X 선 회절 데이터 세트는 포항 가속기 연구소 (한국)의 빔라인 7A에서 수집되었다. 이 연구는 과학 기술부, ICT 및 미래 계획 (2015R1A1A01057574, MH)이 자금을 지원하는 국립 과학 재단 (NRF)을 통해 관리되는 기초 과학 연구 프로그램의 지원을 받았다.

1. rBC1531의 재조합 단백질 생산 및 정제 <ol><li> 재조합 BC1531 단백질 (rBC1531) - 발현 플라스미드 <ol><li> B. cereus 10 의 게놈 DNA를 준비합니다. </li><li> Bam HI 및 Sal I 제한 효소 부위를 각각 생성하기 위해 정방향 및 역방향 프라이머 (물질 목록 참조)를 사용하여 폴리머 라제 연쇄 반응 (PCR)에 의해 B. cereus 게놈 DNA의 템플레이트로부터 bc1531 유전자를 증폭시킨다. </li><li> PCR 제품과 수정 된 pET49b 벡터 (pET49bm)를 BamHI 및 Sal I을 사용하여 분해하고 11 . </li><li> 설명 된대로 10 μL 반응에서 T4 DNA 리가 제를 사용하여 1.1.3 단계에서 소화 PCR 제품과 벡터 (3 : 1 비율)를 섞는다. 18 ° C에서 30 분 동안 품어 라. </li><li> chemica 50 μL에 연결 반응 3 μL 피펫유능한 E. coli DH5α 세포를 튜브에 넣습니다. 피펫 팅을 위아래로 부드럽게 혼합하고 얼음에 30 분 동안 두십시오. 42 ° C에서 45 초 동안 열충격. Luria - Bertani (LB) 배지 1 ML을 추가하고 격렬하게 (250 rpm, 37 ° C, 45 분) 떨고있는 동안 세포를 성장. </li><li> 단계 1.1.6에서 형질 전환 한 세포 100 μL를 취해 100 μg / mL kanamycin (칸)이 들어있는 LB- 한천 플레이트에 뿌립니다. 37 ~ 18 시간 동안 ~ 18 시간 동안 품어 낸다. </li><li> 멸균 팁을 사용하여 식민지를 선택하고 100 μg / ML 칸과 LB 미디어 3 ML의 세포를 성장; 격렬히 흔들어주세요 (250 rpm, 37 ° C, 18 h). </li><li> 10 설명한대로 알칼리성 SDS의 lysis 방법을 사용하여 플라스미드 DNA를 준비합니다. </li><li> DNA sequencing 12 를 사용하여 rBC1531 발현 구조의 염기 서열을 확인합니다. </li></ol></li><li> rBC1531 단백질의 과발현 <ol><li> rBC1531-exp로 대장균 BL21 (DE3) 균주를 재조합과발현을 위해 단계 1.1.5-1.1.6에 기술 된대로 레 시온 플라스미드를 사용한다. </li><li> 식민지를 선택하고 50 μg / ML 칸 (LB + 칸)을 포함하는 LB 매체의 10 ML에서 그것을 성장; 37 ° C에서 18 시간 동안 격렬히 흔든다. </li><li> 1L의 LB + Kan 배지에 밤새 배양 10 mL를 접종하고 OD 600 (600 nm에서의 광학 밀도)이 ~ 0.7에이를 때까지 37 ℃에서 성장시킨다. </li><li> 온도를 18 ° C로 낮추고 재조합 단백질 발현을 위해 1 mM의 최종 농도에서 배양 물에 이소 프로필 β-D-1-thiogalactopyranoside (IPTG)를 첨가하기 위해 약 15 분 동안 얼음물에서 배양합니다. 18 ~ 18 ℃에서 16 ~ 18 시간 동안 배양하십시오. </li></ol></li><li> rBC1531의 정제 <ol><li> 원심 분리 (5,000 xg, 4 ° C, 30 분)에 의해 세포를 수확. 세포를 방해하지 않도록주의 깊게 상등액을 버린다. 10 MM 이미 다졸이 들어있는 인산염 완충 식염수 (PBS) 용액 50 mL에 세포를 재현 탁합니다. </li><li> 세포 lysates (시간 : 2 분 30 초, 사이클 : 5 초, 사이클 오프 : 10 초, 진폭 : 38 %)의 과열을 방지하기 위해 얼음 sonication에 의해 세포를 두 번 Lyse. </li><li> 원심 분리 (~ 25,000 xg, 4 ℃, 30 분)에 의해 세포 용 해물을 맑게한다. </li><li> 10 ML 이미 다졸 및 중력 흐름을 포함하는 60 ML 니켈 비즈 3 ML을 섞어 여분의 버퍼 2.5 X 10cm 유리 크로마토 그래피 칼럼에 평형 니켈 구슬을 해결합니다. </li><li> 피펫은 사전에 평형 니켈 구슬과 칼럼에 1.3.3에서 뜨는을 전송하고 저속 (~ 20 RPM)에서 회전 바퀴에 4 시간에 2 시간 품어. </li><li> 뜨는를 중력에 의해 배수하고 10 MM 이미 다졸을 포함하는 PBS 100 ML로 열에있는 세 번 니켈 구슬을 씻어주십시오. </li><li> 250 mM 이미 다졸을 함유 한 PBS 4 x 5 mL를 적용하여 rBC1531 단백질을 용출시켰다. </li><li> 1.3.7 단계에서 15 μL의 용리액을 취해 15 % SDS-PAGE에서이를 수행하십시오. 단백질 밴드를 시각화합니다.Coomassie blue 염색법을 사용하여 젤 10 . </li></ol></li><li> 트롬빈 단백 분해에 의한 rBC1531 단백질의 친화력 태그 제거 <ol><li> 분주를 투석 튜브 (분자량 차단 : 3 kDa)에 피펫과 트롬빈 절단 호환 버퍼 (20 MM HEPES, 산도 7.4, 150 MM NaCl 및 1.5 MM β - mercaptoethanol)의 4 L를 포함하는 비커에 튜브를 놓으십시오. 