가 5 &#39;서열을 갖는 순방향 및 역방향 프라이머를 사용하여 제조사의 지침에 따라 고 충실도 DNA 중합 효소를 사용하여 게놈 DNA로부터 상 동성 암을 증폭시킨다. 오버행은 올바른 조립 순서와 방향을 생성하기 위해 아래에 설명 된대로 적절한 순서를 포함해야합니다 ( 그림 1B ). 좌측 상 동성 암 FP 돌출부 : 5 &#39;GGGTCTCA GGCC 왼쪽 상 동성 암 RP 돌출부 : 5 &#39;GGGTCTCT CACG 오른쪽 상 동성 암 FP 돌출부 : 5 &#39;GGGTCTCA GTCC 오른쪽 상 동성 암 RP 돌출부 : 5 &#39;GGGTCTCT CCAC </li><li> 적절한 amplif에 대한 상 동성 암 검사앞으로 진행하기 전에 겔 전기 영동을 통한 배양. </li><li> 골든 게이트 클로닝 28 에 의해 저항 카세트와 오른쪽 및 왼쪽 상 동성 암 지역을 HDR 템플릿 플라스미드로 조립. pGolden - Neo 또는 pGolden - Hygro plasmids 30 을 loxP- 측면 저항 카세트 (loxP-PGK-Neo-pA-loxP 또는 loxP-PGK-Hyg-pA-loxP)의 공급원으로 사용하십시오. 다중 클로닝 영역에서 BsaI 사이트를 갖는 변형 된 pUC19 인 pUC19-BsaI를 사용하고, 다른 곳의 BsaI 사이트를 수령 벡터 (요청시 이용 가능)로서 제거 하였다. 3 개의 인서트 및 벡터에 대해 1 : 1 : 1 : 1의 비율을 사용하십시오. <ol><li> 다음 반응 혼합물 30을 조제한다 : <table><tbody><tr><td> 오른쪽 상 동성 암 PCR 제품 </td><td> 0.06 pmol (30-40ng) </td></tr><tr><td> 왼쪽 상 동성 암 PCR 제품 </td><td> 0.06 pmol (30-40ng) </td></tr><tr><td> pGolden-Neo 플라스미드 (100 ng / μL) </td><td> 1 &amp;# 181; L </td></tr><tr><td> pUC19-BsaI 플라스미드 (100ng / ㎕) </td><td> 1 μL </td></tr><tr><td> 2x T7 DNA 리가 아제 완충액 </td><td> 5 μL </td></tr><tr><td> BsaI (10U / μL) </td><td> 0.75 μL </td></tr><tr><td> T7 DNA 리가 제 (3000 U / μL) </td><td> 0.25 μL </td></tr><tr><td> 물 </td><td> 최대 10 μL </td></tr></tbody></table></li><li> 다음 thermocycler 매개 변수를 사용하십시오 : 37 ° C 5 분, 20 ° C 5 분. 30 사이클을 반복합니다. </li><li> 나머지 선형화 된 DNA를 소화하기 위해 제조업체의 지침에 따라 exonuclease로 클로닝 제품을 처리하십시오. </li><li> 세포와 함께 제공된 프로토콜에 따라 반응 혼합물을 유능한 E. coli 균주로 변형시키고 암피실린 함유 접시에 플레이트를 만듭니다. </li></ol></li><li> 올바른 템플릿 어셈블리로 클론을 식별하려면 박테리아를 수행하십시오(전체 인서트가 너무 커서 증폭을 증폭시킬 수 없기 때문에) 조립 된 인서트의 상 동성 암 부분 영역을 증폭시키기위한 al colony PCR. 인접한 플라스미드 서열에 하나의 프라이머를 사용하고 저항 카세트의 가장자리에 상보적인 두 번째 프라이머 ( 그림 1B , 서열은 Neo와 Hygro inserts 모두 공통이다)를 사용하여 약 200 bp보다 긴 어셈블리 의존성 생성물을 생성한다 포함 된 상 동성 암 : pUC19-Bsal- 좌측 : 5 &#39;GGCTCGTATGTTGTGTGGAATTGTGAG 저항 - 왼쪽 : 5 &#39;AAAAGCGCCTCCCCTACCC pUC19-BsaI- 오른쪽 : 5&#39; GCTATTACGCCAGCTGGCGAAA 저항 - 오른쪽 : 5 &#39;AAGACAATAGCAGGCATGCTGGG <ol><li> 멸균 된 이쑤시개로 세균성 콜로니를 선택하고 물 20 μL로 박테리아를 정지시킵니다. 95 ° C에서 15 분간 가열하고 탁상 원심 분리기에서 최대 속도로 5 분간 스핀 다운합니다. 즉시 얼음 위에 놓으십시오. </li><li> 다음 PCR 혼합물을 준비하십시오. 31 &lt;/ sup&gt; : <table><tbody><tr><td> 희석 식민지 템플릿 </td><td> 1.25 μL </td></tr><tr><td> 10x Taq 반응 완충액 </td><td> 1.25 μL </td></tr><tr><td> 20mM dNTPs </td><td> 0.25 μL </td></tr><tr><td> 10 μM 포워드 프라이머 </td><td> 0.25 μL </td></tr><tr><td> 10 μM Reverse primer </td><td> 0.25 μL </td></tr><tr><td> Taq 폴리 메라 이제 </td><td> 0.25 μL </td></tr><tr><td> 물 </td><td> 9 μL </td></tr></tbody></table></li><li> 다음 thermocycler 매개 변수를 사용하십시오 : 95 ° C 30 초, (95 ° C 30 초, 61 ° C 30 초, 72 ° C 1 분 / kb) 25 ℃, 2 분간 72 ℃에서 반복하십시오. </li><li> 아가 로스 겔 전기 영동으로 정확한 amplicon 크기에 대한 PCR 제품을 확인하십시오. </li><li> 선택적으로, 정확한 삽입 크기 및 순서를 갖는 개별 콜로니로부터의 miniprep 플라스미드 DNAe 상 동체 암 부위를 증폭시켰다. </li></ol></li></ol> 4. 배양 세포로의 CRISPR 성분의 트랜 스펙 션 <ol><li> transfection하기 전에 : 37 ° C와 5 % CO 2 에서 10 % FBS로 보충 된 DMEM 배지에서 배양 T-REx293 세포. </li><li> 6 잘 접시에 플레이트 세포와 70 % confluency로 성장. 트랜 스펙 션되지 않은 컨트롤을위한 웰을 포함하십시오. </li><li> 상업 transfection 프로토콜을 사용하여 2.5 μg 총 플라스미드와 세포를 Transfect. 동시에, 트랜스 팩트되지 않은 컨트롤을 유지하십시오. 참고 : 형질 전환 방법 및 효율은 세포 유형에 따라 다릅니다. 실험 전에 시스템에 대한 적절한 형질 전환 방법을 결정하십시오. <ol><li> 선택으로 세포 transfection, 0.75 μg Cas9 - sgRNA 1 (왼쪽 컷), 0.75 μg Cas9 - sgRNA 2 (오른쪽 컷), 1.0 μg 상동 재조합 템플릿을 사용합니다. </li><li> transfecti의 경우선택하지 않고 세포에 2.5 μg Cas9-sgRNA 플라스미드를 사용한다. </li></ol></li></ol> 5. 마약 선택 <ol><li> transfection 후 48 시간, 적절한 약물 (Neomycin / Hygromycin)으로 세포를 치료하십시오. untransfected 컨트롤 (일반적으로 3-5 일 Neo, Hygro에 대한 7-14 일)에 죽을 때까지 선택을 수행하십시오. 참고 : T-REx293 세포의 경우 Neomycin과 Hygromycin에는 각각 500 μg / mL와 10 μg / mL의 농도를 사용하십시오. 다른 세포 유형의 경우, 효과적인 농도를 결정하기 위해 감염되지 않은 세포에서 약물의 사전 적정을 수행하는 것이 유용 할 수 있습니다. </li></ol> 6. 