저자는 클론 파생 바이러스의 특성 규명에 도움을 주신 Kristen Bullard-Feibelman, Milena Veselinovic 및 Claudia Rückert에게 감사드립니다. 이 연구는 국립 알레르기 및 전염병 연구소 (NIH)에서 AI114675 (BJG) 및 AI067380 (GDE) 보조금으로 일부 지원되었습니다.

1. 감염성 클론 Plasmid의 형질 전환 및 회수 <ol><li> 상업적 형질 전환 프로토콜 ( 예 : NEB 5 Minute Transformation Protocol)을 사용하여 두 가지 플라스미드 (일부분)를 변형하여 변형시킨다. 두 플라스미드 모두 암피실린 내성을 나타내는 유전자를 포함하고 있으므로 선택시 암피실린이나 카 베니 실린을 사용하십시오. Carbenicillin은보다 안정적이므로 선호됩니다. <ol><li> -80 ° C의 냉동고에서 세포 (물질 표 참조)를 제거하고 5-10 분 동안 얼음 위에서 녹입니다. 37 ℃에서 카파 보이트 억제 (SOC (항생 물질 없음) - 세포와 함께)와 함께 prewarm lysogeny 국물 (LB) (10g / L NaCl 및 25 μg / ML carbenicillin을 포함, LB - carb라는) 접시와 국물. </li><li> 50 μL의 유능한 세포가 들어있는 튜브에 1 μL의 플라스미드 DNA에 100 pg-10 ng을 첨가하십시오. 튜브를 가볍게 흔들어서 가볍게 섞는다. </li><li> 5 분 동안 얼음에 튜브를 품어 라. </li><li> 42 ° C에서 30 초 동안 열 충격 튜브수조에. 열 충격 직후 2 분 동안 얼음으로 되돌아갑니다. </li><li> 각 튜브에 상온 SOC 950 μL를 피펫으로 섞는다. LB - carb 플레이트에 박테리아 혼합물 100 μL를 퍼 뜨리고 37 ° C (대략 12-14 H) 밤새 품어. </li></ol></li><li> 12-14 시간 배양 후 37 ° C 배양기에서 플레이트를 제거하십시오. 식민지가 (약 8-9 시간) 성장을 계속할 수 있도록 실온에서 어두운 서랍에 판을 놓으십시오. </li><li> Terrific broth (TB, TB-carb라고 불리는 25 μg / mL carbenicillin 함유) 5 mL를 사용하여 박테리아 셰이커 (대략 14-16 h)에서 30 ° C 밤새 각 플라스미드에 대해 5 ~ 10 개의 작은 콜로니를 성장시킵니다. 참고 : 작은 콜로니는 플라스미드가 손상되지 않았다는 표시입니다. 결실, 재배치 또는 돌연변이 (본 명세서에서 불안정성 사건이라 칭함)를 포함하는 플라스미드를 갖는 콜로니는보다 빨리 성장할 것이며 따라서 더 커질 것이다. 따라서 플레이트에서 가장 작은 콜로니를 선택해야합니다.가장 큰 식민지를 선택한다. 일부 중간 크기의 콜로니도 완결을 위해 선택 될 수 있습니다. 사용 된 온도가 낮 으면 세포가 자라날 확률이 줄어 듭니다 (OD 600 이 0.6-0.8 이상). 대부분의 연구자가 하룻밤 사이의 성장을 수행하기 때문에 더 많은 제어와과 성장 기회 감소가 가능합니다. </li><li> 탁도 (대략 OD 600 0.6-0.8)에 대한 액체 배양을 점검하십시오. 4 ℃에서 모든 탁한 튜브를 놓고 다른 튜브가 오래 동안 성장하여 탁 해지도록하십시오. 참고 : 플라스미라 불안정성 사건이 발생할 수 있으므로 권장치보다 큰 OD 600 값으로 박테리아를 키우지 마십시오. </li><li> 상업용 플라스미드 miniprep 키트 (재료 표 참조)로 박테리아에서 플라스미드 DNA를 추출합니다. 사전 가열 (가열 블록에서 70 ° C까지) 용리 완충액 15 μL로 용리. 원심 분리 전에 용출 완충액을 컬럼에서 5 분 동안 배양합니다. 주의 사항 :이 시동기 배양액 1 mL 이상을 4 ° C다음 단계에서 더 사용하십시오. </li><li> 배양 중에 플라스미드 불안정성 사건이 발생했는지 평가하기 위해 회수 된 플라스미드 10 μL를 소화합니다. 참고 : pI를 SalI / NheI로, p2를 BamHI / HindIII로 37 ℃에서 1 시간 분해하십시오. 겔 전기 영동으로 소화 한 후 올바른 밴드가 있는지 확인하고 ( 그림 2a ) 2 단계로 진행합니다. 롤링 서클 증폭 (RCA)으로 플라스미드 DNA를 준비하는 경우 miniprep 용리액의 일부를 주형으로 준비하십시오. </li></ol> 2. 라이 게이션을위한 충분한 플라스미드 DNA의 준비 참고 : 연결 및 후속 electroporation은 maxiprep 또는 RCA를 통해 생성되어야합니다 충분한 양의 플라스미드 DNA가 필요합니다. maxiprep은 전통적으로 사용되는 접근법이지만 RCA는 박테리아를 필요로하지 않는 이점을 제공하므로 박테리아에서 플라스미드 유도 독성의 가능성을 제거하여 불안정성을 유발할 수 있습니다. <ol><li><strong&gt; 다음 maxiprep 절차를 수행하십시오. <ol><li> 이전 섹션에서 정확한 제한 효소 소화 패턴을 시연 한 각 플라스미드에 TB-Carb (25 μg / mL carbenicillin) 배지 1 L에 시동기 배양 500 μL를 첨가하고 30 ° C (약 14-16 시간) , 약 0.6-0.8의 OD 600 ). 참고 :이 OD 600 값 이상으로 배양되지 않도록하십시오. 이것은 잠재적으로 플라스미드 내에서 불안정한 결과를 초래할 것이다. </li><li> 박테리아를 수확하고 제조사의 프로토콜에 따라 maxipreps를 수행하십시오 (Materials Table 참조). </li></ol></li><li> 1.6 단계에서 저장된 miniprep을 사용하여 RCA 절차에 대해 다음을 수행하십시오. <ol><li> 샘플 버퍼 50 μL를 포함하는 튜브에 플라스미드 DNA 1 μL를 전송합니다. </li><li> 95 ° C에서 3 분간 열 변성시킨 다음 4 ° C에서 배양하여 사용할 준비가 될 때까지 기다리십시오. </li><li> 상업적 증폭 준비premix ( 재료 표 참조). 얼음에 세트 튜브에 효소 믹스 2 μL와 반응 버퍼 50 μL를 결합하십시오. 참고 : 증폭 프리믹스는 사용할 준비가 될 때까지 얼음에 보관해야합니다. 요구되는 수의 증폭 반응을위한 충분한 시약을 조합하여 마스터 믹스를 준비하는 것이 편리합니다. 사용하지 않은 모든 프리믹스는 폐기해야합니다. </li><li> 준비된 증폭 premix 50 μL를 변성 된 시료에 옮긴다. </li><li> 반응 튜브를 30 ° C에서 18 시간 동안 품어 낸다. </li><li> 튜브를 65 ° C에서 10 분 동안 배양하여 ø29 DNA 중합 효소를 비활성화한다. </li><li> 사용 준비가 끝날 때까지 반응 튜브를 4 ° C 또는 -20 ° C에 보관하십시오. 