Name: vigs-mediated forward genetics screening for identification of genes involved in nonhost resistance
Uploaded: 2013-08-23T13:00:00.000+00:00
Duration: 8 min 17 s
Description: Watch this Scientific Journal Video about VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance at JoVE.com

이 프로젝트는 사무엘 로버츠 노블 재단에 의해 후원되었다. 저자는 회원국 감사합니다. 제니 갤로 웨이와 콜린이 우수한 식물 관리를위한 Elles, 그리고 작품에 대한 양 케이티 브라운. 우리는 또한 회원국에게 감사의 말씀을 전합니다. 트리 나 코트렐, 푸자 Uppalapati, Moumita 사하구, Swetha Vinukonda이 프로토콜을 설정하는 동안 기술 지원을위한 씨 이삭 Greenhut.

1. 식물 성장 및 타겟 유전자 침묵 <ol><li> 식물의 성장 조건 : <ol><li> N.를 뿌리다 토양 덜 포팅 혼합물 메트로 믹스 350 성장 챔버에서 씨앗을 발아에 benthamiana 씨. 다른 토양 토양 적은 매체는 메트로 - 믹스 대신 사용할 수 있습니다. </li><li> 이식 3 주 오래된 개별 화분에 모종 21 유지 온실에서 그들을 성장 ± 2 ° C 이전의 문헌 12에 설명 된 다른 성장 조건과 함께. 두 사흘 이식 후, 식물 TRV 접종에 사용할 수 있습니다. </li></ol></li><li> TRV2 클론을 성장 : TRV는 양자 바이러스 및 게놈 RNA1 및 RNA2으로 구성되어 있습니다. RNA1는 RNA 의존 RNA 중합 효소와 운동 단백질 20,21 인코딩합니다. RNA2는 외피 단백질 (CP) 및 subgenomic RNA를 21 개의 비 구조 단백질을 인코딩합니다. RNA1 및 RNA2 모두 성숙 비르의 형성에 필요한우리 입자들의 확산 20,21. TRV2 벡터의 cDNA를 라이브러리 건설 이전의 문학 22,23에 설명되어 있습니다. 간단히, 본 연구에서 사용 VIGS 라이브러리는 다양한 생물과 비 생물 적 elicitors에 노출 된 잎 조직에서 추출한 RNA에서 건설되었다. <ol><li> 냉장고에서 TRV2 벡터의 cDNA를 클론 (96 - 웰 플레이트)가 포함 된 아그로 박테 리움을 (GV2260 변형) 꺼냅니다. 점차적를 해동하고 문화가 실내 온도에 도달 한 후, 96 핀 Replicator를 사용하여 리팜피신 (10 ㎍ / ㎖) 및 카나마이신 (50 ㎍ / ㎖)과 루리아 - 베르 타니 (LB) 한천 배지에 각각의 아그로 박테 리움 문화를 접종. </li><li> 이틀 동안 28 ° C에서 번호판을 품어. 그 적절한 아그로 박테 리움의 접종이 두 식물의 찌르기 접종 사용할 수 있도록 우리는 일반적으로 각 복제에 대한 네 가지 복제 식민지를 성장. 무균 조건 하에서 모든 단계를 수행합니다. </li></ol></li><li> VIGS : <ol><li> 성장28에 TRV1을 들고 아그로 박테 리움 (GV2260) ° 위에서 언급 한 항생제와 LB 액체 배지에서 C. 하룻밤 성장 문화에서 원심 분리하여 수확 세포는 (10 MM MES, 산도 5.5, 200 μM의 acetosyringone) 접종 버퍼에 다시 일시 중지, 50 rpm으로 진탕, 실온에서 3 시간 동안 배양한다. </li><li> 원심 분리하여 세포를 수확하고 5 밀리미터 MES 버퍼 (산도 5.5) 및 접종 (OD 600 = 0.3)에 다시 일시 중지합니다 3-4 N.의 배축면에 benthamiana는 needleless 주사기를 사용 둡니다. 자세한 접종 절차는 이전의 문헌 24에 나와 있습니다. 나중에 TRV1 접종의 사이트에서, 이쑤시개와 잎을 찔러서 각각의 TRV2 식민지를 접종. </li><li> 활발한 성장을 효율적으로 VIGS 12 중요하기 ​​때문에 충분한 영양과 식물을 유지합니다. 2 주간 포스트 접종에 대한 표적 유전자의 전사가 감소하기 시작하고 식물 병원균 INOC을위한 준비TRV 접종 후 3 주에 ulation. </li></ol></li></ol> 2. Nonhost 병원체 문화 및 식물 접종의 준비 <ol><li> 본 연구에 사용 된 병원균의 세부 사항 : 모나스 syringae pv를. tabaci, P. syringae pv를. 