클론 개체의 분리 <ol><li> 선택 후 원래의 우물에서 세포를 100 % confluency로 성장시킵니다. 세포를 96 웰 플레이트에 0.33 세포 / 웰의 밀도로 접종한다. 참고 : 세 개의 96 웰 플레이트에 시드를하면 올바른 클론을 하나 이상 분리 할 수있는 좋은 출발점이 될 수 있지만 더 많거나 적게 필요할 수 있습니다. depsgRNA 및 HDR 효율성이 끝납니다. </li><li> 식민지가 눈에 보일 때까지 2-4 주에 걸쳐 식민지를 관찰하십시오. 멸균 피펫 팁으로 보이는 식민지를 선택하고 monolayer 성장을 장려하기 위해 새로운 우물에 reseed. 서스펜션 세포를 사용할 때 더 낮은 배양 밀도를 사용하여 단일 콜로니 우물의보다 많은 부분을 확보 할 수 있습니다. </li></ol> 7. 상영 후보자 <ol><li> 선택을 사용하지 않고 선별 후보 : 도트 블롯 <ol><li> 개별 클론을 50-100 %의 confluency로 성장시킵니다. 웰 내에서 피펫 팅하여 세포의 단일 층을 제거하십시오. </li><li> 깨끗한 마이크로 원심 분리 튜브에 총 부피 100 μL 중 분취 량 90 μL. 5 분 동안 6,000 rpm으로 스핀 다운하고, 배지를 제거하고, 1X Lysis Buffer 또는 1x SDS loading buffer (5x : 250 mM Tris-Cl pH 6.8, 8 % SDS, 0.1 % bromophenol blue, 40 % 글리세롤, 100 mM DTT). 웰에있는 세포의 나머지에 새로운 미디어 90 μL를 추가하십시오계속 전파하십시오. </li><li> 점을 형성하는 건조 nitrocellulose 막 위에 세포 lysate 1 μL를 피펫. 각 샘플을 두 개의 별도 멤브레인에서 두 번 블로 팅하여 두 개의 동일한 샘플 패턴을 만듭니다. </li><li> 실온에서 TBST (트리스 완충 식염수 + 0.01 % 트윈 20 : 8g NaCl, 0.2g KCl, 3g 트리스 염기, 최대 1L 증류수, pH 7.4) 31 중 5 % 여기에서 그리고 절차 전반에 걸쳐서 흔들림). </li><li> 하나의 막에있는 표적 단백질에 대한 1 차 항체와 대조 단백질 (튜브린, GAPDH 또는 다른 것으로 예상되는 다른 단백질)에 대한 1 차 항체를 사용하여 블로 팅합니다. TBST + 5 % 우유에서 1 차 항체 희석액 (ELAVL1은 0.2 μg / mL, Pum2는 0.1 μg / mL)을 사용하십시오. 실온에서 1 시간 동안 품어 낸다. </li><li> 5 분 동안 TBST로 3 번 씻는다. </li><li> T에서 각 막을 적절한 HRP- 접합 이차 항체와 함께 배양한다.BST + 실온에서 1 시간 동안 5 % 우유. </li><li> 5 분 동안 TBST로 3 번 씻는다. </li><li> 제조업체 지침에 따라 화학 발광 기질 용액 (재료 표 참조)을 적용하고 디지털 화학 발광 이미 저에서 블 ted된 막을 묘사하십시오. </li><li> 적절한 소프트웨어를 사용하여 표적 단백질과 대조 단백질의 도트 농도를 정량화하십시오. </li><li> 낮은 제어 단백질 신호로 후보 물질을 제거하고, 나머지 후보 물질에 대한 단백질 강도를 제어하기 위해 표적의 배경 - 뺀 비율을 계산하십시오. Western blot으로 통과 및 추가 확인을 위해 가장 낮은 비율의 후보를 선택하십시오. </li></ol></li><li> 선택의 사용을 가진 후보자를 검열하십시오 : 식민지 PCR <ol><li> DNA prep 키트를 사용하여 세포 용 해물을 수집하십시오 ( 재료 표 참조). <ol><li> 새로운 96 well에서 개별 콜로니를 복제하고 100 % confluency까지 성장시킵니다. </li><li> 한 세트의 복제본에서 미디어를 제거합니다.키트에서 추출 버퍼 30 μL에 세포를 resuspend. 깨끗한 1.5 ML microcentrifuge 튜브로 전송하십시오. </li><li> 용액을 96 ℃에서 15 분간 가열하고 실온으로 냉각시킨다. </li><li> 키트에서 안정화 버퍼 30 μL를 추가합니다. 잘 섞다. </li></ol></li><li> 식민지 PCR에 의해 wildtype 및 monallelic / biallelic 돌연변이 라인을 식별합니다. <ol><li> 저항 카세트의 성공적인 또는 성공적이지 않은 통합 ( 그림 2C )에 기반한 상 동성 암 주위의 영역을 증폭시키기 위해 두 개의 개별 PCR 프라이머 세트 (표적 유전자좌의 왼쪽과 오른쪽에 대해)를 설계하십시오. 양쪽에는 상 동성 암 외부에 어닐링하는 공통 프라이머 (적색)를 사용하십시오. 야생형 대립 유전자를 테스트하기 위해 상 동성 영역 (파란색)에 걸친 내인성 서열에 상보적인 상응하는 쌍을 이루는 프라이머와 함께 사용하십시오. 삽입 된 저항 카세트와 상보적인 또 다른 한 쌍의 프라이머를 사용하십시오 (섹션의 프라이머 참조).2.3), 원하는 돌연변이를 시험한다. </li><li> (권장) WT와 돌연변이 대립 유전자가 모두 포함되어 있기 때문에 원래 선택된 벌크 세포군의 세포 용 해물을 사용하여 프라이머 세트를 확인합니다 ( 그림 2D ). </li><li> 다음 반응 혼합물을 준비하십시오 : <table><tbody><tr><td> 세포 용 해물 </td><td> 0.5 μL </td></tr><tr><td> 10x KOD 버퍼 </td><td> 1.25 μL </td></tr><tr><td> 25mM MgSO4 </td><td> 0.75 μL </td></tr><tr><td> 2 mM dNTPs </td><td> 1.25 μL </td></tr><tr><td> 10 μM 포워드 프라이머 </td><td> 0.375 μL </td></tr><tr><td> 10 μM Reverse primer </td><td> 0.375 μL </td></tr><tr><td> KOD 중합 효소 </td><td> 0.25 μL </td></tr><tr><td> 물 </td><td> 7.75 μL </td></tr></tbody></table></li><li> 다음 thermocycler 조건을 사용하십시오 : 95 ℃에서 2 분, (95 ℃에서 20 초, Primer Tm에서 10 초, 70 ℃에서 20 초 / kb) 25 사이클을 반복하십시오. </li><li> 아가 로스 겔 전기 영동으로 PCR 산물을 시각화하십시오. </li></ol></li><li> 예측 통합의 각 측면에 대한 식민지 PCR 테스트를 반복합니다. 통합의 존재와 삭제 된 지역에 대한 내인성 서열 생성물이없는 후보 물질을 선택하고 확장하십시오. </li><li> 웨스턴 블랏 및 / 또는 RT-qPCR로 양성 반응자를 확인합니다. </li></ol></li></ol> 8. 시퀀싱으로 게놈 돌연변이 확인 <ol><li> 페놀 클로로포름 추출 31 에 의해 돌연변이 세포주에서 게놈 DNA를 분리합니다. </li><li> PCR은 각 말단에 BsaI 제한 부위를 부가하는 5 &#39;오버행을 갖는 프라이머를 사용하여 sgRNA 표적 영역을 증폭시킨다. 참고 : 두 대립 유전자가 동일 할 수있는 HDR로 편집 한 클론의 경우 PCR 산물을 직접 시퀀싱 할 수 있습니다. </li><li> 골든 게이트 복제에 의해 증폭 된 영역을 pUC19-BsaI로 클로닝한다. </li><li> 반응 혼합물을 유능한 대장균 균주로 변형시킨다. </li><li> 6 ~ 10 개의 개별 콜로니에서 Miniprep 플라스미드 DNA를 추출하고 Sanger 시퀀싱으로 클로닝 된 영역을 시퀀싱합니다. </li></ol>