4 ° C에서 하룻밤. </li><li> 분수를 피펫과 원뿔 튜브로 전송합니다. </li><li> 280 nm에서 흡광도를 측정하고 설명 된 바와 같이 rBC1531 단백질 농도를 추정. </li><li> 0.5 mL 튜브에서 rBC1531 50 μg을 채취하고 다양한 양의 트롬빈 ( 즉, 2, 1, 0.6 및 0.3 단위)을 첨가하십시오. rBC1531과 트롬빈 반응을 20 ℃에서 ~ 3 시간 동안 배양하여 N- 말단 친 화성 태그를 절단하는데 필요한 트롬빈의 최소량을 결정한다. </li><li> rBC1531 및 트롬빈 반응을 15 %SDS-PAGE로 확인하고 N 말단 친화력 태그를 완전히 소화하고 태그가없는 rBC1531을 생산하는 트롬빈의 최소량 ( 예 : rBC1531 50 μg 당 0.3 단위의 트롬빈)을 결정합니다. </li><li> 10mg의 rBC1531 단백질과 60 단위의 트롬빈을 15 mL 튜브에 넣고 20 ℃에서 3 시간 동안 트롬빈 - 단백질 분해 반응을 일으킨다. </li><li> 설명 된대로 분자량 및 용출 부피의 표준 곡선을 만들기 위해 크기 - 제외 크로마토 그래피 (SEC) 칼럼에 겔 여과 표준을 적용하십시오. </li><li> 원심 분리 필터 튜브 (분자량 차단 : 3 kDa)에 1.4.6 단계의 트롬빈 소화 rBC1531 단백질을 넣고 4,000 ml에서 3,000 g으로 원심 분리하여 5 mL 미만의 부피로 줄입니다. </li><li> 농도가 rBC1531 단백질을 SEC 칼럼에 적용하고 튜브 당 0.5 mL로 60 개의 용출 분획물을 수집하십시오 13 . </li><li> 각 분획물 15 μL를 취하여 15 % SDS-PAGE에서 실행하고,Coomassie 염색 용액 (0.15 % (w / v) Coomassie 브릴리언트 블루, 40 % (v / v) 메탄올 및 10 % (v / v) 빙초산)을 사용하여 겔을 만들었다. </li><li> rBC1531을 포함하는 분수를 피펫 씩 하나의 튜브에 모으십시오. </li></ol></li></ol> 2. 결정화 스크리닝 및 rBC1531의 최적화 <ol><li> rBC1531 단백질 결정화를위한 스크리닝 조건 <ol><li> 1.4.8에서 설명한대로 원심 분리 필터 튜브를 사용하여 단계 1.4.11에서 rBC1531를 ~ 18.5 mg / mL까지 농축합니다. </li><li> 96- 웰 앉아 드롭 결정화 플레이트의 웰에 각 결정화 스크리닝 용액 (섹션 2.2 참조 ) 을 50 μL 씩 첨가한다. 앉아있는 침대에 18.5 mg / mL rBC1531 단백질 용액 0.5 μL를 놓습니다. 용액 전체 0.5 μL와 단백질 용액을 섞어서 전체 플레이트에 대한 과정을 반복하십시오. </li><li> 깨끗한 접착 필름으로 판을 덮으십시오.18 ° C에 96 - 웰 플레이트를 놓고 증기 확산을 허용합니다. </li><li> 광학 현미경을 사용하여 20 ~ 40 배율로 방울을 스캔하여 2-3 주 동안 매일 크리스탈 형성을 모니터링하십시오. </li><li> 얻은 rBC1531 단백질 결정을 사용하여 X- 선 회절 데이터 12 을 수집하십시오. </li></ol></li><li> rBC1531 결정화 조건의 최적화 <ol><li> 선택한 초기 결정화 조건 용액 ( 예 : 0.1 M sodium cacodylate, pH 6.5 및 1.0 M sodium citrate) 500 μL를 준비하고 앉은 방울을 위해 24-well crystallization plate를 채 웁니다. </li><li> 앉아있는 침대에 18.5 mg / mL rBC1531 단백질 용액 0.5 μL를 넣고 잘 용액 0.5 μL와 섞은 다음 즉시 투명 필름으로 판을 덮습니다. 플레이트를 18 ° C에 놓습니다. </li><li> 가벼운 현미경으로 1 주일 동안 결정 성장을 관찰하십시오. </li><li> pH를 변화시켜 다양한 결정화 조건을 최적화하십시오 ( 즉,., pH 5.5-6.8)를 사용하고 구연산 나트륨의 염농도 ( 즉, 0.9-1.2 M)를 변경하여 단핵 결정을 얻는다. 1 주일 동안 결정 성장을 모니터하고 X 선 회절 데이터를 수집하십시오. 12 . </li></ol></li></ol> 3. rBC1531의 뉴 클레오 시드 트리 포스파타제 (NTPase) 활성의 특성 규명 <ol><li> 무기 인산염 비례 검정의 검증 <ol><li> 피로 인산염 (100 MM)의 주식을 준비하고 반응 버퍼 (20 MM HEPES, 산도 7.4, 150 μl)에 0.1, 0.25, 0.5, 1.0, 5.0, 10, 50, 100 및 250 μm의 최종 농도로 희석 mM NaCl 및 2 mM MgCl 2 )로 2 번 96- 웰 플레이트에서 배양 하였다. 첫번째 판을 대조군으로 사용하십시오 (이것은 피로 포스파타제를 포함하지 않습니다). 두 번째 플레이트에 3.1.2 절에서 설명한대로 작업 플레이트로 pyrophosphatase가 포함되어 있는지 확인하십시오. </li><li> Saccharomyces cerevisiae 무기 p 0.01 단위 첨가Yrophosphatase (1 μL)를 작용 플레이트의 웰에 넣고 20 ° C에서 30-60 분 동안 배양합니다. </li><li> 몰리브덴 산 암모늄 (0.86 % v / v)과 아스코르브 산 (14 % v / v)을 7 : 3의 비율로 혼합하여 몰리브덴 산 용액을 제조한다. 몰리브덴 산 용액 16 μL를 작업 및 대조 우물에 모두 넣고 15 분 동안 기다린다. </li><li> 690 nm (OD 690 nm)에서 광학 밀도를 읽습니다. </li></ol></li><li> 비색 NTPase 분석 <ol><li> 100 mM 뉴 클레오 사이드 트리 포스페이트 (NTP) 기질을 준비하고 검정 완충액 (20 mM HEPES, pH 7.4) 중 180 μL에서 원하는 농도 ( 예 : 0, 0.2, 4.4, 11, 22, 44, 88, 132 μM) pH 7.4, 150 mM NaCl 및 2 mM MgCl 2 )에 용해시켰다. </li><li> 96- 웰 플레이트에서 반응 당 200 μL까지 단계 3.2.1에서 rBC1531 (1.5 mM) 및 NTP 기질 20 μg을 첨가하고 잘 혼합하기 위해 위아래로 피펫 팅하십시오. 뚜껑을하여 플레이트를 덮고 30 분 동안 37 ° C 배양기에 두십시오기질 가수 분해 반응을 수행한다. </li><li> 플레이트를 70 ° C의 수 욕조에 옮기고 15 분 동안 방치하여 rBC1531 매개 촉매 반응을 중지시킵니다. </li><li> S. cerevisiae 무기 pyrophosphatase (1 μL) 0.01 단위를 반응 판 (단계 3.2.3)의 각 웰에 첨가하고 20 ℃에서 30 분 동안 배양한다. 몰리브덴 산 용액 16 μL를 반응 판에 첨가하여 색상을 만듭니다 (~ 15 분). OD 690nm 에서 읽으십시오. </li><li> 12 에서 설명한대로 Michaelis-Menten 방정식을 사용하여 분석하십시오. </li></ol></li></ol>