참고 :이 시점에서 두 방법을 통해 준비된 플라스미드 DNA는 (260 nm에서의 흡광도를 사용하여) 정량화되어야하며 ZIKV 게놈은 생기지 않은 상태 (삭제 및 재배치)가 발생하지 않았 음을 확인하기 위해 생거 (Sanger) 서열을 완전히 시퀀싱해야합니다. </li></ol></li></ol><table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 입문서 이름 </td><td> 서열 (5 &#39;- 3&#39;) </td></tr><tr><td> ZIKV PRVABC59 1For. </td><td> AGTTGTTGATCTGTGTGAATCAGAC </td></tr><tr><td> ZIKV 보존 된 632For. </td><td> GCCCTATGCTGGATGAGG </td></tr><tr><td> ZIKV 보존 된 692Rev. </td><td> GGTTCCGTACACAACCCAAGTTG </td></tr><tr><td> ZIKV 보존 된 1313Rev. </td><td> CTCCCTTTGCCAAAAAGTCCACA </td></tr><tr><td> ZIKV 보존 된 1201 용. </td><td> CCAACACAAGGTGAAGCCTAC </td></tr><tr><td> ZIKV 보존 된 1663For. </td><td> GCAGACACCGGAACTCCACACT </td></tr><tr><td> 2008 년 보존 된 ZIKV. </td><td> CAGATGGCGGTGGACATGC </td></tr><tr><td> ZIKV는 2350Rev를 보존합니다. </td><td> GTGAGAACCAGGACATTCCTCC </td></tr><tr><td> ZIKV 보존 된 2605For. </td><td> TACAAGTACCATCCTGACTCCC </td></tr><tr><td> ZIKV 보존 된 3499Rev. </td><td>GCCTTATCTCCATTCCATACCA </td></tr><tr><td> ZIKV 보존 3961Rev. </td><td> TTGCCAACCAGGCCAAAG </td></tr><tr><td> ZIKV 보존 4132For. </td><td> CATTTGTCATGGCCCTGG </td></tr><tr><td> ZIKV 보존 된 4561Rev. </td><td> CTATTGGGTTCATGCCACAGAT </td></tr><tr><td> ZIKV 보존 된 4665For. </td><td> GACCACAGATGGAGTGTACAGAGT </td></tr><tr><td> ZIKV 보존 5189Rev. </td><td> AAGACAGTTAGCTGCTTCTTCTTCAG </td></tr><tr><td> ZIKV 보존 5219For. </td><td> GAGAGTTCTTCCTGAAATAGTCCGTGA </td></tr><tr><td> ZIKV 보존 된 6086Rev. </td><td> CTTGCTTCAAGCCAGTGTGC </td></tr><tr><td> ZIKV 보존 된 6119 포. </td><td> GCCTCATAGCCTCGCTCTATCG </td></tr><tr><td> ZIKV 보존 된 6721Rev. </td><td> CCATTCCAAAGCCCATCTTCCC </td></tr><tr><td> ZIKV 보존 된 6769For. </td><td> CCAGCCAGAATTGCATGTGTCC </td></tr><tr><td> ZIKV 보존 된 7209Rev. </td><td> ATCATTAGCAGCGGGACTCCAA </td></tr><tr><td> ZIKV 보존 된 7343For. </td><td> GTTGTGGATGGAATAGTGGT </td></tr><tr><td> ZIKV 보존 8243 용. </td><td> TGCCCATACACCAGCACTATGA </td></tr><tr><td> ZIKV PRVABC59 8893Rev </td><td> TGCATTGCTACGAACCTTGTTG </td></tr><tr><td> ZIKV는 9133For를 보존했습니다. </td><td> AGCCCTTGGATTCTTGAACGAGGA </td></tr><tr><td> ZIKV PRVABC59 9673Rev. </td><td> AACGCAATCATCTCCACTGACT </td></tr><tr><td> ZIKV는 9686을 위해 보존되었습니다. </td><td> GATGATAGGTTGCACATGCC </td></tr><tr><td> ZIKV 보존 된 10321Rev. </td><td> GTCCATGTACTTTTCTTCATCACCTAT </td></tr><tr><td> ZIKV 보존 된 10455For. </td><td> CAGGAGAAGCTGGGAAACC </td></tr><tr><td> ZIKV 보존 된 10621Rev. </td><td> CAGATTGAAGGGTGGGGAAGGTC </td></tr></tbody></table> 표 1 : cDNA 클론을 시퀀싱하기위한 프라이머. 플라스미드는 나열된 프라이머로 완전히 시퀀싱 할 수 있습니다. &quot;conserved&quot;indi로 표시 한 프라이머ZIKV의 모든 유전형을 서열화 / 증폭시킬 가능성이 높다. &quot;PRVABC59&quot;로 표시된 프라이머는이 균주에 특이 적이지만 다른 아시아 유전자형 계통 및 기타 유전자형에도 사용할 수 있습니다. 3. 체외 수정 RNA의 준비 <ol><li> maxiprep 또는 RCA 준비 DNA의 소화 반응을 설정하십시오. <ol><li> p1 소화의 경우, 10x 반응 완충액, 3 μL의 ApaLI, 3 μL의 BamHI-HF, 3 μL의 rSAP 또는 CIP, 및 3.3 μg의 p1 DNA를 혼합한다. 100 μL에 ddH 2 O를 첨가한다. </li><li> p2 소화를 위해서는 10x 반응 완충액 10 μL, ApaLI 3 μL, EcoRI-HF 3 μL 및 p2 DNA 13.3 μg을 섞는다. 100 μL에 ddH 2 O를 첨가한다. </li><li> 1-2 시간 동안 37 ° C에서 배양하십시오. </li><li> 시중에서 판매하는 젤 및 PCR 클린업 키트를 사용하여 정제하십시오 (재료 표 참조). 가열 블록에서 70 ° C로 예열 된 용리 완충액 30 μL로 용리회전하기 전에 5 분 동안 칼럼). 참고 : 1 μL을 나중에 젤에서 실행하십시오. </li></ol></li><li> 라이 게이션 반응을 준비하십시오. <ol><li> 10x T4 DNA 연결 반응 버퍼 10 μL, T4 DNA 리가 아제 (400 U / μL) 3 μL, 정제 p1 29 μL 및 정제 P2 29 μL를 합칩니다. 100 μL에 ddH 2 O를 첨가한다. </li><li> 상온에서 2 시간 또는 16 ° C 밤새 품어 낸다. </li><li> 시중에서 판매하는 젤 및 PCR 클린업 키트를 사용하여 정제하십시오 (재료 표 참조). 가열 블록 (회전하기 전에 5 분 동안 부화 칼럼)에서 70 ° C로 예열 된 용리 완충액 10 μL로 용출시킨다. 