<ol>
	<li>Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+with+zinc-finger+nucleases.">Genome engineering with zinc-finger nucleases.</a> Genetics. 188 (4), 773-782 (2011).</li><li>Kim, Y. G., Cha, J., Chandrasegaran, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hybrid+restriction+enzymes:+zinc+finger+fusions+to+Fok+I+cleavage+domain.">Hybrid restriction enzymes: zinc finger fusions to Fok I cleavage domain.</a> Proc Natl Acad Sci U S A. 93 (3), 1156-1160 (1996).</li><li>Bibikova, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stimulation+of+homologous+recombination+through+targeted+cleavage+by+chimeric+nucleases.">Stimulation of homologous recombination through targeted cleavage by chimeric nucleases.</a> Mol Cell Biol. 21 (1), 289-297 (2001).</li><li>Bibikova, M., Golic, M., Golic, K. G., Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+chromosomal+cleavage+and+mutagenesis+in+Drosophila+using+zinc-finger+nucleases.">Targeted chromosomal cleavage and mutagenesis in Drosophila using zinc-finger nucleases.</a> Genetics. 161 (3), 1169-1175 (2002).</li><li>Porteus, M. H., Cathomen, T., Weitzman, M. D., Baltimore, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+gene+targeting+mediated+by+adeno-associated+virus+and+DNA+double-strand+breaks.">Efficient gene targeting mediated by adeno-associated virus and DNA double-strand breaks.</a> Mol Cell Biol. 23 (10), 3558-3565 (2003).</li><li>Bogdanove, A. J., Voytas, D. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+effectors:+customizable+proteins+for+DNA+targeting.">TAL effectors: customizable proteins for DNA targeting.</a> Science. 333 (6051), 1843-1846 (2011).</li><li>Miller, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+TALE+nuclease+architecture+for+efficient+genome+editing.">A TALE nuclease architecture for efficient genome editing.</a> Nat Biotechnol. 29 (2), 143-148 (2011).</li><li>Moscou, M. J., Bogdanove, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+cipher+governs+DNA+recognition+by+TAL+effectors.">A simple cipher governs DNA recognition by TAL effectors.</a> Science. 326 (5959), 1501 (2009).</li><li>Christian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+DNA+double-strand+breaks+with+TAL+effector+nucleases.">Targeting DNA double-strand breaks with TAL effector nucleases.</a> Genetics. 186 (2), 757-761 (2010).</li><li>Jiang, W., Marraffini, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas:+New+Tools+for+Genetic+Manipulations+from+Bacterial+Immunity+Systems.">CRISPR-Cas: New Tools for Genetic Manipulations from Bacterial Immunity Systems.</a> Annu Rev Microbiol. 69, 209-228 (2015).</li><li>Barrangou, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+provides+acquired+resistance+against+viruses+in+prokaryotes.">CRISPR provides acquired resistance against viruses in prokaryotes.</a> Science. 315 (5819), 1709-1712 (2007).</li><li>Karginov, F. V., Hannon, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR+system:+small+RNA-guided+defense+in+bacteria+and+archaea.">The CRISPR system: small RNA-guided defense in bacteria and archaea.</a> Mol Cell. 37 (1), 7-19 (2010).</li><li>Wiedenheft, B., Sternberg, S. H., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+genetic+silencing+systems+in+bacteria+and+archaea.">RNA-guided genetic silencing systems in bacteria and archaea.</a> Nature. 482 (7385), 331-338 (2012).</li><li>Mojica, F. J., Diez-Villasenor, C., Garcia-Martinez, J., Soria, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intervening+sequences+of+regularly+spaced+prokaryotic+repeats+derive+from+foreign+genetic+elements.">Intervening sequences of regularly spaced prokaryotic repeats derive from foreign genetic elements.</a> J Mol Evol. 60 (2), 174-182 (2005).</li><li>Pourcel, C., Salvignol, G., Vergnaud, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+elements+in+Yersinia+pestis+acquire+new+repeats+by+preferential+uptake+of+bacteriophage+DNA,+and+provide+additional+tools+for+evolutionary+studies.">CRISPR elements in Yersinia pestis acquire new repeats by preferential uptake of bacteriophage DNA, and provide additional tools for evolutionary studies.</a> Microbiology. 151 (Pt 3), 653-663 (2005).</li><li>Brouns, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+CRISPR+RNAs+guide+antiviral+defense+in+prokaryotes.">Small CRISPR RNAs guide antiviral defense in prokaryotes.</a> Science. 321 (5891), 960-964 (2008).</li><li>Deltcheva, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+RNA+maturation+by+trans-encoded+small+RNA+and+host+factor+RNase+III.">CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III.</a> Nature. 471 (7340), 602-607 (2011).</li><li>Garneau, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR/Cas+bacterial+immune+system+cleaves+bacteriophage+and+plasmid+DNA.">The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA.</a> Nature. 468 (7320), 67-71 (2010).</li><li>Marraffini, L. A., Sontheimer, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+interference+limits+horizontal+gene+transfer+in+staphylococci+by+targeting+DNA.">CRISPR interference limits horizontal gene transfer in staphylococci by targeting DNA.</a> Science. 322 (5909), 1843-1845 (2008).</li><li>Gasiunas, G., Barrangou, R., Horvath, P., Siksnys, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cas9-crRNA+ribonucleoprotein+complex+mediates+specific+DNA+cleavage+for+adaptive+immunity+in+bacteria.">Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria.</a> Proc Natl Acad Sci U S A. 109 (39), E2579-E2586 (2012).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Davis, A. J., Chen, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+double+strand+break+repair+via+non-homologous+end-joining.">DNA double strand break repair via non-homologous end-joining.</a> Transl Cancer Res. 2 (3), 130-143 (2013).</li><li>Guirouilh-Barbat, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+the+KU80+pathway+on+NHEJ-induced+genome+rearrangements+in+mammalian+cells.">Impact of the KU80 pathway on NHEJ-induced genome rearrangements in mammalian cells.</a> Mol Cell. 14 (5), 611-623 (2004).</li><li>Moore, J. K., Haber, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+cycle+and+genetic+requirements+of+two+pathways+of+nonhomologous+end-joining+repair+of+double-strand+breaks+in+Saccharomyces+cerevisiae.">Cell cycle and genetic requirements of two pathways of nonhomologous end-joining repair of double-strand breaks in Saccharomyces cerevisiae.</a> Mol Cell Biol. 16 (5), 2164-2173 (1996).</li><li>Liang, F., Han, M., Romanienko, P. J., Jasin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Homology-directed+repair+is+a+major+double-strand+break+repair+pathway+in+mammalian+cells.">Homology-directed repair is a major double-strand break repair pathway in mammalian cells.</a> Proc Natl Acad Sci U S A. 95 (9), 5172-5177 (1998).</li><li>Gratz, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+specific+and+efficient+CRISPR/Cas9-catalyzed+homology-directed+repair+in+Drosophila.">Highly specific and efficient CRISPR/Cas9-catalyzed homology-directed repair in Drosophila.</a> Genetics. 196 (4), 961-971 (2014).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li><li>Engler, C., Kandzia, R., Marillonnet, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one+pot,+one+step,+precision+cloning+method+with+high+throughput+capability.">A one pot, one step, precision cloning method with high throughput capability.</a> PLoS One. 3 (11), e3647 (2008).</li><li>Ran, F. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+using+the+CRISPR-Cas9+system.">Genome engineering using the CRISPR-Cas9 system.</a> Nat Protoc. 8 (11), 2281-2308 (2013).</li><li>Luo, Y., Lin, L., Bolund, L., Sorensen, C. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+construction+of+rAAV-based+gene+targeting+vectors+by+Golden+Gate+cloning.">Efficient construction of rAAV-based gene targeting vectors by Golden Gate cloning.</a> Biotechniques. 56 (5), 263-268 (2014).</li><li>Green, M. R., Sambrook, J., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning: a laboratory manual. , (2012).</li><li>Lin, S., Staahl, B. T., Alla, R. K., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+homology-directed+human+genome+engineering+by+controlled+timing+of+CRISPR/Cas9+delivery.">Enhanced homology-directed human genome engineering by controlled timing of CRISPR/Cas9 delivery.</a> Elife. 3, e04766 (2014).</li><li>Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+RNA-guided+genome+editing+in+human+cells+via+delivery+of+purified+Cas9+ribonucleoproteins.">Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins.</a> Genome Res. 24 (6), 1012-1019 (2014).</li></ol>