토마토 T1, P. syringae pv를. glycinea과 크 산토 모나스 (Xanthomonas) campestris pv를. vesicatoria 본 연구에 사용됩니다. P. 성장 왕의 B (KB) 12 시간 동안 28 ° C에서 리팜피신 (10 ㎍ / ㎖), 카나마이신 (50 ㎍ / ㎖)를 첨가 액체 배지에 syringae 변종. X. 성장 16 시간 동안 LB 액체 배지에서 campestris pv를. vesicatoria. 모든 병원균 이전 문헌 19에서 설명한대로 GFPuv을 표현할 수있는 플라스미드를 항구. </li><li> 식물의 접종에 대한 병원체 배양의 준비 : <ol><li> 원심 분리하여 세균 세포를 수확 긴 주를 사용하여 녹색 형광의 존재를 확인어둠 속에서 velength UV 램프. 멸균 수로 두 번 세포를 씻으하고는 멸균 물을 사용하여 원하는 농도에 다시 일시 중지합니다. </li><li> 반점 (약 1.5 cm 직경)와 같은 표적 유전자 침묵 잎 (5 일 ~ 8 일)의 배축면에 각각의 병원체 (들)을 접종한다. 여러 nonhost 병원체를 동시에 표적 유전자 침묵 식물에서의 성장을위한 테스트 할 수 있습니다. 이것은 란타 박테리아의 성장에서 볼 수있는 양성 대조군으로 사용 할 수있는 동시에 호스트 병원체를 접종. 또한 접종 벡터 제어 (TRV :: 00) 식물. </li></ol></li></ol> 3. 세균성 병원균의 란타 성장의 관찰 <ol><li> 어둠 속에서 긴 파장 자외선에 접종 잎을 노출합니다. 세균성 식민지 잎 표면에서 방출되는 적색 형광 배경에 잎의 배축 측면에서 녹색 형광 점으로 볼 수 있습니다. </li><li> 병원균의 성장을 관찰이일 포스트 접종 (dpi)로부터 5 DPI. 이 시간 간격 동안 매일 관찰이 필요합니다. </li><li> 후 첫 번째 화면, 짧은 명단 침묵 하나 이상의 nonhost 병원체 (들)의 성장 결과 클론. </li><li> 선택한 클론 VIGS를 반복하고 다시 nonhost 병원체 (들) 유전자 침묵 식물의 반응을 테스트합니다. 심사의 두 번째 레벨은 첫 번째 화면 중에 얻은 잘못된 반응을 제거하기 위해 수행됩니다. </li></ol> 4. 변조 된 Nonhost 저항을 위해 선발 된 식물의 확인 <ol><li> 위에서 설명한대로 화면에서 선택의 cDNA 클론을 침묵. 5 분 - 0.01 % (v / v)의 Silwet L-77 3 진공 청소기로 청소하기 위하여 침수 식물을 복종과 각각의 병원체 문화와 식물을 잠수하여 nonhost 병원체 (들)과 전체 공장을 접종한다. 아래에 설명 된대로 기존의 성장 분석 6,18,19하여 박테리아의 성장을 계량. </li><li> 0 시간 후 접종 (HPI)에서,3 dpi로 5부터, 잎 펀치 (0.5 cm 2)를 사용하여 다섯 개의 생물 각 nonhost 병원체 (들) 복제 접종 잎에서 두 잎 샘플을 수집합니다. 잎 샘플 2 일 동안 28 ° C에서 적절한 항생제와 부화로 보충 KB 한천 배지에 시리얼 희석 판 수액을 갈기. 식민지 카운터를 사용하여 세균성 식민지를 계산하고 이전의 문헌 6에 설명 된 잎 박테리아의 성장을 계산합니다. </li><li> nonhost 병원체 (들)에 민감한 식물 벡터 제어에 비해 병원균의 성장의 높은 숫자를 표시해야합니다. </li></ol> 5. 대상 유전자의 삽입 및 확인을 시퀀싱 <ol><li> attB1 및 attB2 프라이머를 사용하거나 TRV2 벡터에 클로닝 사이트를 측면에서는 프라이머를 사용하여 선택한 복제에 대한 식민지 PCR을 수행합니다. 겔에 PCR 제품을 실행하고 단일 대역의 증폭을 확인합니다. </li><li> TRV2 벡터의 식물 유전자 삽입은 attB를 사용하여 염기 서열 할 수 있습니다프라이머하거나 복제 사이트를 측면에서는 프라이머. </li><li> 시퀀스를 사용하여 BLAST를 수행하고 유전자의 세부 사항을 확인합니다. </li><li> 유엔 번역 된 지역 (UTRs)와 함께 전체 길이 유전자 서열을 구하십시오. </li><li> 시퀀스의 세 가지 영역 300-400 bp의 단편을 선택하고 TRV2 벡터로 그들을 복제. 독립적 세 VIGS 구문을 사용하여 VIGS을 수행하고 세 가지 유전자 침묵 식물 nonhost 저항의 타협을 확인합니다. </li></ol>