참고 : 1 μL을 나중에 젤에서 실행하십시오. </li></ol></li><li> 소화되지 않은 플라스미드, 소화 된 플라스미드 및 아가 로스 겔에서의 연결 장치를 작동시킨다. 라이 게이션 제품은 소화 된 플라스미드 단독보다 높은 분자량 밴드 (약 11kb)를 가져야하며, 이는 라이 게이션이 성공적임을 나타냅니다 ( 그림 2b ).</li><li> T7 in vitro 전사 반응을 설정하십시오. <ol><li> 10 μL 2x ARCA / NTP 혼합, 2 μL의 T7 RNA 중합 효소 혼합 및 최종 부피 20 μL를위한 8 μL의 정제 된 연결 반응을 합칩니다. 참고 : 믹스에 포함 된 ARCA는 올바른 방향으로 독점적으로 통합 된 캡 아날로그입니다. 표준 캡 아날로그는 올바른 방향으로 뚜껑이있는 전사 물의 ~ 50 % 만 얻을 수 있습니다. </li><li> 37 ° C에서 4 시간 동안 품어 낸다. </li><li> UV 분광 광도계를 통해 RNA 농도를 측정하십시오. RNA 전 사체의 길이를 확인하기 위해 denaturing agarose gel을 실행하십시오 (선택 사항). </li></ol></li></ol> 4. 일렉트로 포 레이션에 의한 감염 바이러스의 구조 <ol><li> (T150 및 T182 사이의 수용 가능, DMEM + 10 % 태아 소 혈청 (FBS)에서 재배) 1 개의 T182 플라스크를 회수해야한다. mock transfection control으로 1 T182를 포함하십시오. Cells는 70-80 %의 confluency에서 사용해야합니다. </li><li> 세포가 준비되면, 37 ° C로 가열 수 중 욕에서 DMEM + 15 % FBS + 10 MM HEPES의 12 ML / 반응을 놓으십시오. </li><li> 표준 프로토콜과 trypsinization하여 세포를 분리하고 트립신을 비활성화하는 10 % FBS와 미디어에서 세포를 복구, 4 ° C에서 5 분 동안 150 XG에서 세포를 원심 분리하십시오. </li><li> 4 ° C에서 5 분 150 XG에서 세포를 pelleting 1X 인산 버퍼 식염수 (PBS)에서 세포를 씻으십시오. 이 단계를 두 번 반복하여 총 세 번의 세척을하십시오. </li><li> 샘플 당 RPMI 1640 + 10 MM HEPES (멸균) 200 μL에 Resuspend 세포. 멸균 튜브에 세포 현탁액 200 μL를 전송합니다. 세포는 ~ 0.5 x 107 세포 / mL이어야합니다. </li><li> 단계 3.4에서 생성 된 RNA (바람직하게는 5-10 μg) 20 μL를 세포의 각 세트에 첨가한다. 튜브를 가볍게 치고 부드럽게 혼합하고 튜브의 내용물을 2mm 간격의 전기 천공 큐벳으로 옮긴다. </li><li> electr 설정oporator는 170V LV, 오메가 (저항)는 0 및 950μF (약 625V / cm 및 다른 기계의 경우 20ms 시정 수). 사용 가능한 가장 낮은 설정으로 0 또는 ∞로 저항을 설정합니다. </li><li> 1 회 펄스하고 단계 4.2에서 가온 된 DMEM + 15 % FBS + 10 mM HEPES 600 μL를 즉시 첨가한다. 모든 세포를 제거하기 위해 큐벳의 내부를 철저히 씻어 내십시오. 사전 예열 매체 10 ML을 포함 T75 조직 배양 플라스크에 세포를 추가합니다. 큐벳에 포함 된 드로퍼를 사용하여 큐벳에서 추가 미디어를 제거합니다. 불임을 유지하도록주의하십시오. </li><li> 미디어와 세포를 혼합하고 37 ° C 배양기에 넣으십시오. </li><li> 다음날 세포 생존 가능성을 확인하고, 50-75 % 세포 사멸이 관찰 될 때까지 매일 그렇게하십시오. 세포 사멸은 모의 electroporated 컨트롤과 비교하여 관찰됩니다. 참고 : ZIKV 세포 병리학 적 효과 (CPE)는 Vero 세포에서 아주 분명하게 나타나 세포 배양액을 분리하여 부유시킵니다. 우리는 가지고있다.수확에 이상적인 것으로 8-10 일의 범위를 관찰했다. </li><li> 원뿔 튜브와 원심 분리기에있는 상층 액을 수확하여 4 ℃에서 10 분 이상&gt; 3000 xg에서 세포 파편을 제거합니다. </li><li> 깨끗한 상청액을 새 튜브에 옮기고 20 % FBS (100 % 주식)의 최종 농도로 보충합니다. 또한, 동결 상태 (1 M 멸균 주식)에서 바이러스 감염성을 보존하기 위해 완충제로 10 mM의 최종 농도에서 무균 HEPES를 첨가하십시오. </li><li> vortexing과 나누어 냄으로써 스크류 캡 바이알에 바이러스를 혼합합니다. 나중에 사용할 수 있도록 -80 ° C에서 보관하십시오. </li></ol> 5. 회복 된 바이러스의 적정 <ol><li> 적정하기 전날 Vero 세포의 6- 또는 12- 웰 플레이트의 적절한 수를 씨닝하십시오. </li><li> 냉동실에서 바이러스를 제거하고 튜브 또는 96 - 웰 플레이트에있는 DMEM + 2 % FBS에서 연속 10 배 희석합니다. 참고 : 회수 된 클론의 예상 역가는 1 x 106 ~ 5 x 107 PFU / mL입니다. </li><li> 200 o 추가400μL 씩 각 희석액을 12 또는 6 웰 플레이트의 웰에 각각 복제한다. </li><li> 37 ° C 배양기 및 암석을 매 15 분마다 놓아서 총 1-1.5 시간의 흡착 기간을 거친다. </li><li> 바이러스 접종원을 제거하고 각 잘 1 ML (12 - 웰) 또는 2 ML (6 - 잘) DMEM - Tragacanth 오버레이를 추가합니다. 참고 : 여기에는 아가로 오스, 한천, 메틸 셀룰로오스 또는 기타 오버레이 미디어를 사용할 수 있습니다. </li><li> 5 일 동안 37 ° C 배양기에서 세포를 품어. 적절한 플라크 형성 시간은 사용되는 오버레이에 따라 다릅니다. </li><li> 세포를 고정시키기 위해 인큐베이터에서 플레이트를 제거하고 오버레이를 부드럽게 소독제에 버립니다. </li><li> 커버와 소용돌이가 혼합되도록 각 우물에 충분한 20 % 에탄올 /0.1 % 크리스탈 바이올렛 (CV)을 추가합니다. 참고 : 많은 다른 정착액이 존재하며 여기에서 사용할 수 있습니다. 또한 아가로 오스 또는 한천 오버레이를 사용하는 경우 중성 색과 함께 두 번째 오버레이를 사용하여 고정하지 않고 플라크를 시각화 할 수 있습니다. 20 % 에탄올은이전 연구에서 외피 바이러스를 비활성화시키는 데 효과적입니다. 봉투되지 않은 바이러스는 비활성화되지 않으므로이 금액을 사용하지 마십시오 19 . </li><li> 플레이트를 상온에서 30-60 분 동안 배양하십시오 (클래스 II 바이오 안전성 캐비닛에서). CV (지역 규정에 따라)를 버리고 수돗물로 접시를 씻으십시오. </li><li> 접시를 건조시키고 플라크를 수동으로 계산하십시오. 참고 : 참조 번호 20은 플라크 분석을 수행하기위한 추가 참조 자료로 사용할 수 있습니다. </li></ol>