저자는 경쟁적인 금전적 이해 관계가 없다고 선언합니다.

CRISPR / Cas9 시스템은 다른 일시적인 조작 방법에 대한보다 일관된 대안을 제공하는 안정한 게놈 변형의 효율적인 생성을 가능하게했다. 여기, 우리는 포유 동물 세포 라인에서 CRISPR / Cas9 유전자 녹아웃의 신속한 식별을위한 두 가지 방법을 제시했습니다. 두 가지 방법 모두 세포질이 거의 필요하지 않으므로 클론 배양의 초기 단계에서 시험을 수행하여 시간과 시약을 절약 할 수 있습니다. 두 가?...

<html> 안정한 유전 적 변형은 일시적인 세포 섭동 (perturbation)의 방법보다 이점을 제공하는데, 이는 효율성과 지속 기간이 가변적 일 수 있습니다. 게놈 편집은 징크 핑거 핵산 분해 효소 1 , 2 , 3 , 4 , 5 , 전사 활성제 유사 이펙터 핵산 효소 (TALENs) 6 , 7 , 8 , 9 와 같은 표적 특이 적 뉴 클레아 제의 개발로 인해 최근에 점점 더 보편화되고있다. (CRISPR) 시스템 10 에서 유래 된 RNA 유도 뉴 클레아 제를 포함한다. CRISPR / Cas9 편집 기계는 박테리아와 고세균이 바이러스 감염을 막기 위해 사용하는 면역계로부터 변형되었습니다.ass = &quot;xref&quot;&gt; 11 , 12 , 13 . 이 과정에서, 침입 바이러스 서열의 짧은 20-30nt 단편이 반복 단위 14 , 15 에 의해 둘러싸인 &quot;스페이서&quot;로서 게놈 궤적에 편입된다. 후속 전사 및 RNA 프로세싱은 trans-activating crRNA 17 (tracrRNA)과 함께 작동 자 Cas9 엔도 뉴 클레아 제와 함께 조립되는 작은 CRISPR- 관련 RNAs 16 (crRNA)을 생성한다. 따라서 crRNA는 Cas9 표적화에 대한 특이성을 제공하고, 상보적인 바이러스 DNA 서열을 절단하고 추가 감염을 예방하기 위해 복합체를 유도한다 18 , 19 . 표적 DNA에있는 어떤 &quot;protospacer&quot;서열이라도 짧은 protospacer 인접 모티프 (PAM), S. pyogenes Casg의 경우 NGG에 직접 5 &#39;있는 한, crRNA의 원천이 될 수있다 <sup class = &quot;xref&quot;&gt; 20. 숙주의 CRISPR 궤적의 스페이서 근처에 PAM 서열이 없다는 것은 자기와 비 - 자기를 구별하여 숙주의 표적화를 방지한다. 이 생물학적 시스템은 보편성과 유연성으로 인해 거의 모든 PAM 인접 DNA 사이트를 타겟팅 할 수 있도록 게놈 편집에 강력하게 적응했습니다. 이 버전에서는 추가 변경으로 crRNA와 tracrRNA를 Cas9 단백질 21 에로드되는 단일 가이드 RNA (sgRNA) 성분으로 융합시켰다. 진핵 세포에서 Cas9와 sgRNA의 발현시, Cas9 단백질은 표적 유전자좌에서 두 DNA 가닥을 절단한다. 상 동성 서열의 적당한 영역이없는 경우, 세포는 전형적으로 작은 결실 또는 드물게 삽입을 유도하는 비 - 상 동성 말단 결합 (NHEJ) 22 , 23 , 24 를 통해 이러한 단절을 고정시킨다. 공개를 타겟팅 할 때판독 프레임에서, 수리는 비 기능성 단백질 생성물을 생성하는 번역적인 골격 이동을 유발할 수있다. 대조적으로, 큰 상 동성 영역을 갖는 외인성 템플레이트가 제공 될 때, 세포는 상 동성 지시에 의한 보수에 의해 이중 가닥 절단을 고칠 수있다 25 , 26 . 이 경로는 excisable 선택 마커 27 도입과 함께 게놈에서 더 큰 정확한 삭제, 교체 또는 삽입을 허용합니다. 여기, 우리는 두 가지 CRISPR / Cas9 방법 ( 그림 1A ) 중 하나에 의해 녹아웃 세포 라인을 생성하기위한 프로토콜을 제시합니다. NHEJ 접근법은 단일 sgRNA 절단 사이트 및 선발 독립 스크리닝을 사용하므로 초기 준비가 거의 필요하지 않습니다. 이 방법을 사용할 때 녹아웃을 생성 할 가능성이 가장 높은 전사 인자의 5 &#39;말단 근처에있는 엑손과 상보적인 RNA를 고안해야합니다. 수정 이후이 경우 게놈에 대한 이온은 작으며, 녹아웃 클론을 스크리닝하는 것은 도트 블롯을 기반으로하며, 여기서 단백질 생산물은 고효율 방식으로 평가됩니다. 우리는 ELAV와 유사한 1 단백질 (ELAVL1) 녹아웃 라인을 예로 들어 사용합니다. 두 번째 접근법은 homology directed repair (HDR)에 의존하고 관심있는 유전자 또는 관심 영역에 걸친 2 개의 sgRNA 절단 부위를 사용하여 수십 kb의 결실을 허용합니다. 절단 부위의 측면에 위치하는 두 개의 상 동성 영역을 갖는 플라스미드는 녹아웃 생성의 효율을 증가시키는 선택 가능한 저항 마커를 도입하는 대체 주형 ( 도 1b )을 제공한다. 이 방법은 적절하게 설계된 상 동성 암으로 유전자 변형을 도입하는 데에도 적용될 수있다. 이 경우 새로운 DNA 단편을 통합하면 PCR 기반의 스크리닝이 가능합니다 ( 그림 1C ). 여기에서는 Pumilio RNA binding family member 2 (PUM2) knockout line의 생성을 예로 사용합니다.