<ol>
	<li>Heath, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+and+nonspecific+plant+defenses.">Nonhost resistance and nonspecific plant defenses.</a> Currrent Opinion in Plant Biology. 3, 315-319 (2000).</li><li>Mysore, K. S., Ryu, C. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance:+how+much+do+we+know.">Nonhost resistance: how much do we know.</a> Trends in Plant Science. 9, 97-104 (2004).</li><li>Ellis, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+nonhost+disease+resistance:+can+they+assist+disease+control+in+agriculture.">Insights into nonhost disease resistance: can they assist disease control in agriculture.</a> The Plant Cell. 18, 523-528 (2006).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+against+bacterial+pathogens:+retrospects+and+prospects.">Nonhost resistance against bacterial pathogens: retrospects and prospects.</a> Annual Review of Phytopathology. 51, (2013).</li><li>Lu, M., Tang, X., Zhou, J. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arabidopsis+NHO1+is+required+for+general+resistance+against+Pseudomonas+bacteria.">Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria.</a> The Plant Cell. 13, 437-447 (2001).</li><li>Rojas, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycolate+oxidase+plays+a+major+role+during+nonhost+resistance+responses+by+modulating+reactive+oxygen+species+mediated+signal+transduction+pathways.">Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways.</a> The Plant Cell. 24, 336-352 (2012).</li><li>Daurelio, L. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+analysis+reveals+novel+genes+involved+in+nonhost+response+to+bacterial+infection+in+tobacco.">Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco.</a> Journal of Plant Physiology. 168, 382-391 (2011).</li><li>Moreau, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EDS1+contributes+to+nonhost+resistance+of+Arabidopsis+thaliana+against+Erwinia+amylovora.">EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora.</a> Molecular Plant-Microbe Interactions. 25, 421-430 (2012).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ornithine-delta-aminotransferase+and+proline+dehydrogenase+genes+play+a+role+in+non-host+disease+resistance+by+regulating+pyrroline-5-carboxylate+metabolism-induced+hypersensitive+response.">Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response.</a> Plant, Cell &amp; Environment. 35, 1329-1343 (2012).</li><li>Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+and+advantages+of+virus-induced+gene+silencing+for+gene+function+studies+in+plants.">Applications and advantages of virus-induced gene silencing for gene function studies in plants.</a> The Plant Journal. 39, 734-746 (2004).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+dimensions+for+VIGS+in+plant+functional+genomics.">New dimensions for VIGS in plant functional genomics.</a> Trends in Plant Science. 16, 656-665 (2011).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+can+persist+for+more+than+2+years+and+also+be+transmitted+to+progeny+seedlings+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato.</a> Plant Biotechnology Journal. 9, 797-806 (2011).</li><li>Bombarely, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+draft+genome+sequence+of+Nicotiana+benthamiana+to+enhance+molecular+plant-microbe+biology+research.">A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research.</a> Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).</li><li>Sharma, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+silencing+of+WIPK+and+SIPK+genes+reduces+resistance+to+a+bacterial+pathogen,+but+has+no+effect+on+the+INF1-induced+hypersensitive+response+(HR)+in+Nicotiana+benthamiana.">Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana.</a> Mol Gen Genomics. 269, 583-591 (2003).</li><li>Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+forward+genetics+based+on+virus-induced+gene+silencing.">Fast forward genetics based on virus-induced gene silencing.</a> Current Opinion in Plant Biology. 2, 109-113 (1999).</li><li>Lu, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+throughput+virus-induced+gene+silencing+implicates+heat+shock+protein+90+in+plant+disease+resistance.">High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance.</a> EMBO Journal. 22, 5690-5699 (2003).</li><li>Pozo, O., Pedley, K. F., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MAPKKK[alpha]+is+a+positive+regulator+of+cell+death+associated+with+both+plant+immunity+and+disease.">MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease.</a> EMBO Journal. 23, 3072-3082 (2004).</li><li>Wang, K., Senthil-Kumar, M., Ryu, C. -. M., Kang, L., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phytosterols+play+a+key+role+in+plant+innate+immunity+against+bacterial+pathogens+by+regulating+nutrient+efflux+into+the+apoplast.">Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast.</a> Plant Physiology. 158, 1789-1802 (2012).</li><li>Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+in+planta+bacterial+infection+at+both+cellular+and+whole-plant+levels+using+the+green+fluorescent+protein+variant+GFPuv.">Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv.</a> New Phytologist. 174, 212-223 (2007).</li><li>Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technical+Advance:+Tobacco+rattle+virus+as+a+vector+for+analysis+of+gene+function+by+silencing.">Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing.</a> The Plant Journal. 25, 237-245 (2001).</li><li>MacFarlane, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+biology+of+the+tobraviruses.">Molecular biology of the tobraviruses.</a> Journal of General Virology. 80, 2799-2807 (1999).</li><li>Anand, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+plant+genes+involved+in+Agrobacterium-mediated+plant+transformation+by+virus-induced+gene+silencing.">Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing.</a> Molecular Plant-Microbe Interactions. 20, 41-52 (2007).</li><li>Liu, E., Page, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+cDNA+libraries+for+virus-induced+gene+silencing+(VIGS)+using+tobacco+rattle+virus.">Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus.</a> Plant Methods. 4, 5 (2008).</li><li>Vel&#225;squez, A. C., Chakravarthy, S., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+(VIGS)+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato.</a> J. Vis. Exp. (28), e1292 (2009).</li><li>Peart, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitin+ligase-associated+protein+SGT1+is+required+for+host+and+nonhost+disease+resistance+in+plants.">Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants.</a> Proceedings of the National Academy of Sciences. 99. , 99-10869 (2002).</li><li>Oh, S. -. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insight+into+Types+I+and+II+nonhost+resistance+using+expression+patterns+of+defense-related+genes+in+tobacco.">Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco.</a> Planta. 223, 1101-1107 (2006).</li><li>Senthil-Kumar, M., Mysore, K., Kodama, H., Komamine, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+and+Plant+Gene+Function+Analysis.">RNAi and Plant Gene Function Analysis.</a> Methods in Molecular Biology. 744, 13-25 (2011).</li></ol>