<ol>
	<li>Kindhauser, M. K., Allen, T., Frank, V., Santhana, R. S., Dye, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika:+the+origin+and+spread+of+a+mosquito-borne+virus.">Zika: the origin and spread of a mosquito-borne virus.</a> Bull World Health Organ. 94 (9), 675C-686C (2016).</li><li>Oehler, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+virus+infection+complicated+by+Guillain-Barre+syndrome--case+report,+French+Polynesia,+December+2013.">Zika virus infection complicated by Guillain-Barre syndrome--case report, French Polynesia, December 2013.</a> Euro Surveill. 19 (9), (2014).</li><li>Li, D., Aaskov, J., Lott, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+cryptic+prokaryotic+promoter+within+the+cDNA+encoding+the+5'+end+of+dengue+virus+RNA+genome.">Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.</a> PLoS One. 6 (3), e18197 (2011).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+approach+to+propagate+flavivirus+infectious+cDNA+clones+in+bacteria+by+introducing+tandem+repeat+sequences+upstream+of+virus+genome.">A novel approach to propagate flavivirus infectious cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome.</a> J Gen Virol. 95 (Pt 7), 1493-1503 (2014).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Successful+propagation+of+flavivirus+infectious+cDNAs+by+a+novel+method+to+reduce+the+cryptic+bacterial+promoter+activity+of+virus+genomes.">Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes.</a> J Virol. 85 (6), 2927-2941 (2011).</li><li>Rice, C. M., Grakoui, A., Galler, R., Chambers, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+of+infectious+yellow+fever+RNA+from+full-length+cDNA+templates+produced+by+in+vitro+ligation.">Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation.</a> New Biol. 1 (3), 285-296 (1989).</li><li>Yun, S. I., Kim, S. Y., Rice, C. M., Lee, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+application+of+a+reverse+genetics+system+for+Japanese+encephalitis+virus.">Development and application of a reverse genetics system for Japanese encephalitis virus.</a> J Virol. 77 (11), 6450-6465 (2003).</li><li>Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., Davidson, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+major+determinant+of+mouse+neurovirulence+of+dengue+virus+type+2+using+stably+cloned+genomic-length+cDNA.">Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA.</a> J Gen Virol. 79 (Pt 3), 437-446 (1998).</li><li>Johansen, I. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intron+insertion+facilitates+amplification+of+cloned+virus+cDNA+in+Escherichia+coli+while+biological+activity+is+reestablished+after+transcription+in+vivo.">Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo.</a> Proc Natl Acad Sci U S A. 93 (22), 12400-12405 (1996).</li><li>Shan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Infectious+cDNA+Clone+of+Zika+Virus+to+Study+Viral+Virulence,+Mosquito+Transmission,+and+Antiviral+Inhibitors.">An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors.</a> Cell Host Microbe. 19 (6), 891-900 (2016).</li><li>Schwarz, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rescue+of+the+1947+Zika+Virus+Prototype+Strain+with+a+Cytomegalovirus+Promoter-Driven+cDNA+Clone.">Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone.</a> mSphere. 1 (5), (2016).</li><li>Tsetsarkin, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Full-Length+Infectious+cDNA+Clone+of+Zika+Virus+from+the+2015+Epidemic+in+Brazil+as+a+Genetic+Platform+for+Studies+of+Virus-Host+Interactions+and+Vaccine+Development.">A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development.</a> MBio. 7 (4), (2016).</li><li>Gadea, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+method+for+the+rapid+generation+of+recombinant+Zika+virus+expressing+the+GFP+reporter+gene.">A robust method for the rapid generation of recombinant Zika virus expressing the GFP reporter gene.</a> Virology. 497, 157-162 (2016).</li><li>Kapoor, M., Zhang, L., Mohan, P. M., Padmanabhan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+and+characterization+of+an+infectious+dengue+virus+type-2+RNA+genome+(New+Guinea+C+strain).">Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain).</a> Gene. 162 (2), 175-180 (1995).</li><li>Messer, W. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+characterization+of+a+reverse+genetic+system+for+studying+dengue+virus+serotype+3+strain+variation+and+neutralization.">Development and characterization of a reverse genetic system for studying dengue virus serotype 3 strain variation and neutralization.</a> PLoS Negl Trop Dis. 6 (2), e1486 (2012).</li><li>Kinney, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avian+virulence+and+thermostable+replication+of+the+North+American+strain+of+West+Nile+virus.">Avian virulence and thermostable replication of the North American strain of West Nile virus.</a> J Gen Virol. 87 (Pt 12), 3611-3622 (2006).</li><li>Chang, A. C., Cohen, S. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+amplifiable+multicopy+DNA+cloning+vehicles+derived+from+the+P15A+cryptic+miniplasmid.">Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid.</a> J Bacteriol. 134 (3), 1141-1156 (1978).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. 91 (1), (2017).</li><li>Roberts, P. L., Lloyd, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus+inactivation+by+protein+denaturants+used+in+affinity+chromatography.">Virus inactivation by protein denaturants used in affinity chromatography.</a> Biologicals. 35 (4), 343-347 (2007).</li><li>Baer, A., Kehn-Hall, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+concentration+determination+through+plaque+assays:+using+traditional+and+novel+overlay+systems.">Viral concentration determination through plaque assays: using traditional and novel overlay systems.</a> J Vis Exp. (93), e52065 (2014).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. , (2016).</li><li>Grubaugh, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Drift+during+Systemic+Arbovirus+Infection+of+Mosquito+Vectors+Leads+to+Decreased+Relative+Fitness+during+Host+Switching.">Genetic Drift during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during Host Switching.</a> Cell Host Microbe. 19 (4), 481-492 (2016).</li></ol>