<table><tbody><tr><td>Competent &lt;em&gt;E. coli&lt;/em&gt; cells</td><td></td><td></td><td></td></tr><tr><td>plasmid prep kit</td><td></td><td></td><td></td></tr><tr><td>pSpCas9(BB) plasmid</td><td>Addgene</td><td>42230</td><td>Ran &lt;em&gt;et al.&lt;/em&gt; 2013, cloning sgRNAs</td></tr><tr><td>BbsI enzyme</td><td>ThermoFisher</td><td>FD1014</td><td>Ran &lt;em&gt;et al.&lt;/em&gt; 2013, cloning sgRNAs</td></tr><tr><td>T7 DNA ligase</td><td>NEB</td><td>M0318L</td><td>Ran &lt;em&gt;et al.&lt;/em&gt; 2013, cloning sgRNAs</td></tr><tr><td>Tango Buffer</td><td>ThermoFisher</td><td>BY5</td><td>Ran &lt;em&gt;et al.&lt;/em&gt; 2013, cloning sgRNAs</td></tr><tr><td>PlasmidSafe exonuclease</td><td>Epicentre</td><td>E3105K</td><td>Ran &lt;em&gt;et al.&lt;/em&gt; 2013, cloning sgRNAs</td></tr><tr><td>Q5 hot start high fidelity polymerase</td><td>NEB</td><td>M0494A</td><td>HA amplification</td></tr><tr><td>pUC19-BsaI</td><td></td><td></td><td>Modified pUC19 plasmid, mutated existing BsaI site and inserted two outward facing BsaI sites after BamHI/EcoRI digestion</td></tr><tr><td>pGolden-Neo</td><td>Addgene</td><td>51422</td><td>Resistance cassette</td></tr><tr><td>pGolden-Hygro</td><td>Addgene</td><td>51423</td><td>Resistance cassette</td></tr><tr><td>BsaI enzyme</td><td>NEB</td><td>R3535S</td><td>Homology arm contruction</td></tr><tr><td>T7 DNA ligase</td><td>NEB</td><td>M0318L</td><td></td></tr><tr><td>PlasmidSafe exonuclease</td><td>Epicentre</td><td>E3105K</td><td></td></tr><tr><td>Toothpicks</td><td></td><td></td><td>bacterial PCR</td></tr><tr><td>Taq polymerase</td><td></td><td></td><td>bacterial colony PCR</td></tr><tr><td>HEK293 human cells</td><td></td><td></td><td></td></tr><tr><td>DMEM</td><td>Corning</td><td>10-013-CV</td><td></td></tr><tr><td>FBS</td><td>Corning</td><td>MT35010CV</td><td></td></tr><tr><td>Penicillin-Strep (opt.)</td><td>Gibco</td><td>15140-122</td><td></td></tr><tr><td>6 well plates</td><td>BioLite</td><td>12556004</td><td></td></tr><tr><td>TransIT-LTI Transfection Reagent</td><td>Mirus</td><td>MIR2300</td><td>for lipofection only</td></tr><tr><td>Opti-MEM</td><td>ThermoFisher</td><td>31985062</td><td>for lipofection only</td></tr><tr><td>G418 (Neomycin)</td><td>Sigma Aldrich</td><td>A1720-5G</td><td></td></tr><tr><td>Hygromycin</td><td>Sigma Aldrich</td><td>H3274-250MG</td><td></td></tr><tr><td>96 well plates</td><td>ThermoFisher</td><td>12556008</td><td></td></tr><tr><td>Passive Lysis Buffer, 5x</td><td>Promega</td><td></td><td></td></tr><tr><td>1x SDS loading buffer</td><td></td><td></td><td>recipe decribed in protocol</td></tr><tr><td>Nitrocellulose Membrane</td><td>Bio-Rad</td><td>162-0115</td><td></td></tr><tr><td>TBST</td><td></td><td></td><td>recipe decribed in protocol</td></tr><tr><td>Dehydrated milk</td><td></td><td></td><td></td></tr><tr><td>SuperSignal West Dura Extended Duration Substrate</td><td>ThermoFisher</td><td>34075</td><td>for HRP-conjugated secondary antibodies</td></tr><tr><td>Extracta DNA prep for PCR</td><td>Quantabio</td><td>95091-025</td><td></td></tr><tr><td>KOD polymerase</td><td>Novagen</td><td>71316</td><td></td></tr></tbody></table>

selection-dependent and independent generation of crispr/cas9-mediated gene knockouts in mammalian cells