우리는 공개 아무것도 없어.

식물 면역 거의 또는 전혀 녹색 형광 벡터 제어 공장에서 방출되지 않는, 따라서 nonhost 병원균의 성장을 제한하고 장파장 자외선 (그림 3D)에 따라 nonhost 병원균 접종 둡니다. 그러나 nonhost 저항에 관련된 유전자가 침묵 할 때, 유전자 침묵 식물 nonhost 병원균과 녹색 형광의 성장 (그림 3E) 볼을 선호. 이것은이 논문에 설명 된 방법에 관련된 기본 원칙이다. 이 방법은 HR-기반?...

Nonhost 저항은 특정 병원체 1,2 인종에 대한 모든 식물 종의 저항이다. 이 넓은 스펙트럼과 식물 2,3 튼튼한 질병 저항을 부여. 그러나 특히 세균성 병원균에 대한 기전은 잘 4 이해되지 않습니다. 타협 nonhost 저항 및 nonhost 저항 5-9시 차등 발현 유전자의 식별을위한 높은 처리량 성적 프로파일은 이전 세균 nonhost 저항을 해부에 사용되는 두 가지 주요 방법임을 돌연변이 또는 침묵 식물 검사. nonhost 저항은 많은 유전자, 유전자 식별을위한 높은 처리량 기능 게놈 접근법의 참여와 복잡한 메커니즘 (들) 4에 의해 제어되기 때문에 nonhost 저항 메커니즘 (들)을보다 잘 이해 중요합니다. 바이러스에 의한 유전자 침묵 (VIGS)가 성공적으로 내생 식물 침묵하는 데 사용되었습니다많은 식물 종 10,11의 유전자.은 Nicotiana benthamiana는 VIGS 10,12하고 초안 게놈 시퀀스에 대한 가장 적합한 식물 중 하나입니다 지금 13 사용할 수 있습니다. 담배 딸랑이 바이러스 (TRV) 기반 VIGS 널리 역 유전학 도구로 사용되었다 nonhost 저항 2,4,14에 관련된 유전자의 특성을. 이 VIGS 벡터 및 파생 상품은 애기 장대 생물 자원 센터 (ABRC를 통해 지금 사용할 수 있습니다 <a href="http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html" target="_blank">http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html</a> ). VIGS는 식물의 면역 15-17, 특히 nonhost 저항 6,18에 관련된 유전자를 식별 앞으로 유전학 도구로 사용되었습니다. 과민 반응 (HR) 매개 특정 nonhost 병원균에 대한 식물에 의해 유도 된 세포 죽음을 평가하고 질병에 의한 세포 죽음을 평가하는 것은 주로 identifyin에 사용되는 두 가지 주요 분석입니다G 감수성 유전자는 식물을 침묵. 그러나 HR 세포의 죽음이 유일한 유형-II nonhost 병원균에 대한 유도가 아닌 타입-I nonhost 병원균 2에 대하여. 따라서, HR의 분석은 보편적 특히 타입 I nonhost 병원체의 넓은 범위에 식물에 의해 사용 nonhost 저항 전략을 파악하는 데 사용할 수 없습니다. 또한, 유전자 침묵 공장에서 nonhost 저항의 부분적인 손실이 항상 질병의 증상 6 따라서 질병 점수가 nonhost 저항을 저하 식물을 식별하는 데 사용할 수 없습니다 이어질하지 않습니다. 반면에, 유전자 침묵 식물 nonhost 병원균의 성장을 평가하는 유전자 침묵 식물 nonhost 저항의 손실을 공부하기위한 좋은 방법입니다. 기존의 성장 분석 6,19, 유전자 침묵 식물에 nonhost 박테리아의 성장을 평가하기위한 빠른 방법에 비해 앞으로 유전학 검사에 필요한 시간을 단축 할 수 있습니다. 우리는 이전에 박테리아를 관찰하는 방법을보고자외선 아래에서 육안으로 잎에 L 병원균의 성장 (UV)는 밝은 녹색 형광 단백질 (GFP) 19를 표현하는 박테리아를 사용하여. 이 논문에서 우리는 nonhost 저항을 손상하는 유전자 침묵 식물의 쉽게 식별 nonhost 세균성 병원체를 표현 GFPuv의 유용성을 보여줍니다. 이 방법은 감염 식물의 식별을위한 정확하고 높은 처리량 검사에 대한 의무이다.

<table><tbody><tr><td>96-well U-bottom plates</td><td>Becton Dickinson Labware (Franklin Lakes, NJ, USA)</td><td>35-3077</td><td></td></tr><tr><td>96-pin replicator stainless steel</td><td>Nalge Nunc International (Naperville, IL, USA)</td><td>250520</td><td></td></tr><tr><td>High Intensity UV Inspection Lamps, Model B-100ap</td><td>Thomas scientific (Swedesboro, NJ, USA)</td><td>6283K50</td><td>Manufacturer ID 95-0127-01 </td></tr><tr><td>Stuart SC6 colony counter</td><td>Bibby Scientific Limited, Staffordshire, UK</td><td>SC6PLUS</td><td></td></tr><tr><td>Soil-less potting mixture, Metro-Mix 350</td><td>SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)</td><td></td><td></td></tr><tr><td>Primers:&lt;br/&gt; attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT)&lt;br/&gt; attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)</td><td>Integrated DNA Technologies, Inc (Coralville, IA, USA)</td><td>Custom synthesized</td><td></td></tr><tr><td>MES, Monohydrate </td><td>VWR international (Radnor, PA, USA)</td><td>CAS No. 145224-94-8</td><td></td></tr><tr><td>Acetosyringone (Dimethoxy-4&amp;rsquo;-hydroxyacetophenone) </td><td>Sigma Aldrich (St. Louis, MO, USA)</td><td>D134406</td><td></td></tr><tr><td>Vac-In-Stuff (Silwet L-77)</td><td>Lehle Seeds (Round Rock, TX, USA)</td><td>VIS-30</td><td></td></tr></tbody></table>

vigs-mediated forward genetics screening for identification of genes involved in nonhost resistance