<ol>
	<li>Ivanova, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+Bacillus+cereus+and+comparative+analysis+with+Bacillus+anthracis.">Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis.</a> Nature. 423, 87-91 (2003).</li><li>Spencer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacillus+anthracis.">Bacillus anthracis.</a> J Clin Pathol. 56, 182-187 (2003).</li><li>Deli, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LmbE+proteins+from+Bacillus+cereus+are+de-N-acetylases+with+broad+substrate+specificity+and+are+highly+similar+to+proteins+in+Bacillus+anthracis.">LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis.</a> FEBS J. 277, 2740-2753 (2010).</li><li>Gross, M., Marianovsky, I., Glaser, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MazG+--+a+regulator+of+programmed+cell+death+in+Escherichia+coli.">MazG -- a regulator of programmed cell death in Escherichia coli.</a> Mol Microbiol. 59, 590-601 (2006).</li><li>Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=House+cleaning,+a+part+of+good+housekeeping.">House cleaning, a part of good housekeeping.</a> Mol Microbiol. 59, 5-19 (2006).</li><li>Lee, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+Escherichia+coli+MazG,+the+regulator+of+nutritional+stress+response.">Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response.</a> J Biol Chem. 283, 15232-15240 (2008).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimeric+dUTPases,+HisE,+and+MazG+belong+to+a+new+superfamily+of+all-alpha+NTP+pyrophosphohydrolases+with+potential+&amp;#34;house-cleaning&amp;#34;+functions.">Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential &amp;#34;house-cleaning&amp;#34; functions.</a> J Mol Biol. 347, 243-255 (2005).</li><li>Robinson, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+putative+house-cleaning+enzyme+encoded+within+an+integron+array:+1.8+A+crystal+structure+defines+a+new+MazG+subtype.">A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype.</a> Mol Microbiol. 66, 610-621 (2007).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+crystal+structure+of+a+complex+of+Campylobacter+jejuni+dUTPase+with+substrate+analogue+sheds+light+on+the+mechanism+and+suggests+the+&amp;#34;basic+module&amp;#34;+for+dimeric+d(C/U)TPases.">The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the &amp;#34;basic module&amp;#34; for dimeric d(C/U)TPases.</a> J Mol Biol. 342, 1583-1597 (2004).</li><li>Green, M., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning: A laboratory Manual. 1, (2012).</li><li>Brown, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Gene cloning an introduction. , (1986).</li><li>Kim, M. I., Hong, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Bacillus-conserved+MazG+protein,+a+nucleotide+pyrophosphohydrolase.">Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase.</a> Biochem Biophys Res Commun. 472, 237-242 (2016).</li><li>Sheehan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Physical biochemistry: Principles and applications. , (2009).</li><li>Lesley, S. A., Wilson, I. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+and+crystallization+at+the+joint+center+for+structural+genomics.">Protein production and crystallization at the joint center for structural genomics.</a> J Struct Funct Genomics. 6, 71-79 (2005).</li><li>Jeon, Y. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+biochemical+characterization+of+bacterial+YpgQ+protein+reveals+a+metal-dependent+nucleotide+pyrophosphohydrolase.">Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase.</a> J Struct Biol. 195, 113-122 (2016).</li></ol>

저자는 공개 할 것이 없습니다.