CRISPR / Cas9 게놈 공학 시스템은 적은 노력으로 정확한 게놈 편집을 가능하게함으로써 생물학에 혁명을 일으켰습니다. 특이성을 부여하는 단일 가이드 RNA (sgRNA)에 의해 유도 된 Cas9 단백질은 표적 유전자좌에서 DNA 가닥 둘 모두를 절단합니다. DNA가 끊어지면 NHEJ (homologous end joining) 또는 homology directed repair (HDR)가 유발 될 수 있습니다. NHEJ는 프레임 변이 돌연변이를 유도하는 작은 결실 또는 삽입을 도입 할 수있는 반면, HDR은 더 크고 더 정확한 섭동을 허용한다. 여기, 우리는 다운 스트림 선택 / 스크리닝을위한 두 가지 옵션으로 설립 CRISPR / Cas9 방법을 결합하여 녹아웃 세포 라인을 생성하기위한 프로토콜을 제시합니다. NHEJ 접근법은 하나의 sgRNA 절단 사이트와 선택에 의존하지 않는 스크리닝을 사용하며, 단백질 생산은 도트 면역 블롯 (dot immunoblot)으로 높은 처리량 방식으로 평가됩니다. HDR 접근법은 관심있는 유전자를 스팬하는 2 개의 sgRNA 절단 부위를 사용합니다. 제공된 HDR 템플릿과 함께이 메소드는 삭제를 수행 할 수 있습니다.삽입 된 선택 저항 마커의 도움을 받아 수십 kb의 적절한 방법과 각 방법의 장점에 대해 설명합니다.

ELAVL1 knockout line을 생성하기 위해 강력한 항체를 사용할 수 있었으므로 단일 sgRNA ( 그림 1A , 왼쪽)를 사용하여 편집 한 다음 도트 면역 블롯을 수행했습니다. 3 개의 sgRNA를 독립적으로 트랜 스펙 션하여 효율을 비교하고 결과 클론에서 표적 효과를 배제했습니다. clonal population으로부터 2 개의 nitrocellulose membrane으로 세포 용 해물을 채취하고 blotting 한 ?...

Watch this Scientific Journal Video about Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells at JoVE.com

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

체세포를 유 전적으로 조작하는 능력의 최근 진보는 기본 및 응용 연구에 큰 가능성을 안겨줍니다. 여기, 우리는 선택 마커의 사용 여부에 관계없이 포유류 세포주에서 CRISP / Cas9 생성 녹아웃 생산 및 스크리닝을위한 두 가지 접근법을 제시한다.

포유류 세포에서 CRISPR / Cas9 매개 유전자 knockouts의 선택 의존 및 독립적 생성

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

selection-dependent-independent-generation-crisprcas9-mediated-gene

Universidad de Cartagena UDEC

Research

JoVE Journal

Genetics

12.4K 조회수.  University of California, Riverside.  체세포를 유 전적으로 조작하는 능력의 최근 진보는 기본 및 응용 연구에 큰 가능성을 안겨줍니다. 여기, 우리는 선택 마커의 사용 여부에 관계없이 포유류 세포주에서 CRISP / Cas9 생성 녹아웃 생산 및 스크리닝을위한 두 가지 접근법을 제시한다. 

비디오: Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

Using a Fluorescent PCR-capillary Gel Electrophoresis Technique to Genotype CRISPR/Cas9-mediated Knockout Mutants in a High-throughput Format

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play in the functioning of cells and whole organisms. This cause has been tremendously aided by the recent introduction of the CRISPR/Cas9 system-a versatile tool that allows researchers to manipulate the genome and transcriptome in order to, among other things, knock out, knock down, or knock in genes in a targeted manner. For the purpose of knocking out a gene, CRISPR/Cas9-mediated double-strand breaks recruit the non-homologous end-joining DNA repair pathway to introduce the frameshift-causing insertion or deletion of nucleotides at the break site. However, an individual guide RNA may cause undesirable off-target effects, and to rule these out, the use of multiple guide RNAs is necessary. This multiplicity of targets also means that a high-volume screening of clones is required, which in turn begs the use of an efficient high-throughput technique to genotype the knockout clones. Current genotyping techniques either suffer from inherent limitations or incur high cost, hence rendering them unsuitable for high-throughput purposes. Here, we detail the protocol for using fluorescent PCR, which uses genomic DNA from crude cell lysate as a template, and then resolving the PCR fragments via capillary gel electrophoresis. This technique is accurate enough to differentiate one base-pair difference between fragments and hence is adequate in indicating the presence or absence of a frameshift in the coding sequence of the targeted gene. This precise knowledge effectively precludes the need for a confirmatory sequencing step and allows users to save time and cost in the process. Moreover, this technique has proven to be versatile in genotyping various mammalian cells of various tissue origins targeted by guide RNAs against numerous genes, as shown here and elsewhere.

The genotyping technique described here, which couples fluorescent polymerase chain reaction (PCR) to capillary gel electrophoresis, allows for high-throughput genotyping of nuclease-mediated knockout clones. It circumvents limitations faced by other genotyping techniques and is more cost effective than sequencing methods.

CRISPR을 유전자형하기 위해 형광 PCR-모세관 젤 전기 영동 기술을 사용 / 높은 처리량 형식으로 녹아웃 돌연변이를 Cas9 매개

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play ...

연구

유전학

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development of a customizable platform to rapidly generate gene modifications in a wide variety of organisms, including zebrafish. CRISPR-based genome editing uses a single guide RNA (sgRNA) to target a CRISPR-associated (Cas) endonuclease to a genomic DNA (gDNA) target of interest, where the Cas endonuclease generates a double-strand break (DSB). Repair of DSBs by error-prone mechanisms lead to insertions and/or deletions (indels). This can cause frameshift mutations that often introduce a premature stop codon within the coding sequence, thus creating a protein-null allele. CRISPR-based genome engineering requires only a few molecular components and is easily introduced into zebrafish embryos by microinjection. This protocol describes the methods used to generate CRISPR reagents for zebrafish microinjection and to identify fish exhibiting germline transmission of CRISPR-modified genes. These methods include in vitro transcription of sgRNAs, microinjection of CRISPR reagents, identification of indels induced at the target site using a PCR-based method called a heteroduplex mobility assay (HMA), and characterization of the indels using both a low throughput and a powerful next-generation sequencing (NGS)-based approach that can analyze multiple PCR products collected from heterozygous fish. This protocol is streamlined to minimize both the number of fish required and the types of equipment needed to perform the analyses. Furthermore, this protocol is designed to be amenable for use by laboratory personal of all levels of experience including undergraduates, enabling this powerful tool to be economically employed by any research group interested in performing CRISPR-based genomic modification in zebrafish.