세균성 병원균에 대한 식물의 Nonhost 질병 저항은 복잡한 방어 경로에 의해 제어됩니다. 이 메커니즘을 이해하는 것은 병원균의 넓은 범위에 대한 내구성이 질병 저항성 식물 개발을위한 중요합니다. 바이러스에 의한 유전자 침묵 (VIGS) 기반의 앞으로 유전학 검사는 nonhost 저항을 부여 식물의 방어 유전자의 식별을위한 유용한 방법입니다. 담배 딸랑이 바이러스 (TRV) 기반 VIGS 벡터 날짜에 가장 효율적인 VIGS 벡터이며가 효율적으로 사용되었습니다 은 Nicotiana benthamiana에서 내생 대상 유전자를 침묵합니다. 이 논문에서, 우리는 N.에서의 cDNA 라이브러리에서 개별 클론의 침묵에 대해 앞으로 유전학 검사 방식을 보여 benthamiana와 nonhost 병원균에 대한 노출 nonhost 저항을 유전자 침묵 식물의 반응을 평가, 모나스 syringae pv를. 토마토 T1, P. syringae pv를. GLYCinea, 그리고 X. campestris pv를. vesicatoria. 이러한 세균성 병원균 표현 GFPuv 단백질을 설계하고 침묵 표적 유전자가 nonhost 저항을 부여에 관여하는 경우 그들의 녹색 형광 식민지가 nonhost 병원균 접종 공장에서 UV 빛의 밑에 육안으로 볼 수 있습니다. 이 nonhost 병원균에 감염 유전자 침묵 식물의 믿을 수있는 빠른 식별을 용이하게합니다. 또한, 유망 후보 유전자 정보는 TRV 벡터 식물 유전자 삽입 순서에 의해 알 수있다. 여기에 우리가 nonhost 저항성에 관련된 유전자를 식별하는 VIGS 매개 앞으로 유전학의 높은 처리 능력을 보여줍니다. 약 100 cDNA를 개별적 이후 주에서 공부 할 수있는 약 2~3주 여러 nonhost 세균성 병원균에 대한 nonhost 저항의 관련성에 침묵 할 수 있습니다. 이 논문에서, 우리는이 검사에 관련된 자세한 단계를 열거합니다. VIGS 매개 앞으로 유전학 screeniNG 접근 방식은 nonhost 저항에 관여 식별 유전자뿐만 아니라 다양한 식물 종의 다양한 생물과 비 생물 적 스트레스 공차를 부여 유전자를 공부하는뿐만 아니라 확장 할 수 있습니다.

본 연구의 주요 목적은 N. 침묵을 지켰 유전자의 쉽고 정확하게 식별하는 방법을 보여주는 것입니다 nonhost 저항을 손상하는 benthamiana 공장. 이 방법의 네 가지 주요 단계가 있습니다. 첫 번째 단계는 개별적으로 TRV-VIGS를 사용하여 유전자의 다수를 침묵하는 것입니다. 우리는 그림 1에 묘사 된 프로토콜을 사용하여 약 1.5 년의 기간 동안 약 5,000 유전자에게 6,18 침묵을</...

Watch this Scientific Journal Video about VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance at JoVE.com

VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

바이러스에 의한 유전자 침묵은 식물의 nonhost 저항성에 관련된 유전자를 식별하기위한 유용한 도구입니다. 우리는 nonhost 병원균에 감염 유전자 침묵 식물을 식별 GFPuv을 표현 세균성 병원체의 사용을 보여줍니다. 이 방법은 빠르고, 간단하고 대규모 검사와 유사한 프로토콜이 다양한 식물 미생물 상호 작용을 연구에 적용 할 수있는 용이하게합니다.

유전자의 식별을위한 VIGS - 중재 앞으로 유전학 검사는 Nonhost 저항에 참여


	Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important ...

vigs-mediated-forward-genetics-screening-for-identification-genes

Universidad de Cartagena UDEC

Research

JoVE Journal

Immunology and Infection

16.9K 조회수.  The Samuel Roberts Noble Foundation.  바이러스에 의한 유전자 침묵은 식물의 nonhost 저항성에 관련된 유전자를 식별하기위한 유용한 도구입니다. 우리는 nonhost 병원균에 감염 유전자 침묵 식물을 식별 GFPuv을 표현 세균성 병원체의 사용을 보여줍니다. 이 방법은 빠르고, 간단하고 대규모 검사와 유사한 프로토콜이 다양한 식물 미생물 상호 작용을 연구에 적용 할 수있는 용이하게합니다. 

비디오: VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

Genetic Manipulation of the Plant Pathogen Ustilago maydis to Study Fungal Biology and Plant Microbe Interactions

Gene deletion plays an important role in the analysis of gene function. One of the most efficient methods to disrupt genes in a targeted manner is the replacement of the entire gene with a selectable marker via homologous recombination. During homologous recombination, exchange of DNA takes place between sequences with high similarity. Therefore, linear genomic sequences flanking a target gene can be used to specifically direct a selectable marker to the desired integration site. Blunt ends of the deletion construct activate the cell&#39;s DNA repair systems and thereby promote integration of the construct either via homologous recombination or by non-homologous-end-joining. In organisms with efficient homologous recombination, the rate of successful gene deletion can reach more than 50% making this strategy a valuable gene disruption system. The smut fungus Ustilago maydis is a eukaryotic model microorganism showing such efficient homologous recombination. Out of its about 6,900 genes, many have been functionally characterized with the help of deletion mutants, and repeated failure of gene replacement attempts points at essential function of the gene. Subsequent characterization of the gene function by tagging with fluorescent markers or mutations of predicted domains also relies on DNA exchange via homologous recombination. Here, we present the U. maydis strain generation strategy in detail using the simplest example, the gene deletion.

Genetic Manipulation of the Plant Pathogen Ustilago maydis to Study Fungal Biology and Plant Microbe Interactions

We describe a robust gene replacement strategy to genetically manipulate the smut fungus Ustilago maydis. This protocol explains how to generate deletion mutants to investigate infection phenotypes. It can be extended to modify genes in any desired way, e.g., by adding a sequence encoding a fluorescent protein tag.

플랜트 병원체의 유전자 조작<em&gt; Ustilago maydis</em&gt; 곰팡이 생물과 식물 미생물 상호 작용을 연구하는

Gene deletion plays an important role in the analysis of gene function. One of the most efficient methods to disrupt genes in a targeted manner is the ...

연구

유전학

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the identification and verification of a drug resistance gene in the Apicomplexan parasite Toxoplasma gondii, the method of Quantitative Trait Locus (QTL) mapping using a Whole Genome Sequence (WGS) -based genetic map and the method of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 -based gene editing. The approach of QTL mapping allows one to test if there is a correlation between a genomic region(s) and a phenotype. Two datasets are required to run a QTL scan, a genetic map based on the progeny of a recombinant cross and a quantifiable phenotype assessed in each of the progeny of that cross. These datasets are then formatted to be compatible with R/qtl software that generates a QTL scan to identify significant loci correlated with the phenotype. Although this can greatly narrow the search window of possible candidates, QTLs span regions containing a number of genes from which the causal gene needs to be identified. Having WGS of the progeny was critical to identify the causal drug resistance mutation at the gene level. Once identified, the candidate mutation can be verified by genetic manipulation of drug sensitive parasites. The most facile and efficient method to genetically modify T. gondii is the CRISPR/Cas9 system. This system comprised of just 2 components both encoded on a single plasmid, a single guide RNA (gRNA) containing a 20 bp sequence complementary to the genomic target and the Cas9 endonuclease that generates a double-strand DNA break (DSB) at the target, repair of which allows for insertion or deletion of sequences around the break site. This article provides detailed protocols to use CRISPR/Cas9 based genome editing tools to verify the gene responsible for sinefungin resistance and to construct transgenic parasites.

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

Details are presented on how QTL mapping with a whole genome sequence based genetic map can be used to identify a drug resistance gene in Toxoplasma gondii and how this can be verified with the CRISPR/Cas9 system that efficiently edits a genomic target, in this case the drug resistance gene.

약물 저항 유전자를 확인하기위한 QTL 매핑 및 CRISPR / Cas9 편집<em&gt; Toxoplasma gondii</em

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the ...

Forward Genetic Approach to Uncover Stress Resistance Genes in Mice &#8212; A High-throughput Screen in ES Cells

Phenotype-driven genetic screens in mice is a powerful technique to uncover gene functions, but are often hampered by extremely high costs, which severely limits its potential. We describe here the use of mouse embryonic stem (ES) cells as surrogate cells to screen for a phenotype of interest and subsequently introduce these cells into a host embryo to develop into a living mouse carrying the phenotype. This method provides (1) a cost effective, high-throughput platform for genetic screen in mammalian cells; (2) a rapid way to identify the mutated genes and verify causality; and (3) a short-cut to develop mouse mutants directly from these selected ES cells for whole animal studies. We demonstrated the use of paraquat (PQ) to select resistant mutants and identify mutations that confer oxidative stress resistance. Other stressors or cytotoxic compounds may also be used to screen for resistant mutants to uncover novel genetic determinants of a variety of cellular stress resistance.

Stress resistance is one of the hallmarks for longevity and is known to be genetically governed. Here, we developed an unbiased high-throughput method to screen for mutations that confer stress resistance in ES cells with which to develop mouse models for longevity studies.

앞으로 유전 접근은 마우스의 스트레스 저항성 유전자를 밝히기 위해서 - ES 세포에서 높은 처리량 화면

Phenotype-driven genetic screens in mice is a powerful technique to uncover gene functions, but are often hampered by extremely high costs, which severely ...

발생학

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide RNA (sgRNA) that confers specificity, the Cas9 protein cleaves both DNA strands at the targeted locus. The DNA break can trigger either non-homologous end joining (NHEJ) or homology directed repair (HDR). NHEJ can introduce small deletions or insertions which lead to frame-shift mutations, while HDR allows for larger and more precise perturbations. Here, we present protocols for generating knockout cell lines by coupling established CRISPR/Cas9 methods with two options for downstream selection/screening. The NHEJ approach uses a single sgRNA cut site and selection-independent screening, where protein production is assessed by dot immunoblot in a high-throughput manner. The HDR approach uses two sgRNA cut sites that span the gene of interest. Together with a provided HDR template, this method can achieve deletion of tens of kb, aided by the inserted selectable resistance marker. The appropriate applications and advantages of each method are discussed.

Recent advances in the ability to genetically manipulate somatic cell lines hold great potential for basic and applied research. Here, we present two approaches for CRISPR/Cas9 generated knockout production and screening in mammalian cell lines, with and without the use of selectable markers.

포유류 세포에서 CRISPR / Cas9 매개 유전자 knockouts의 선택 의존 및 독립적 생성

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

Genome-wide RNAi Screening to Identify Host Factors That Modulate Oncolytic Virus Therapy

High-throughput genome-wide RNAi (RNA interference) screening technology has been widely used for discovering host factors that impact&#160;virus replication. Here we present the application of this technology to uncovering host targets that specifically modulate the replication of Maraba virus, an oncolytic rhabdovirus, and vaccinia virus with the goal of enhancing therapy. While the protocol has been tested for use with oncolytic Maraba virus and oncolytic vaccinia virus, this approach is applicable to other oncolytic viruses and can also be utilized for identifying host targets that modulate virus replication in mammalian cells in general. This protocol describes the development and validation of an assay for high-throughput RNAi screening in mammalian cells, the key considerations and preparation steps important for conducting a primary high-throughput RNAi screen, and a step-by-step guide for conducting a primary high-throughput RNAi screen; in addition, it broadly outlines the methods for conducting secondary screen validation and tertiary validation studies. The benefit of high-throughput RNAi screening is that it allows one to catalogue, in an extensive and unbiased fashion, host factors that modulate any aspect of virus replication for which one can develop an in vitro assay such as infectivity, burst size, and cytotoxicity. It has the power to uncover biotherapeutic targets unforeseen based on current knowledge.