저자는 공개 할 것이 없습니다.

Here we describe a method for the recovery of a bipartite infectious cDNA clone system for ZIKV. Previously described clones for ZIKV suffer from either attenuation or require the addition of introns, making plasmids larger and preventing rescue in insect cells. Infectious virus can be recovered using the two-plasmid clone system in either mammalian or insect cells (data not shown). In addition, virus recovered from this system behaves similarly to wild-type virus in several cell lines, in an immunocompromised mouse mode...

Zika 바이러스 (ZIKV, Family Flaviviridae : Flavivirus 속)는 2013-14 년 브라질에 도착한 모기에 의한 플라 비 바이러스로 이후 미주 전역에 퍼져 있던 열병의 대규모 발생과 관련이 있습니다 1 . 또한, ZIKV는 성인의 길랑 발레 증후군 및 태아 및 신생아의 소두증과 같은 심각한 질병 결과와 관련되어 있습니다 2 . 서반구에서 급속하게 확산되기 전에 ZIKV에 대해 알려진 것이 거의 없다. 여기에는 분자 도구가 없어 기계 론적 연구가 어려웠습니다. 감염성 cDNA 클론과 같은 바이러스의 분자 도구는 백신 및 항 바이러스 치료 개발을 촉진하고 차별적 인 바이러스 병인, 면역 반응 및 바이러스 성 진화와 관련된 바이러스 유전 인자의 평가를 허용합니다. 플라 비 바이러스 전염성 클론은 cr 때문에 박테리아에서 매우 불안정한 것으로 알려져있다그들의 게놈에 존재하는 유익한 원핵 생물 프로모터 3 . 이 문제를 개선하기 위해 몇 가지 접근법이 사용되었습니다. 바이러스 서열 4의 상류 중계 반복의 삽입, 추정 원핵 생물 프로모터 서열 5의 돌연변이, 게놈을 다중 플라스미드 6 으로 분할, 저 복사 수 벡터 (박테리아 인공 염색체 포함) 7 및 바이러스 게놈에서의 인트론 삽입 9 . 수정하지 않은 하나의 전장 시스템이 ZIKV에 대해 설명되었습니다. 그러나,이 클론은 세포 배양 및 마우스에서 약화 된 것으로 보였다. 다른 그룹은 인트론을 ZIKV 게놈으로 조작하여 감염성 바이러스 11 의 생산을 위해 포유류 세포 에서 시험관 내 에서 접합 될 수있는 박테리아의 불안정한 서열을 파괴 할 수 있도록했습니다, 12 . 또한, 전염성 - 서브 게놈 - 앰플리 콘이라는 제목의 PCR 기반 시스템이 ZIKV 13 의 원형 MR766을 구제하는데 성공적으로 사용되었습니다. 여기에 설명 된 접근 방식은 외래 서열을 필요로하지 않고 황열병 6 , 뎅기열 14 , 15 및 웨스트 나일 바이러스 16에서 성공적으로 사용 된 여러 플라스미드를 사용하여 불안정성이 높은 지역의 게놈을 파괴합니다. 또한 바이러스 게놈 말단에 D 형 간염 리보 자임 서열을 추가하면 선형화 부위를 추가 할 필요없이 진정한 3 &#39;말단을 만들 수 있습니다. 또한 두 플라스미드는 잔류 독성을 완화하기 위해 낮은 카피 수 벡터 (pACYC177, 세포 당 ~ 15 카피)로 구성된다. 복구 된 바이러스는포유류와 곤충 둘 다에서 파생 된 다양한 세포 유형을 포함하는 8 개의 세포주 에서 체외 성장 곡선에서 부모 바이러스. 모기에서 마우스와 감염, 보급 및 전염 속도에서 동일한 병원성 프로파일을 나타냈다. 여기서, 우리는 감염성 클론 플라스미드를 성장시키고, 체외에서 전장 바이러스 성 RNA (바이러스 성 게놈) 를 생성하고 , 세포 배양에서 감염성 바이러스를 회수하는 방법을 기술 한 프로토콜을 상세히 설명한다. 첫째, 우리는 박테리아에서 플라스미드의 번식 또는 롤링 서클 증폭 (RCA)을 이용한 박테리아없는 증폭을 기술한다. 다음으로, 우리는 두 플라스미드가 어떻게 소화되는지를 보여 주며,이어서 전체 길이의 바이러스를 생성하기 위해 함께 연결됩니다. 마지막으로, 우리는 전사 RNA의 생산과 Vero 세포로의 전기 천공을 기술하고, 회수 된 바이러스의 적정을 기술한다 ( 그림 1 ). 설명 된 접근법은 빠르며, fo1 ~ 2 주 안에 전염성 바이러스 주식을 회수.

<table><tbody><tr><td>NEB Stable CompetentE. coli</td><td>New England BioLabs</td><td>C3040H</td><td></td></tr><tr><td>Carbenicillin, Disodium Salt</td><td>various</td><td></td><td></td></tr><tr><td>Zyppy Plasmid Miniprep Kit</td><td>Zymo Research</td><td>D4036</td><td></td></tr><tr><td>ZymoPURE Plasmid Maxiprep Kit</td><td>Zymo Research</td><td>D4202</td><td></td></tr><tr><td>SalI-HF</td><td>New England BioLabs</td><td>R3138S</td><td>20,000 units/ml</td></tr><tr><td>NheI-HF</td><td>New England BioLabs</td><td>R3131S</td><td>20,000 units/ml</td></tr><tr><td>ApaLI</td><td>New England BioLabs</td><td>R0507S</td><td>10,000 units/ml</td></tr><tr><td>EcoRI-HF</td><td>New England BioLabs</td><td>R3101S</td><td>20,000 units/ml</td></tr><tr><td>BamHI-HF</td><td>New England BioLabs</td><td>R3136S</td><td>20,000 units/ml</td></tr><tr><td>HindIII-HF</td><td>New England BioLabs</td><td>R3104S</td><td>20,000 units/ml</td></tr><tr><td>illustra TempliPhi 100 Amplification Kit</td><td>GE Healthcare Life Sciences</td><td>25640010</td><td></td></tr><tr><td>NucleoSpin Gel and PCR Clean-up</td><td>Macherey-Nagel</td><td>740609.5</td><td></td></tr><tr><td>Shrimp Alkaline Phosphatase (rSAP)</td><td>New England BioLabs</td><td>M0371S</td><td>1,000 units/ml</td></tr><tr><td>Alkaline Phosphatase, Calf Intestinal (CIP)</td><td>New England BioLabs</td><td>M0290S</td><td>10,000 units/ml</td></tr><tr><td>T4 DNA Ligase</td><td>New England BioLabs</td><td>M0202S</td><td>400,000units/mL</td></tr><tr><td>HiScribe T7 ARCA mRNA Kit</td><td>New England BioLabs</td><td>E2065S</td><td></td></tr><tr><td>Vero cells</td><td>ATCC</td><td>CCL-81</td><td></td></tr><tr><td>ECM 630 High Throughput Electroporation System</td><td>BTX</td><td>45-0423</td><td>Other machines are acceptable.</td></tr><tr><td>LB Broth with agar (Miller)</td><td>Sigma</td><td>L3147</td><td>Can be homemade as well.</td></tr><tr><td>Terrific Broth</td><td>Sigma</td><td>T0918</td><td>Can be homemade as well.</td></tr><tr><td>Petri Dish</td><td>Celltreat</td><td>229693</td><td></td></tr><tr><td>Culture Tubes</td><td>VWR International</td><td>60818-576</td><td></td></tr><tr><td>T75 flasks</td><td>Celltreat</td><td>229340</td><td></td></tr><tr><td>T182 flasks</td><td>Celltreat</td><td>229350</td><td></td></tr><tr><td>1x PBS</td><td>Corning</td><td>21-040-CV</td><td></td></tr><tr><td>RPMI 1640 with L-glutamine</td><td>Corning</td><td>10-040-CV</td><td></td></tr><tr><td>DMEM with L-glutamine and 4.5 g/L glucose</td><td>Corning</td><td>10-017-CV</td><td></td></tr><tr><td>Fetal Bovine Serum (FBS)</td><td>Atlas Biologicals</td><td>FP-0500-A</td><td></td></tr><tr><td>Tragacanth Powder</td><td>MP Bio</td><td>MP 104792</td><td></td></tr><tr><td>Crystal Violet</td><td>Amresco</td><td>0528-1006</td><td></td></tr><tr><td>Ethanol Denatured</td><td>VWR International</td><td>BDH1156-1LP</td><td></td></tr><tr><td>6 well plate</td><td>Celltreat</td><td>229106</td><td></td></tr><tr><td>12 well plate</td><td>Celltreat</td><td>229111</td><td></td></tr><tr><td>Sequencing Oligos</td><td>IDT</td><td>see table 1</td><td></td></tr><tr><td>Qubit 3.0</td><td>ThermoFisher</td><td>Qubit 3.0</td><td>other methods are acceptable.</td></tr><tr><td>Qubit dsDNA BR Assay Kit</td><td>ThermoFisher</td><td>Q32850</td><td>other methods are acceptable.</td></tr><tr><td>Qubit RNA HS Assay Kit</td><td>ThermoFisher</td><td>Q32852</td><td>other methods are acceptable.</td></tr><tr><td>Class II Biosafety Cabinet</td><td>Varies</td><td>N/A</td><td>This is necessary for live-virus work.</td></tr></tbody></table>

rescue and characterization of recombinant virus from a new world zika virus infectious clone

전염성 cDNA 클론은 바이러스의 유전자 조작을 허용하여 백신, 병인 발생, 복제, 전달 및 바이러스 진화에 대한 작업을 용이하게합니다. 여기에서는 Zika 바이러스 (ZIKV)에 대한 전염성 클론의 구축에 대해 설명합니다. ZIKV는 현재 미국에서 폭발적인 발병을 일으키고 있습니다. 플라 비 바이러스 유래 플라스미드에서 흔히 볼 수있는 박테리아에 대한 독성을 막기 위해 우리는 NS1 유전자에서 게놈을 분리하는 2 플라스미드 시스템을 만들었으며 돌연변이없이 성공적으로 복구 할 수 없었던 완전한 길이의 구조물보다 더 안정적이었다. 두 조각을 연결하기위한 소화 및 결합 후, 전장 바이러스 RNA는 T7 RNA 폴리머 라제로 시험 관내 전사에 의해 생성 될 수있다. 전사 된 RNA가 세포 내로 전기 천공 된 후 바이러스와 유사한 생체 내 성장 동역학 및 생체 내 독성 및 감염 표현형이 마우스 및 모기에서 각각 나타났다.

여기에 설명 된 프로토콜은 전염성 클론 파생 Zika 바이러스의 복구를 허용합니다. 2 플라스미드 감염 복제 시스템을 조작하는 것은 매우 불안정한 전장 버전 (데이터는 표시되지 않음)과 비교하여 신중하게 수행하면 간단합니다. 두 개의 개별 조각의 소화 및 연결 후, 봉쇄 된 RNA는 Vero 세포 ( 그림 1 )로 electroporated 다음 T7 중합 효소와 시험 관내</em...

Watch this Scientific Journal Video about Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone at JoVE.com

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

이 프로토콜은 두 개의 플라스미드 감염성 cDNA 클론으로부터 감염성 Zika 바이러스의 회수를 설명합니다.

새로운 세계 Zika 바이러스 전염성 클론으로부터 재조합 바이러스의 구조 및 특성 규명

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

rescue-characterization-recombinant-virus-from-new-world-zika-virus

Universidad de Cartagena UDEC

Research

JoVE Journal

Immunology and Infection

9.6K 조회수.  Colorado State University.  이 프로토콜은 두 개의 플라스미드 감염성 cDNA 클론으로부터 감염성 Zika 바이러스의 회수를 설명합니다. 

비디오: Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Generation of Recombinant Influenza Virus from Plasmid DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally established in 1999 1,2 plasmid-based reverse genetic techniques to generate recombinant viruses have revolutionized the influenza research field because specific questions have been answered by genetically engineered, infectious, recombinant influenza viruses. Such studies include virus replication, function of viral proteins, the contribution of specific mutations in viral proteins in viral replication and/or pathogenesis and, also, viral vectors using recombinant influenza viruses expressing foreign proteins 3.

Rescue of influenza A viruses from plasmid DNA is a basic and essential experimental technique that allows influenza researchers to generate recombinant viruses to study multiple aspects in the biology of influenza virus, and to be used as potential vectors or vaccines.

플라스미드 DNA의 재조합 독감 바이러스의 생성

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

연구

면역학 및 감염병학

Generation of Recombinant Arenavirus for Vaccine Development in FDA-Approved Vero Cells

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field 4. The use of cell-based arenavirus minigenome systems together with the ability to generate recombinant infectious arenaviruses with predetermined mutations in their genomes has facilitated the investigation of the contribution of viral determinants to the different steps of the arenavirus life cycle, as well as virus-host interactions and mechanisms of arenavirus pathogenesis 1, 3, 11 . In addition, the development of trisegmented arenaviruses has permitted the use of the arenavirus genome to express additional foreign genes of interest, thus opening the possibility of arenavirus-based vaccine vector applications 5 . Likewise, the development of single-cycle infectious arenaviruses capable of expressing reporter genes provides a new experimental tool to improve the safety of research involving highly pathogenic human arenaviruses 16 . The generation of recombinant arenaviruses using plasmid-based reverse genetics techniques has so far relied on the use of rodent cell lines 7,19 , which poses some barriers for the development of Food and Drug Administration (FDA)-licensed vaccine or vaccine vectors. To overcome this obstacle, we describe here the efficient generation of recombinant arenaviruses in FDA-approved Vero cells.

Rescue of recombinant arenaviruses from cloned cDNAs, an approach referred to as reverse genetics, allows researchers to investigate the role of specific viral gene products, as well as the contribution of their different specific domains and residues, to many different aspects of the biology of arenavirus. Likewise, reverse genetics techniques in FDA-approved cell lines (Vero) for vaccine development provides novel possibilities for the generation of effective and safe vaccines to combat human pathogenic arenaviruses.

FDA 승인 베로 세포 백신 개발을위한 재조합 Arenavirus의 생성

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field  4. The use of cell-based ...

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV is an RNA virus of the Flaviviridae family. ZIKV is mainly transmitted by mosquitoes, but can also be spread by maternal to fetal vertical transmission as well as sexual contact. To date, there are no reliable treatment or vaccine options available to protect those infected by the virus. The development of a reproducible, effective Zika virus infectious cell culture system is critical for studying the molecular mechanisms of ZIKV replication as well as drug and vaccine development. In this regard, a protocol describing a mammalian cell-based in vitro Zika virus culture system for viral production and growth analysis is reported here. Details on the formation of plaques by Zika virus on a cell monolayer and plaque assay for measuring viral titer are presented. Viral genome replication kinetics and double-stranded RNA genome replicatory intermediates are determined. This culture platform was utilized to screen against a library of a small set of cytokines resulting in the identification of interferon-&#945; (IFN-&#945;), IFN-&#946; and IFN-&#947; as potent inhibitors of Zika viral growth. In summary, an in vitro infectious Zika viral culture system and various virological assays are demonstrated in this study, which has the potential to greatly benefit the research community in elucidating further the mechanisms of viral pathogenesis and the evolution of viral virulence. Antiviral IFN-alpha can further be evaluated as a prophylactic, post-exposure prophylactic, and treatment option for Zika virus infections in high-risk populations, including infected pregnant women.

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV), an emerging pathogen, is linked to fetal developmental abnormalities and microcephaly. The establishment of an effective infectious cell culture system is crucial for studies of ZIKV replication as well as vaccine and drug development. In this study, various virological assays pertaining to ZIKV are illustrated and discussed.

Zika 바이러스 감염 세포 배양 시스템과<em&gt; 체외</em인터페론의&gt; 예방 효과

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV ...

Evaluation of Zika Virus-specific T-cell Responses in Immunoprivileged Organs of Infected Ifnar1-/- Mice

The Zika virus (ZIKV) can induce inflammation in immunoprivileged organs (e.g., the brain and testis), leading to the Guillain-Barr&#233; syndrome and damaging the testes. During an infection with the ZIKV, immune cells have been shown to infiltrate into the tissues. However, the cellular mechanisms that define the protection and/or immunopathogenesis of these immune cells during a ZIKV infection are still largely unknown. Herein, we describe methods to evaluate the virus-specific T-cell functionality in these immunoprivileged organs of ZIKV-infected mice. These methods include a) a ZIKV infection and vaccine inoculation in Ifnar1-/- mice; b) histopathology, immunofluorescence, and immunohistochemistry assays to detect the virus infection and inflammation in the brain, testes, and spleen; c) the preparation of a tetramer of ZIKV-derived T-cell epitopes; d) the detection of ZIKV-specific T cells in the monocytes isolated from the brain, testes, and spleen. Using these approaches, it is possible to detect the antigen-specific T cells that have infiltrated into the immunoprivileged organs and to evaluate the functions of these T cells during the infection: potential immune protection via virus clearance and/or immunopathogenesis to exacerbate the inflammation. These findings may also help to clarify the contribution of T cells induced by the immunization against ZIKV.

Evaluation of Zika Virus-specific T-cell Responses in Immunoprivileged Organs of Infected Ifnar1-/- Mice

A protocol to evaluate antigen-specific T-cell responses in the immunoprivileged organs of the Ifnar1-/- murine model for the Zika virus (ZIKV) infection is described. This method is pivotal for investigating the cellular mechanisms of the protection and immunopathogenesis of ZIKV vaccines and is also valuable for their efficacy evaluation.

감염 된 Ifnar1/- 생쥐의 Immunoprivileged 장기에서 Zika 바이러스 관련 T 세포 응답의 평가

The Zika virus (ZIKV) can induce inflammation in immunoprivileged organs (e.g., the brain and testis), leading to the Guillain-Barr&#233; syndrome and ...

Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought serious public safety concerns. Among the risk factors, antibody-dependent enhancement (ADE) poses the most significant threat, as the recent re-emergence of the Zika virus (ZIKV) is primarily in areas where the population has been exposed and is in a state of pre-immunity to other closely related flaviviruses, especially dengue virus (DENV). Here, we describe a protocol for quantifying the effect of human serum antibodies against DENV on ZIKV infection in primary human cells or cell lines.

We describe a method to evaluate the effect of pre-existing immunity against dengue virus on the Zika virus infection by using human serum, primary human cells, and infection quantification by quantitative real-time polymerase chain reaction.

기본 인간 세포에서 Zika 바이러스의 항 체 의존 향상의 정량화

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought ...

Establishing Mouse Models for Zika Virus-induced Neurological Disorders Using Intracerebral Injection Strategies: Embryonic, Neonatal, and Adult

The Zika virus (ZIKV) is a flavivirus currently endemic in North, Central, and South America. It is now established that the ZIKV can cause microcephaly and additional brain abnormalities. However, the mechanism underlying the pathogenesis of ZIKV in the developing brain remains unclear. Intracerebral surgical methods are frequently used in neuroscience research to address questions about both normal and abnormal brain development and brain function. This protocol utilizes classical surgical techniques and describes methods that allow one to model ZIKV-associated human neurological disease in the mouse nervous system. While direct brain inoculation does not model the normal mode of virus transmission, the method allows investigators to ask targeted questions concerning the consequence after ZIKV infection of the developing brain. This protocol describes embryonic, neonatal, and adult stages of intraventricular inoculation of ZIKV. Once mastered, this method can become a straightforward and reproducible technique that only takes a few hours to perform.

Here we describe a method for establishing a model of Zika virus-induced microcephaly in mouse. This protocol includes methods for embryonic, neonatal, and adult-stage intracerebral inoculation of the Zika virus.

Zika 바이러스 유도 신경 장애 Intracerebral 주입 전략을 사용 하 여 마우스 모델을 수립: 배아, 신생아, 및 성인

The Zika virus (ZIKV) is a flavivirus currently endemic in North, Central, and South America. It is now established that the ZIKV can cause microcephaly ...

신경과학

Rescue of Recombinant Zika Virus from a Bacterial Artificial Chromosome cDNA Clone

The association of Zika virus (ZIKV) infection with neurological complications during the recent worldwide outbreak and the lack of approved vaccines and/or antivirals have underscored the urgent need to develop ZIKV reverse genetic systems to facilitate the study of ZIKV biology and the development of therapeutic and/or prophylactic approaches. However, like with other flaviviruses, the generation of ZIKV full-length infectious cDNA clones has been hampered due to the toxicity of viral sequences during its amplification in bacteria. To overcome this problem, we have developed a nontraditional approach based on the use of bacterial artificial chromosomes (BACs). Using this approach, the full-length cDNA copy of the ZIKV strain Rio Grande do Norte Natal (ZIKV-RGN) is generated from four synthetic DNA fragments and assembled into the single-copy pBeloBAC11 plasmid under the control of the human cytomegalovirus (CMV) immediate-early promoter. The assembled BAC cDNA clone is stable during propagation in bacteria, and infectious recombinant (r)ZIKV is recovered in Vero cells after transfection of the BAC cDNA clone. The protocol described here provides a powerful technique for the generation of infectious clones of flaviviruses, including ZIKV, and other positive-strand RNA viruses, particularly those with large genomes that have stability problems during bacterial&#160;propagation.

The recent epidemic of Zika virus highlights the importance of establishing reverse genetic approaches to develop vaccines and/or therapeutic strategies. Here, we describe the protocol to rescue an infectious recombinant Zika virus from a full-length cDNA clone assembled in a bacterial artificial chromosome under the control of the human cytomegalovirus immediate-early promoter.

세균성 인공 염색체 cDNA 클론에서 재조합 Zika 바이러스의 구조

The association of Zika virus (ZIKV) infection with neurological complications during the recent worldwide outbreak and the lack of approved vaccines ...

Isolation and Quantification of Zika Virus from Multiple Organs in a Mouse

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral load. The purpose of the procedure is to quantify viral titers in peripheral and CNS areas of the mouse at different time points post infection or under different experimental conditions to identify virologic and immunological factors that regulate Zika virus infection. The organ isolation procedures demonstrated allow for both focus forming assay quantification and quantitative PCR assessment of viral titers. The rapid organ isolation techniques are designed for the preservation of virus titer. Viral titer quantification by focus forming assay allows for the rapid throughput assessment of Zika virus. The benefit of the focus forming assay is the assessment of infectious virus, the limitation of this assay is the potential for organ toxicity reducing the limit of detection. Viral titer assessment is combined with quantitative PCR, and using a recombinant RNA copy control viral genome copy number within the organ is assessed with low limit of detection. Overall these techniques provide an accurate rapid high throughput method for the analysis of Zika viral titers in the periphery and CNS of Zika virus infected animals and can be applied to the assessment of viral titers in the organs of animals infected with most pathogens, including Dengue virus.

The goal of the protocol is to demonstrate the techniques used to investigate viral disease by isolating and quantifying Zika virus, from multiple organs in a mouse following infection.

마우스의 여러 장기에서 Zika 바이러스의 격리 및 정량화

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral ...

Vector Competence Analyses on Aedes aegypti Mosquitoes using Zika Virus

The procedures presented describe a generalized methodology to infect Aedes aegypti mosquitoes with Zika virus under laboratory conditions to determine the rate of infection, disseminated infection, and potential transmission of the virus in the mosquito population in question. These procedures are widely utilized with various modifications in vector competence evaluations globally. They are important in determining the potential role that a given mosquito (i.e., species, population, individual) may play in the transmission of a given agent.

Vector Competence Analyses on Aedes aegypti Mosquitoes using Zika Virus

The presented protocol can determine the vector competence of Aedes aegypti mosquito populations for a given virus, such as Zika, in a containment setting.

지카 바이러스를 사용하여 Aedes aegypti 모기에 벡터 역량 분석

The procedures presented describe a generalized methodology to infect Aedes aegypti mosquitoes with Zika virus under laboratory conditions to determine ...

High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) formats. The flavivirus non-structural (NS) proteins are thought to co-translationally assemble on the endoplasmic reticulum (ER) membranes, forming the replication complex (RC). The NS3 and NS5 are the most studied enzymes of the RC and constitute the main targets for drug development due to their crucial roles in viral genome replication. NS3 protease domain, which requires NS2B as its cofactor, is responsible for the cleavage of the immature viral polyprotein into the mature NS proteins, whereas NS5 RdRp domain is responsible for the RNA replication. Herein, we describe in detail the protocols used in replicon-based screenings and enzymatic assays to test large compound libraries for inhibitors of the Zika virus (ZIKV) replication. Replicons are self-replicating subgenomic systems expressed in mammalian cells, in which the viral structural genes are replaced by a reporter gene. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the reporter protein activity. The replicon-based screenings were performed using a BHK-21 ZIKV replicon cell line expressing Renilla luciferase as a reporter gene. To characterize the specific targets of identified compounds, we established in-vitro fluorescence-based assays for recombinantly expressed NS3 protease and NS5 RdRp. The proteolytic activity of the viral protease was measured by using the fluorogenic peptide substrate Bz-nKRR-AMC, while the NS5 RdRp elongation activity was directly detected by the increase of the fluorescent signal of SYBR Green I during RNA elongation, using the synthetic biotinylated self-priming template 3&#8242;UTR-U30 (5&#39;-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3&#39;).

In this work, we describe the protocols used in replicon-based and viral enzyme-based assays to screen for inhibitors of Zika virus replication in a high-throughput screening format.

지카 바이러스 복제억제제에 대한 화면에 높은 처리량 항 바이러스 적 소사

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) ...

새로운 세계 Zika 바이러스 전염성 클론으로부터 재조합 바이러스의 구조 및 특성 규명

요약

더 많은 비디오 탐색

이 비디오의 챕터