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Targeted genome editing in the model system Danio rerio (zebrafish) has been greatly facilitated by the emergence of CRISPR-based approaches. Herein, we describe a streamlined, robust protocol for generation and identification of CRISPR-derived nonsense alleles that incorporates the heteroduplex mobility assay and identification of mutations using next-generation sequencing.

효율적인 생산 및 모델 시스템 Danio rerio 에 유전자 녹아웃 식별의 CRISPR/Cas9 생성

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. Complete gene ablation in HSCs required the generation of knockout mice from which HSCs could be isolated, and gene ablation in primary human HSCs was not possible. Viral transduction could be used for knock-down approaches, but these suffered from variable efficacy. In general, genetic manipulation of human and mouse hematopoietic cells was hampered by low efficiencies and extensive time and cost commitments. Recently, CRISPR/Cas9 has dramatically expanded the ability to engineer the DNA of mammalian cells. However, the application of CRISPR/Cas9 to hematopoietic cells has been challenging, mainly due to their low transfection efficiencies, the toxicity of plasmid-based approaches and the slow turnaround time of virus-based protocols.
A rapid method to perform CRISPR/Cas9-mediated gene editing in murine and human hematopoietic stem and progenitor cells with knockout efficiencies of up to 90% is provided in this article. This approach utilizes a ribonucleoprotein (RNP) delivery strategy with a streamlined three-day workflow. The use of Cas9-sgRNA RNP allows for a hit-and-run approach, introducing no exogenous DNA sequences in the genome of edited cells and reducing off-target effects. The RNP-based method is fast and straightforward: it does not require cloning of sgRNAs, virus preparation or specific sgRNA chemical modification. With this protocol, scientists should be able to successfully generate knockouts of a gene of interest in primary hematopoietic cells within a week, including downtimes for oligonucleotide synthesis. This approach will allow a much broader group of users to adapt this protocol for their needs.

A protocol for fast CRISPR/Cas9-mediated gene disruption in mouse and human primary hematopoietic cells is described in this article. Cas9-sgRNA ribonucleoproteins are introduced via electroporation with sgRNAs generated through in vitro transcription and commercial Cas9. High editing efficiencies are achieved with limited time and financial cost.

CRISPR/Cas9에 의해 Murine 인간과 조 혈 조상 세포의 고효율 유전자 장애

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Genome Editing in Mammalian Cell Lines using CRISPR-Cas

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been successfully repurposed for genome engineering in many different living organisms. Most commonly, the wildtype CRISPR associated 9 (Cas9) or Cas12a endonuclease is used to cleave specific sites in the genome, after which the DNA double-stranded break is repaired via the non-homologous end joining (NHEJ) pathway or the homology-directed repair (HDR) pathway depending on whether a donor template is absent or present respectively. To date, CRISPR systems from different bacterial species have been shown to be capable of performing genome editing in mammalian cells. However, despite the apparent simplicity of the technology, multiple design parameters need to be considered, which often leave users perplexed about how best to carry out their genome editing experiments. Here, we describe a complete workflow from experimental design to identification of cell clones that carry desired DNA modifications, with the goal of facilitating successful execution of genome editing experiments in mammalian cell lines. We highlight key considerations for users to take note of, including the choice of CRISPR system, the spacer length, and the design of a single-stranded oligodeoxynucleotide (ssODN) donor template. We envision that this workflow will be useful for gene knockout studies, disease modeling efforts, or the generation of reporter cell lines.

CRISPR-Cas is a powerful technology to engineer the complex genomes of plants and animals. Here, we detail a protocol to efficiently edit the human genome using different Cas endonucleases. We highlight important considerations and design parameters to optimize editing efficiency.

포유류 세포 라인 CRISPR Cas를 사용 하 여 게놈 편집

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been ...

Pooled CRISPR-Based Genetic Screens in Mammalian Cells

Genome editing using the CRISPR-Cas system has vastly advanced the ability to precisely edit the genomes of various organisms. In the context of mammalian cells, this technology represents a novel means to perform genome-wide genetic screens for functional genomics studies. Libraries of guide RNAs (sgRNA) targeting all open reading frames permit the facile generation of thousands of genetic perturbations in a single pool of cells that can be screened for specific phenotypes to implicate gene function and cellular processes in an unbiased and systematic way. CRISPR-Cas screens provide researchers with a simple, efficient, and inexpensive method to uncover the genetic blueprints for cellular phenotypes. Furthermore, differential analysis of screens performed in various cell lines and from different cancer types can identify genes that are contextually essential in tumor cells, revealing potential targets for specific anticancer therapies. Performing genome-wide screens in human cells can be daunting, as this involves the handling of tens of millions of cells and requires analysis of large sets of data. The details of these screens, such as cell line characterization, CRISPR library considerations, and understanding the limitations and capabilities of CRISPR technology during analysis, are often overlooked. Provided here is a detailed protocol for the successful performance of pooled genome-wide CRISPR-Cas9 based screens.

CRISPR-Cas9 technology provides an efficient method to precisely edit the mammalian genome in any cell type and represents a novel means to perform genome-wide genetic screens. A detailed protocol discussing the steps required for the successful performance of pooled genome-wide CRISPR-Cas9 screens is provided here.

포유류 세포에 있는 풀린 CRISPR 기지를 둔 유전 스크린

Genome editing using the CRISPR-Cas system has vastly advanced the ability to precisely edit the genomes of various organisms. In the context of mammalian ...

A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer

CRISPR/Cas9 technology has greatly improved the feasibility and speed of loss-of-function studies that are essential in understanding gene function. In higher eukaryotes, paralogous genes can mask a potential phenotype by compensating the loss of a gene, thus limiting the information that can be obtained from genetic studies relying on single gene knockouts. We have developed a novel, rapid cloning method for guide RNA (gRNA) concatemers in order to create multi-gene knockouts following a single round of transfection in mouse small intestinal organoids. Our strategy allows for the concatemerization of up to four individual gRNAs into a single vector by performing a single Golden Gate shuffling reaction with annealed gRNA oligos and a pre-designed retroviral vector. This allows either the simultaneous knockout of up to four different genes, or increased knockout efficiency following the targeting of one gene by multiple gRNAs. In this protocol, we show in detail how to efficiently clone multiple gRNAs into the retroviral CRISPR-concatemer vector and how to achieve highly efficient electroporation in intestinal organoids. As an example, we show that simultaneous knockout of two pairs of genes encoding negative regulators of the Wnt signaling pathway (Axin1/2 and Rnf43/Znrf3) renders intestinal organoids resistant to the withdrawal of key growth factors.

This protocol describes the steps for cloning multiple single guide RNAs into one guide RNA concatemer vector, which is of particular use in creating multi-gene knockouts using CRISPR/Cas9 technology. The generation of double knockouts in intestinal organoids is shown as a possible application of this method.