Here we describe a protocol for employing high-throughput RNAi screening to uncover host targets that can be manipulated to enhance oncolytic virus therapy, specifically rhabodvirus and vaccinia virus therapy, but it can be readily adapted to other oncolytic virus platforms or for discovering host genes that modulate virus replication generally.

RNAi 게놈 넓은 검사 Oncolytic 바이러스 치료 변조 호스트 요소를 식별 하

High-throughput genome-wide RNAi (RNA interference) screening technology has been widely used for discovering host factors that impact&#160;virus ...

암 연구학

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

There is much to understand about the onset and progression of neurodegenerative diseases, including the underlying genes responsible. Forward genetic screening using chemical mutagens is a useful strategy for mapping mutant phenotypes to genes among Drosophila and other model organisms that share conserved cellular pathways with humans. If the mutated gene of interest is not lethal in early developmental stages of flies, a climbing assay can be conducted to screen for phenotypic indicators of decreased brain functioning, such as low climbing rates. Subsequently, secondary histological analysis of brain tissue can be performed in order to verify the neuroprotective function of the gene by scoring neurodegeneration phenotypes. Gene mapping strategies include meiotic and deficiency mapping that rely on these same assays can be followed by DNA sequencing to identify possible nucleotide changes in the gene of interest.

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

We present a protocol using a forward genetic approach to screen for mutants exhibiting neurodegeneration in Drosophila melanogaster. It incorporates a climbing assay, histology analysis, gene mapping and DNA sequencing to ultimately identify novel genes related to the process of neuroprotection.

소독멜라노가스터에서 새로운 신경보호 유전자를 식별하기 위한 생체 전방 유전자 스크린

There is much to understand about the onset and progression of neurodegenerative diseases, including the underlying genes responsible. Forward genetic ...

Virus-induced Gene Silencing (VIGS) in Nicotiana benthamiana and Tomato

RNA interference (RNAi) is a highly specific gene-silencing phenomenon triggered by dsRNA1. This silencing mechanism uses two major classes of RNA regulators: microRNAs, which are produced from non-protein coding genes and short interfering RNAs (siRNAs). Plants use RNAi to control transposons and to exert tight control over developmental processes such as flower organ formation and leaf development2,3,4. Plants also use RNAi to defend themselves against infection by viruses. Consequently, many viruses have evolved suppressors of gene silencing to allow their successful colonization of their host5.
Virus-induced gene silencing (VIGS) is a method that takes advantage of the plant RNAi-mediated antiviral defense mechanism. In plants infected with unmodified viruses the mechanism is specifically targeted against the viral genome. However, with virus vectors carrying sequences derived from host genes, the process can be additionally targeted against the corresponding host mRNAs. VIGS has been adapted for high-throughput functional genomics in plants by using the plant pathogen Agrobacterium tumefaciens to deliver, via its Ti plasmid, a recombinant virus carrying the entire or part of the gene sequence targeted for silencing. Systemic virus spread and the endogenous plant RNAi machinery take care of the rest. dsRNAs corresponding to the target gene are produced and then cleaved by the ribonuclease Dicer into siRNAs of 21 to 24 nucleotides in length. These siRNAs ultimately guide the RNA-induced silencing complex (RISC) to degrade the target transcript2.
Different vectors have been employed in VIGS and one of the most frequently used is based on tobacco rattle virus (TRV). TRV is a bipartite virus and, as such, two different A. tumefaciens strains are used for VIGS. One carries pTRV1, which encodes the replication and movement viral functions while the other, pTRV2, harbors the coat protein and the sequence used for VIGS6,7. Inoculation of Nicotiana benthamiana and tomato seedlings with a mixture of both strains results in gene silencing. Silencing of the endogenous phytoene desaturase (PDS) gene, which causes photobleaching, is used as a control for VIGS efficiency. It should be noted, however, that silencing in tomato is usually less efficient than in N. benthamiana. RNA transcript abundance of the gene of interest should always be measured to ensure that the target gene has efficiently been down-regulated. Nevertheless, heterologous gene sequences from N. benthamiana can be used to silence their respective orthologs in tomato and vice versa8.

Virus-induced Gene Silencing VIGS in Nicotiana benthamiana and Tomato

Description of a virus-induced gene silencing (VIGS) method for knock-down of gene expression in Nicotiana benthamiana and tomato.

바이러스 유도 진 입을 (VIGS)에 Nicotiana benthamiana 토마토

RNA interference (RNAi) is a highly specific gene-silencing phenomenon triggered by dsRNA1. This silencing mechanism uses two major classes of RNA ...

생물학

InSET: A Novel Tool for Unbiased Genome-Wide Functional Element Discovery

Identification of Functionally-Relevant Lentivirus Integration Sites in an Insertional Mutagenesis Cell Library

The extent of functional sequences within the human genome is a pivotal yet debated topic in biology. Although high-throughput reverse genetic screens have made strides in exploring this, they often limit their scope to known genomic elements and may introduce non-specific effects. This underscores the urgent need for novel functional genomics tools that enable a deeper, unbiased understanding of genome functionality. This protocol introduces the Insertion-based Screen for functional Elements and Transcripts (InSET), a method for identifying lentivirus integration sites within a lentivirus-based insertional mutagenesis cell library. InSET facilitates the capture of genome-wide lentiviral integration sites, with next-generation sequencing used to detect and quantify flanking sequences. InSET's design enables the analysis of integration site abundance variations in phenotypic screens on a large scale, establishing it as a robust tool for forward genetics and for identifying functional genomic elements. A key benefit of InSET is its capacity to reveal previously unidentified genomic elements, including novel functional exons of both protein-coding and non-coding RNAs, independent of prior annotation. Overall, InSET holds significant value in studying the intricate complexity of the human genome and transcriptome, where many genomic elements await functional characterization.

Insertional mutagenesis is an essential tool in forward genetics for identifying functional genomic elements. Here, we describe the Insertion-based Screen for functional Elements and Transcripts (InSET), a method for detecting lentivirus integration sites within a lentivirus-based insertional mutagenesis cell library.

The extent of functional sequences within the human genome is a pivotal yet debated topic in biology. Although high-throughput reverse genetic screens ...

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-&#947;-Dependent Cell Autonomous Immunity

Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within virtually any warm blooded vertebrate cell type. During parasite invasion of a host cell, the parasite creates a parasitophorous vacuole (PV) that originates from the host cell membrane independent of phagocytosis within which the parasite replicates. While IFN-dependent-innate and cell mediated immunity is important for eventual control of infection, innate immune cells, including neutrophils, monocytes and dendritic cells, can also serve as vehicles for systemic dissemination of the parasite early in infection. An approach is described that utilizes the host innate immune response, in this case macrophages, in a forward genetic screen to identify parasite mutants with a fitness defect in infected macrophages following activation but normal invasion and replication in na&#239;ve macrophages. Thus, the screen isolates parasite mutants that have a specific defect in their ability to resist the effects of macrophage activation. The paper describes two broad phenotypes of mutant parasites following activation of infected macrophages: parasite stasis versus parasite degradation, often in amorphous vacuoles. The parasite mutants are then analyzed to identify the responsible parasite genes specifically important for resistance to induced mediators of cell autonomous immunity. The paper presents a general approach for the forward genetics screen that, in theory, can be modified to target parasite genes important for resistance to specific antimicrobial mediators. It also describes an approach to evaluate the specific macrophage antimicrobial mediators to which the parasite mutant is susceptible. Activation of infected macrophages can also promote parasite differentiation from the tachyzoite to bradyzoite stage that maintains chronic infection. Therefore, methodology is presented to evaluate the importance of the identified parasite gene to establishment of chronic infection.

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-&#947;-Dependent Cell Autonomous Immunity

Forward genetics is a powerful approach to identify genes in intracellular pathogens important for resistance to cell autonomous immunity. The current approach uses innate immune cells, specifically macrophages, to identify novel Toxoplasma gondii genes important for immune evasion.

앞으로 유전학 식별하는 대 식세포를 사용하여 화면<em&gt; 톡소 포자충</em&gt; 유전자 중요 저항이하는 IFN-γ 의존 세포 자치 내성

Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within ...

면역학 및 감염병학

Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. However, these screens are typically conducted in cells that are naturally permissive to the viral pathogen under study. Therefore, the robust replication of viruses in control conditions may limit the dynamic range of these screens. Furthermore, these screens may be unable to easily identify cellular defense pathways that restrict virus replication if the virus is well-adapted to the host and capable of countering antiviral defenses. In this article, we describe a new paradigm for exploring virus-host interactions through the use of screens that center on naturally abortive infections by arboviruses such as vesicular stomatitis virus (VSV). Despite the ability of VSV to replicate in a wide range of dipteran insect and mammalian hosts, VSV undergoes a post-entry, abortive infection in a variety of cell lines derived from lepidopteran insects, such as the gypsy moth (Lymantria dispar). However, these abortive VSV infections can be &#34;rescued&#34; when host cell antiviral defenses are compromised. We describe how VSV strains encoding convenient reporter genes and restrictive L. dispar cell lines can be paired to set-up screens to identify host factors involved in arbovirus restriction. Furthermore, we also show the utility of these screening tools in the identification of virally encoded factors that rescue VSV replication during coinfection or through ectopic expression, including those encoded by mammalian viruses. The natural restriction of VSV replication in L. dispar cells provides a high signal-to-noise ratio when screening for the conditions that promote VSV rescue, thus enabling the use of simplistic luminescence- and fluorescence-based assays to monitor the changes in VSV replication. These methodologies are valuable for understanding the interplay between host antiviral responses and viral immune evasion factors.

Here, we present the protocols to identify 1) virus-encoded immunomodulators that promote arbovirus replication and 2) eukaryotic host factors that restrict arbovirus replication. These fluorescence- and luminescence-based methods allow researchers to rapidly obtain quantitative readouts of arbovirus replication in simplistic assays with low signal-to-noise ratios.

Arbovirus 감염 바이러스 Immunomodulators 및 호스트 항 바이러스 요인의 식별을 위한 도구를 심사로

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. ...

유전자의 식별을위한 VIGS - 중재 앞으로 유전학 검사는 Nonhost 저항에 참여

요약

더 많은 비디오 탐색

이 비디오의 챕터

플랜트 병원체의 유전자 조작

약물 저항 유전자를 확인하기위한 QTL 매핑 및 CRISPR / Cas9 편집