Studies of true pathogens are limited due to safety restrictions and regulations. Alternatively, pathogens can be studied using evolutionarily related non-pathogens or less pathogenic species. The ba1554 gene is considered a critical gene in B. anthracis. Fortunately, an identical gene is present in nonclinical B. cereus. Thus, without serious safety concerns, recombinant BC1531 protein can be used for biophysical and enzymatic characterization. Here, we described detailed procedures, moving fr...

재조합 단백질 발현은 제한된 단백질 양 및 유해한 오염과 같은 천연 단백질 공급원과 관련된 문제점을 극복하기 위해 널리 사용됩니다. 또한 병원성 유전자와 단백질 연구에서 추가적인 안전 예방 조치가 필요없는 대체 실험실 균주를 이용할 수 있습니다. 예를 들어, Bacillus cereus 는 Bacillus anthracis 를 가까운 진화 적 관계 로 연구하는데 유용한 모델이다. B. 탄저균은 사람과 가축에서 치명적인 흡입 탄저병을 일으키는 필수 병원체이며 잠재적으로 생물 표지 2 로 사용될 수 있습니다. 따라서 B. anthracis 에 대한 실험실 연구는 BSL-3 (생물 안전성 수준 3) 관행을 요구하는 미국 질병 통제 센터 (Centers for Disease Control)에 의해 엄격히 규제되며 실험실 구역을 음의 실내 압력으로 격리하도록 요구합니다. B. anthracis 와는 대조적으로 </eB. cereus 는 BSL-1 약제로 분류되어 안전에 대한 염려가 거의 없다. B. cereus 는 감염시 식중독을 일으키는 기회 주의적 병원균으로 의료 지원없이 치료할 수 있습니다. 그러나 B. cereus 는 B. anthracis 와 많은 중요한 유전자를 공유하기 때문에 B. cereus 1의 동족체를 사용하여 B. anthracis 단백질의 기능을 연구 할 수 있습니다. B. anthracis 의 ba1554 - ba1558 유전자 클러스터는 bc1531 - bc1535 클러스터와 잘 보존되어있다. Bacillus thuringiensis 의 bt1364-bt1368 클러스터뿐만 아니라 B. cereus 의 유전자 조직 및 염기 서열에 관한 것이다. 또한, 각 클러스터의 첫 번째 유전자 ( ba1554 , bc1531 및 bt1364 )는 절대적으로 보존되어 있습니다 ( 예 : 100 % 염기 서열 동일성). implyiBacillus 종에서 유전자 산물의 결정적인 역할. 이러한 유전자 클러스터에서의 위치 때문에, ba1554 는 추정 전사 조절 자로 오인되었다. 그러나 ba1554 산물의 아미노산 서열 분석은 MazG family에 속하는 것으로 나타 났는데, 이는 nucleotide pyrophosphohydrolase 활성을 가지고 있으며 전사 인자 활성과 관련이 없다 4 , 5 . MazG 계열에 속하는 단백질은 전체 서열과 길이가 다양하지만 EXXE 12-28 EXXD 모티프로 특징 지워지는 ~ 100 잔기의 MazG 도메인을 공유합니다 ( &quot;X&quot;는 아미노산 잔기를 의미하고 번호 X 잔기의 수를 나타낸다). MazG 도메인은 특정 촉매 활동을 직접적으로 설명하지는 않습니다. Escherichia coli (EcMazG)의 MazG 구성원은 2 개의 MazG 도메인을 보유하고 있지만C 말단 MazG 도메인은 효소 적으로 활성이다 6 . 또한, MazG 효소의 기질 특이성은 비특이적 뉴 클레오 시드 트리 포스페이트 (EcMazG의 경우)에서 특정 dCTP / dATP (인테그린 관련 MazG의 경우) 및 dUTP (dUTPases의 경우) 6 , 7 , 8 , 9로 다양합니다. 따라서 BA1554 단백질의 생물 물리 화학적 분석은 NTPase 활성을 확인하고 기질 특이성을 해독하기 위해 필요하다. 여기에 BSL-3 시설이없는 대부분의 실험실이 분자 수준에서 B. anthracis ba1554 의 ortholog 인 B. cereus bc1531 유전자의 단백질 생성물을 특성화하기 위해 따라갈 수있는 단계별 프로토콜이 제공됩니다. 간단히, 재조합 BC1531 (rBC1531)을 대장균 에서 발현 시키고 친 화성 태그를 사용하여 정제 하였다. X 선 결정학 실험에서 결정rBC1531 단백질의 zation 조건을 스크리닝하고 최적화 하였다. rBC1531의 효소 활성을 평가하기 위해, NTPase 활성을 비색계로 모니터링하여 통상적으로 사용 된 방사성 표지 된 뉴클레오타이드를 회피 하였다. 마지막으로, 얻어진 생 물리 화학적 데이터의 분석은 rBC1531 결정으로부터 X- 선 회절 데이터를 얻는 것뿐만 아니라 rBC1531의 올리고머 화 상태 및 촉매 매개 변수를 결정할 수있게했다.

<table><tbody><tr><td>&lt;em&gt;Bacillus cereus&lt;/em&gt; ATCC14579</td><td>Korean Collection for Tissue Culture</td><td>3624</td><td></td></tr><tr><td>Genomic DNA prep kit</td><td>GeneAll</td><td>106-101</td><td>Genomic DNA preparation</td></tr><tr><td>Forward primer</td><td>Macrogen</td><td>GAAGGATCCGGAAGCAAAAA&lt;br/&gt; CGATGAAAGATATGCA</td><td>&lt;em&gt;Bam&lt;/em&gt;HI site is underlined</td></tr><tr><td>Reverse primer</td><td>Macrogen</td><td>CTTGTCGACTTATTCTTTCTCT&lt;br/&gt; CCCTCATCAATACGTG</td><td>&lt;em&gt;Sal&lt;/em&gt;I site is underlined</td></tr><tr><td>nPfu-Forte</td><td>Enzynomics</td><td>P410</td><td>PCR polymerase</td></tr><tr><td>&lt;em&gt;Bam&lt;/em&gt;HI</td><td>Enzynomics</td><td>R003S</td><td></td></tr><tr><td>&lt;em&gt;Sal&lt;/em&gt;I</td><td>Enzynomics</td><td>R009S</td><td></td></tr><tr><td>pET49b expression vector</td><td>Novagen</td><td>71463</td><td>Expression vector was modified to add affinity tags and BamHI/SalI sites&lt;sup&gt;10&lt;/sup&gt;</td></tr><tr><td>T4 DNA ligase</td><td>Enzynomics</td><td>M001S</td><td></td></tr><tr><td>Dialysis memebrane</td><td>Thermofisher</td><td>18265017</td><td></td></tr><tr><td>Dry block heater</td><td>JSR</td><td>JSBL-02T</td><td></td></tr><tr><td>LB broth (Luria-Bertani)</td><td>LPS solution</td><td>LB-05</td><td></td></tr><tr><td>LB Agar, Miller (Luria-Bertani)</td><td>Becton, Dickinson and Company</td><td></td><td></td></tr><tr><td>Kanamycin</td><td>LPS solution</td><td>KAN025</td><td></td></tr><tr><td>Mini-prep kit</td><td>Favorgen</td><td>FAPDE300</td><td>Plasmid DNA preparation</td></tr><tr><td>BL21(DE3) Competent cell</td><td>Novagen</td><td>69450-3CN</td><td></td></tr><tr><td>Isopropyl &amp;beta;-D-1-thiogalactopyranoside (IPTG)</td><td>Fisher BioReagents</td><td>50-213-378</td><td></td></tr><tr><td>Sodium chloride</td><td>Daejung</td><td>7548-4100</td><td>PBS material</td></tr><tr><td>Potassium chloride</td><td>Daejung</td><td>6566-4405</td><td>PBS material</td></tr><tr><td>Potassium phosphate</td><td>Bio Basic Inc</td><td>PB0445</td><td>PBS material</td></tr><tr><td>Sodium phosphate</td><td>Bio Basic Inc</td><td>S0404</td><td>PBS material</td></tr><tr><td>Imidazole</td><td>Bio Basic Inc</td><td>IB0277</td><td></td></tr><tr><td>Sonicator</td><td>Sonics</td><td>VCX 130</td><td></td></tr><tr><td>Ni-NTA agaros</td><td>Qiagen</td><td>30210</td><td>Nickel bead</td></tr><tr><td>Rotator</td><td>Finepcr</td><td>AG</td><td></td></tr><tr><td>Precision Plus Protein Dual Color Standards</td><td>Bio-rad</td><td>1610374</td><td>SDS-PAGE protein standard</td></tr><tr><td>Coonmassie Brilliant Blue R-250</td><td>Fisher BioReagents</td><td>BP101-25</td><td>Coomassie staining solution</td></tr><tr><td>Methyl alcohol</td><td>Samchun chemical</td><td>M0585</td><td>Coomassie staining solution</td></tr><tr><td>Acetic acid</td><td>Daejung</td><td>1002-4105</td><td>Coomassie staining solution</td></tr><tr><td>Dialysis memebrane</td><td>Thermofisher</td><td>68035</td><td></td></tr><tr><td>2-Mercaptoethanol</td><td>Sigma-aldrich</td><td>M6250</td><td></td></tr><tr><td>Thrombin</td><td>Merckmillipore</td><td>605157-1KUCN</td><td>Prepare aliquots of 20 &amp;mu;L (1 Unit per &amp;mu;L) and store at 70 &amp;deg;C and thaw before use</td></tr><tr><td>Superdex 200 16/600</td><td>General Electric</td><td>28989335</td><td>Size exclusion chromatography</td></tr><tr><td>Gel filtration standard</td><td>Bio-rad</td><td>151-1901</td><td></td></tr><tr><td>Centrifugal filter</td><td>Amicon</td><td>UFC800396</td><td></td></tr><tr><td>Crystralization plates</td><td>Hampton research</td><td>HR3-083</td><td>96-well sitting drop plate</td></tr><tr><td>The JCSG core suite I-IV</td><td>Qiagen</td><td>130924-130927</td><td>Crystallization secreening solution</td></tr><tr><td>Microscope</td><td>Nikon</td><td>SMZ745T</td><td></td></tr><tr><td>Cryschem plates</td><td>Hampton research</td><td>HR3-158</td><td>24-well sitting drop plate</td></tr><tr><td>Inorganic pyrophosphatase</td><td>Sigma</td><td>10108987001</td><td></td></tr><tr><td>Ammonium molybdate solution</td><td>Sigma</td><td>13106-76-8</td><td></td></tr><tr><td>L-ascorbic acid</td><td>Sigma</td><td>50-81-7</td><td></td></tr><tr><td>NTP substrate</td><td>Startagene</td><td>200415-51</td><td></td></tr><tr><td>Spectrophotometer</td><td>Biotek</td><td>SynergyH1</td><td>microplate reader</td></tr><tr><td>GraphPad Prism 5</td><td>GraphPad</td><td>Prism 5 for Window</td><td></td></tr></tbody></table>

recombinant protein expression, crystallization, and biophysical studies of a bacillus-conserved nucleotide pyrophosphorylase, bcmazg

진정한 병원체에서 유전자와 단백질을 연구 할 때 안전 제한과 규제를 극복하기 위해 동질성을 연구 할 수 있습니다. Bacillus anthracis 는 치명적인 흡입 탄저병을 일으키는 절대 병원균입니다. Bacillus cereus 는 B. anthracis 를 가까운 진화 관계로 연구하는 데 유용한 모델로 간주됩니다. B. anthracis 의 유전자 클러스터 ba1554 - ba1558 은 Bacillus thuringiensis 의 bt1364 - bt1368 클러스터뿐만 아니라 B. cereus 의 bc1531 - bc1535 클러스터와 잘 보존되어 있으며 Bacillus 속의 관련 유전자의 중요한 역할을 나타낸다. 이 원고는 B. cereus , bc1531 에서 ortholog의 재조합 단백질을 사용하여 B. anthracis 의 유전자 클러스터에서 첫 번째 유전자 ( ba1554 )의 단백질 생성물을 준비하고 특성화하는 방법을 설명합니다.

본 연구에서 목적 단백질의 특성화는 충분한 양의 재조합 B. cereus bc1531 (rBC1531) 단백질을, 바람직하게는 수 밀리그램 이상으로 제조함으로써 시작되었다. BC1531 단백질을 코딩하는 DNA 단편은 B. cereus 의 게놈 DNA를 주형으로 사용하는 PCR 법으로 ba1554와 동일한 orthologous gene을 포함하고 있으므로 준비 하였다. rBC1531은 대장균 에서 가용성 단백질로 과...

Watch this Scientific Journal Video about Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG at JoVE.com

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Bacillus anthracis 는 치명적인 흡입 탄저의 병원성 물질이기 때문에 유전자와 단백질에 대한 연구가 엄격히 규제됩니다. 또 다른 접근법은 orthologous 유전자를 연구하는 것이다. B. cereus 의 B. anthracis ortholog (bc1531)에 대한 생물학적 물리 화학적 연구는 최소한의 실험 장비를 필요로하며 심각한 안전 문제가 없다고 설명합니다.

재조합 단백질 발현, 결정화 및 생물 물리학 연구<em&gt; 바실러스</em&gt; 보존 된 뉴클레오티드 피로 인산화 효소, BcMazG

To overcome safety restrictions and regulations when studying genes and proteins from true pathogens, their homologues can be studied. Bacillus anthracis ...

recombinant-protein-expression-crystallization-biophysical-studies

Universidad de Cartagena UDEC

Research

JoVE Journal

Biochemistry

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

7.4K 조회수.  Yonsei University.  Bacillus anthracis 는 치명적인 흡입 탄저의 병원성 물질이기 때문에 유전자와 단백질에 대한 연구가 엄격히 규제됩니다. 또 다른 접근법은 orthologous 유전자를 연구하는 것이다. B. cereus 의 B. anthracis ortholog (bc1531)에 대한 생물학적 물리 화학적 연구는 최소한의 실험 장비를 필요로하며 심각한 안전 문제가 없다고 설명합니다. 

비디오: Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a target for future development of inhibitors to decrease the virulence of the pathogen. To perform biophysical and structural characterization as well as inhibitor screening, large amounts of pure and active protein will be needed. We have developed a protocol for efficient production and purification of PPEP-1 by the use of E. coli as the expression host yielding sufficient amounts and purity of protein for crystallization and structure determination. Additionally, using microseeding, highly intergrown crystals of PPEP-1 can be grown to well-ordered crystals suitable for X-ray diffraction analysis. The methods could also be used to produce other recombinant proteins and to study the structures of other proteins producing intergrown crystals.

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

Proline-proline endopeptidase-1 (PPEP-1) is a secreted metalloprotease and promising drug-target from the human pathogen Clostridium difficile. Here we describe all methods necessary for the production and structure determination of this protein.

생산, 결정화 및 구조 결정의<em&gt; C. 남과 어울리지 않는</em&gt; PPEP-1 Microseeding 및 아연 SAD를 통해

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a ...

연구

생화학

Microcrystallography of Protein Crystals and In Cellulo Diffraction

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in their largest dimension, which used to represent a challenge. We present two alternative workflows for the structure determination of protein microcrystals by X-ray crystallography with a particular focus on crystals grown in vivo. The microcrystals are either extracted from cells by sonication and purified by differential centrifugation, or analyzed in cellulo after cell sorting by flow cytometry of crystal-containing cells. Optionally, purified crystals or crystal-containing cells are soaked in heavy atom solutions for experimental phasing. These samples are then prepared for diffraction experiments in a similar way by application onto a micromesh support and flash cooling in liquid nitrogen. We briefly describe and compare serial diffraction experiments of isolated microcrystals and crystal-containing cells using a microfocus synchrotron beamline to produce datasets suitable for phasing, model building and refinement.
These workflows are exemplified with crystals of the Bombyx mori cypovirus 1 (BmCPV1) polyhedrin produced by infection of insect cells with a recombinant baculovirus. In this case study, in cellulo analysis is more efficient than analysis of purified crystals and yields a structure in ~8 days from expression to refinement.

Microcrystallography of Protein Crystals and In Cellulo Diffraction

A protocol is presented for X-ray crystallography using protein microcrystals. Two examples analyzing in vivo-grown microcrystals after purification or in cellulo are compared.

단백질 결정의 미세 결정학 및<em&gt; 셀룰로에서</em&gt; 회절

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in ...

Expression and Purification of Mammalian Bestrophin Ion Channels

The human genome encodes four bestrophin paralogs, namely BEST1, BEST2, BEST3, and BEST4. BEST1, encoded by the BEST1 gene, is a Ca2+-activated Cl- channel (CaCC) predominantly expressed in retinal pigment epithelium (RPE). The physiological and pathological significance of BEST1 is highlighted by the fact that over 200 distinct mutations in the BEST1 gene have been genetically linked to a spectrum of at least five retinal degenerative disorders, such as Best vitelliform macular dystrophy (Best disease). Therefore, understanding the biophysics of bestrophin channels at the single-molecule level holds tremendous significance. However, obtaining purified mammalian ion channels is often a challenging task. Here, we report a protocol for the expression of mammalian bestrophin proteins with the BacMam baculovirus gene transfer system and their purification by affinity and size-exclusion chromatography. The purified proteins have the potential to be utilized in subsequent functional and structural analyses, such as electrophysiological recording in lipid bilayers and crystallography. Importantly, this pipeline can be adapted to study the functions and structures of other ion channels.

The purification of ion channels is often challenging, but once achieved, it can potentially allow in vitro investigations of the functions and structures of the channels. Here, we describe the stepwise procedures for the expression and purification of mammalian bestrophin proteins, a family of Ca2+-activated Cl- channels.

표현과 포유류 Bestrophin 이온 채널의 정화

The human genome encodes four bestrophin paralogs, namely BEST1, BEST2, BEST3, and BEST4. BEST1, encoded by the BEST1 gene, is a Ca2+-activated Cl- ...

Multi-target Parallel Processing Approach for Gene-to-structure Determination of the Influenza Polymerase PB2 Subunit

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States alone, an average of 41,400 deaths and 1.86 million hospitalizations are caused by influenza virus infection each year 1. Point mutations in the polymerase basic protein 2 subunit (PB2) have been linked to the adaptation of the viral infection in humans 2. Findings from such studies have revealed the biological significance of PB2 as a virulence factor, thus highlighting its potential as an antiviral drug target.
The structural genomics program put forth by the National Institute of Allergy and Infectious Disease (NIAID) provides funding to Emerald Bio and three other Pacific Northwest institutions that together make up the Seattle Structural Genomics Center for Infectious Disease (SSGCID). The SSGCID is dedicated to providing the scientific community with three-dimensional protein structures of NIAID category A-C pathogens. Making such structural information available to the scientific community serves to accelerate structure-based drug design.
Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for new lead discovery by targeting a pathway or an entire protein family. Emerald Bio has developed a high-throughput, multi-target parallel processing pipeline (MTPP) for gene-to-structure determination to support the consortium. Here we describe the protocols used to determine the structure of the PB2 subunit from four different influenza A strains.

Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for lead discovery. The following article highlights how the Seattle Structural Genomics Center for Infectious Disease utilizes a multi-target approach for gene-to-structure determination of the PB2 influenza A subunit.

인플루엔자 중합 효소의 유전자에 대한 구조 결정 PB2 소단위를위한 멀티 타겟 병렬 처리 방식

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States ...

면역학 및 감염병학

Expression and Purification of the Human Lipid-sensitive Cation Channel TRPC3 for Structural Determination by Single-particle Cryo-electron Microscopy

Transient receptor potential channels (TRPCs) of the canonical TRP subfamily are nonselective cation channels that play an essential role in calcium homeostasis, particularly store-operated calcium entry, which is critical to maintaining proper function of synaptic vesicle release and intracellular signaling pathways. Accordingly, TRPC channels have been implicated in a variety of human diseases including cardiovascular disorders such as cardiac hypertrophy, neurodegenerative disorders such as Parkinson&#39;s disease, and neurologic disorders such as spinocerebellar ataxia. Therefore, TRPC channels represent a potential pharmacologic target in human diseases. However, the molecular mechanisms of gating in these channels are still unclear. The difficulty in obtaining large quantities of stable, homogeneous, and purified protein has been a limiting factor in structure determination studies, particularly for mammalian membrane proteins such as the TRPC ion channels. Here, we present a protocol for the large-scale expression of mammalian ion channel membrane proteins using a modified baculovirus gene transfer system and the purification of these proteins by affinity and size-exclusion chromatography. We further present a protocol to collect single-particle cryo-electron microscopy images from purified protein and to use these images to determine the protein structure. Structure determination is a powerful method for understanding the mechanisms of gating and function in ion channels.

This protocol describes techniques used to determine ion channel structures by cryo-electron microscopy, including a baculovirus system used to efficiently express genes in mammalian cells with minimum effort and toxicity, protein extraction, purification, and quality checking, sample grid preparation and screening, as well as data collection and processing.

식 및 단일 입자 Cryo 전자 현미경 검사 법에 의하여 구조 결심에 대 한 인간의 지질 민감한 양이온 채널 TRPC3의 정화

Transient receptor potential channels (TRPCs) of the canonical TRP subfamily are nonselective cation channels that play an essential role in calcium ...

Production of Recombinant PRMT Proteins using the Baculovirus Expression Vector System

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. PRMTs can either mono- or dimethylate arginine guanidino groups symmetrically or asymmetrically. The enzymology of these proteins is a complex and intensely investigated area that requires milligram quantities of high-quality recombinant protein. The baculovirus expression vector system (BEVS) employing Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and Spodoptera frugiperda 9 (Sf9) insect cells has been used for expression screening and production of many PRMTs, including PRMT 1, 2, and 4 through 9. To simultaneously screen for the expression of multiple constructs of these proteins, including domains and truncated fragments as well as the full-length proteins, we have applied scalable methods utilizing adjustable and programmable multichannel pipettes, combined with 24- and 96-well plates and blocks. Overall, these method adjustments enabled a large-scale generation of bacmid DNA, recombinant viruses, and protein expression screening. Using culture vessels with a high-fill volume of Sf9 cell suspension helped to overcome space limitations in the production pipeline for single batch large-scale protein production. Here, we describe detailed protocols for the efficient and cost-effective expression of functional PRMTs for biochemical, biophysical, and structural studies.

The baculovirus expression vector system (BEVS) is a robust platform for expression screening and production of protein arginine methyltransferases (PRMTs) to be used for biochemical, biophysical, and structural studies. Milligram quantities of material can be produced for the majority of PRMTs and other proteins of interest requiring a eukaryotic expression platform.

바쿨로바이러스 발현 벡터 시스템을 이용한 재조합 PRMT 단백질 생산

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. ...

Phage Phenomics: Physiological Approaches to Characterize Novel Viral Proteins

Current investigations into phage-host interactions are dependent on extrapolating knowledge from (meta)genomes. Interestingly, 60 - 95% of all phage sequences share no homology to current annotated proteins. As a result, a large proportion of phage genes are annotated as hypothetical. This reality heavily affects the annotation of both structural and auxiliary metabolic genes. Here we present phenomic methods designed to capture the physiological response(s) of a selected host during expression of one of these unknown phage genes. Multi-phenotype Assay Plates (MAPs) are used to monitor the diversity of host substrate utilization and subsequent biomass formation, while metabolomics provides bi-product analysis by monitoring metabolite abundance and diversity. Both tools are used simultaneously to provide a phenotypic profile associated with expression of a single putative phage open reading frame (ORF). Representative results for both methods are compared, highlighting the phenotypic profile differences of a host carrying either putative structural or metabolic phage genes. In addition, the visualization techniques and high throughput computational pipelines that facilitated experimental analysis are presented.

Here, we present phenomic approaches for the functional characterization of putative phage genes. Techniques include a developed assay capable of monitoring host anabolic metabolism, the Multi-phenotype Assay Plates (MAPs), in addition to the established method of metabolomics, capable of measuring effects to catabolic metabolism.

파지 Phenomics : 생리 학적 접근 방법은 소설 바이러스 성 단백질의 특성을

Current investigations into phage-host interactions are dependent on extrapolating knowledge from (meta)genomes. Interestingly, 60 - 95% of all phage ...

Lipidic Bicelles에서 ABC Transporter Membrane Proteins의 결정화

ABCG5/G8 Crystallization in a Lipidic Bicelle Environment for X-Ray Crystallography

ATP-binding cassette (ABC) transporters constitute lipid-embedded membrane proteins. Extracting these membrane proteins from the lipid bilayer to an aqueous environment is typically achieved by employing detergents. These detergents disintegrate the lipid bilayer and solubilize the proteins. The intrinsic habitat of membrane proteins within the lipid bilayer poses a challenge in maintaining their stability and uniformity in solution for structural characterization. Bicelles, which comprise a blend of long and short-chain phospholipids and detergents, replicate the natural lipid structure. The utilization of lipid bicelles and detergents serves as a suitable model system for obtaining high-quality diffraction crystals, specifically to determine the high-resolution structure of membrane proteins. Through these synthetic microenvironments, membrane proteins preserve their native conformation and functionality, facilitating the formation of three-dimensional crystals. In this approach, the detergent-solubilized heterodimeric ABCG5/G8 was reintegrated into DMPC/CHAPSO bicelles, supplemented with cholesterol. This setup was employed in the vapor diffusion experimental procedure for protein crystallization.

저자 스포트라이트: 약물 개발을 촉진하기 위한 ABC 수송체 막 단백질의 이중세포 결정화 설정 

This protocol describes a setup for the crystallization of the sterol transporter ABCG5/G8. ABCG5/G8 is reconstituted into bicelles for hanging-drop crystallization. The protocol does not require specialized materials or substrates, making it accessible and easy to adapt in any laboratory for determining the protein structure through X-ray crystallography.

X선 결정학을 위한 지질 이중세포 환경에서의 ABCG5/G8 결정화

ATP-binding cassette (ABC) transporters constitute lipid-embedded membrane proteins. Extracting these membrane proteins from the lipid bilayer to an ...

재조합 단백질 발현, 결정화 및 생물 물리학 연구

요약

더 많은 비디오 탐색

이 비디오의 챕터

생산, 결정화 및 구조 결정의

단백질 결정의 미세 결정학 및

표현과 포유류 Bestrophin 이온 채널의 정화

인플루엔자 중합 효소의 유전자에 대한 구조 결정 PB2 소단위를위한 멀티 타겟 병렬 처리 방식

식 및 단일 입자 Cryo 전자 현미경 검사 법에 의하여 구조 결심에 대 한 인간의 지질 민감한 양이온 채널 TRPC3의 정화

바쿨로바이러스 발현 벡터 시스템을 이용한 재조합 PRMT 단백질 생산

파지 Phenomics : 생리 학적 접근 방법은 소설 바이러스 성 단백질의 특성을

X선 결정학을 위한 지질 이중세포 환경에서의 ABCG5/G8 결정화

X선 결정학을 위한 지질 이중세포 환경에서의 ABCG5/G8 결정화

X선 결정학을 위한 지질 이중세포 환경에서의 ABCG5/G8 결정화