CRISPR-concatemer를 이용한 마우스 작은 창자 organoids에서 다중 유전자 녹아웃을위한 프로토콜

CRISPR/Cas9 technology has greatly improved the feasibility and speed of loss-of-function studies that are essential in understanding gene function. In ...

생체공학

Construction of CRISPR Plasmids and Detection of Knockout Efficiency in Mammalian Cells through a Dual Luciferase Reporter System

Although highly efficient, modification of a genomic site by the CRISPR enzyme requires the generation of a sgRNA unique to the target site(s) beforehand. This work describes the key steps leading to the construction of efficient sgRNA vectors using a strategy that allows the efficient detection of the positive colonies by PCR prior to DNA sequencing. Since efficient genome editing using the CRISPR system requires a highly efficient sgRNA, a preselection of candidate sgRNA targets is necessary to save time and effort. A dual luciferase reporter system has been developed to evaluate knockout efficiency by examining double-strand break repair via single strand annealing. Here, we use this reporter system to pick up the preferred xCas9/sgRNA target from candidate sgRNA vectors for specific gene editing. The protocol outlined will provide a preferred sgRNA/CRISPR enzyme vector in 10 days (starting with appropriately designed oligonucleotides).

Here, we present a protocol describing a streamlined method for the efficient generation of plasmids expressing both the CRISPR enzyme and associated single guide RNA (sgRNAs). Co-transfection of mammalian cells with this sgRNA/CRISPR vector and a dual luciferase reporter vector that examines double-strand break repair allows evaluation of knockout efficiency.

이중 루시파라제 기자 시스템을 통해 포유류 세포에서 CRISPR 플라스미드 의 건설 및 녹아웃 효율 검출

Although highly efficient, modification of a genomic site by the CRISPR enzyme requires the generation of a sgRNA unique to the target site(s) beforehand. ...

Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific eukaryotic genome engineering. CRISPR/Cas9 is an inexpensive, facile, and efficient genome editing tool that allows genetic perturbation of genes and genetic elements. Here we present a simple methodology for CRISPR design, cloning, and delivery for the production of genomic deletions. In addition, we describe techniques for deletion, identification, and characterization. This strategy relies on cellular delivery of a pair of chimeric single guide RNAs (sgRNAs) to create two double strand breaks (DSBs) at a locus in order to delete the intervening DNA segment by non-homologous end joining (NHEJ) repair. Deletions have potential advantages as compared to single-site small indels given the efficiency of biallelic modification, ease of rapid identification by PCR, predictability of loss-of-function, and utility for the study of non-coding elements. This approach can be used for efficient loss-of-function studies of genes and genetic elements in mammalian cell lines.

CRISPR/Cas9 is a robust system to produce disruption of genes and genetic elements. Here we describe a protocol for the efficient creation of genomic deletions in mammalian cell lines using CRISPR/Cas9.

CRISPR / Cas9를 통해 포유 동물 세포주의 게놈에 삭제 세대

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific ...

생물학

Electroporation-Based CRISPR-Cas9-Mediated Gene Knockout in THP-1 Cells and Single-Cell Clone Isolation

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including their interplay with significant human pathogens such as the human immunodeficiency virus (HIV). Compared to other immortalized cell lines of myeloid origin, THP-1 cells retain many intact inflammatory signaling pathways and display phenotypic characteristics that more closely resemble those of primary monocytes, including the ability to differentiate into macrophages when treated with phorbol-12-myristate 13-acetate (PMA). The use of CRISPR-Cas9 technology to engineer THP-1 cells through targeted gene knockout (KO) provides a powerful approach to better characterize immune-related mechanisms, including virus-host interactions. This article describes a protocol for efficient CRISPR-Cas9-based engineering using electroporation to deliver pre-assembled Cas9:sgRNA ribonucleoproteins into the cell nucleus. Using multiple sgRNAs targeting the same locus at slightly different positions results in the deletion of large DNA fragments, thereby increasing editing efficiency, as assessed by the T7 endonuclease I assay. CRISPR-Cas9-mediated editing at the genetic level was validated by Sanger sequencing followed by Inference of CRISPR Edits (ICE) analysis. Protein depletion was confirmed by immunoblotting coupled with a functional assay. Using this protocol, up to 100% indels in the targeted locus and a decrease of over 95% in protein expression were achieved. The high editing efficiency makes it convenient to isolate single-cell clones by limiting dilution.

The THP-1 cell line is widely used as a model to investigate the functions of human monocytes/macrophages across various biology-related research areas. This article describes a protocol for efficient CRISPR-Cas9-based engineering and single-cell clone isolation, enabling the production of robust and reproducible phenotypic data.

THP-1 세포의 전기천공법 기반 CRISPR-Cas9 매개 유전자 녹아웃 및 단일 세포 클론 분리

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including ...

면역학 및 감염병학

CRISPR-Cas9 Mediated Gene Deletion in Human Pluripotent Stem Cells Cultured Under Feeder-Free Conditions

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical application of this technique, particularly in pluripotent stem cells, presents certain challenges, such as being time- and labor-intensive and having low editing efficiency. Here, we describe the generation of a CRISPR-mediated gene knockout in a human embryonic stem cell (hESC) line stably expressing sgRNAs for the L2HGDH gene, using a highly efficient and stable lentiviral-mediated gene delivery system. The sgRNAs targeting exon 1 of the L2HGDH gene were chemically synthesized and cloned into the lentiCRISPR v2-puro vector, which combines the constitutive expression of sgRNAs with Cas9 in a highly efficient single-vector system to achieve higher lentiviral titers for hESC infection and stable selection using puromycin. Puromycin-selected cells were further expanded, and single-cell clones were obtained using the limited dilution method. The single clones were expanded, and several homozygous knockout clones for the L2HGDH gene were obtained, as confirmed by a 100% reduction in L2HGDH expression using Western blot analysis. Furthermore, using MSBSP-PCR, the CRISPR mutation site was mapped upstream of the PAM recognition sequence of Cas9 in the selected homozygous clones. Sanger sequencing was performed to analyze the exact insertions/deletions, and functional characterization of the clones was conducted. This method produced a significantly higher percentage of homozygous deletions compared to previously reported non-viral gene delivery methods. Although this report focuses on the L2HGDH gene, this robust and cost-effective approach can be used to create homozygous knockouts for other genes in pluripotent stem cells for gene function studies.

<meta charset="utf8"></head><body>CRISPR-Cas9 매개 유전자 결실은 feeder-free 조건에서 배양된 인간 만능 줄기 세포에서 발생합니다.

The presented method describes the generation of a CRISPR-mediated gene knockout in the human embryonic stem cell (hESC) line H9, which stably expresses sgRNAs targeting the L2HGDH gene using a highly efficient lentiviral-mediated gene delivery system.

CRISPR-Cas9 매개 유전자 결실은 feeder-free 조건에서 배양된 인간 만능 줄기 세포에서 발생합니다.

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical ...