Name: methylated rna immunoprecipitation assay to study m5c modification in arabidopsis
Uploaded: 2020-05-14T14:30:00.000+00:00
Duration: 8 min 50 s
Description: Watch this Scientific Journal Video about Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis at JoVE.com

עבודה זו נתמכה על ידי מלגת דוקטורט של IMPRS ל- E.S, מלגת EMBO לטווח ארוך לסמנכ"ל כספים, וקרנות פנימיות של MPI-MPP ל- F.K. חלק מעבודה זו מומנה גם באמצעות PLAMORF, פרויקט שקיבל מימון ממועצת המחקר האירופית (ERC) במסגרת תוכנית המחקר והחדשנות Horizon 2020 של האיחוד האירופי (הסכם מענק מס ' 810131). המחברים מבקשים להודות לפדריקו אפלט על הניתוח הביואינפורמטי וההערות על כתב היד, ומתיו בהין ואמירה קראמדי על הניתוח הביואינפורמטי.

1. הכנת ה- RNA
<ol><li>טוחנים 200 מ"ג של רקמת צמח לאבקה בחנקן נוזלי, ומוודאים שהרקמה נשארת קפואה לאורך כל ההליך.</li>
	<li>לחלץ את ה-RNA מרקמת הצמח הרצוי בעקבות חומצה guanidinium thiocyanate-פנול-כלורופורם פרוטוקול החילוץ. כדי להקטין את האפשרות לזהם RNA עם DNA במהלך הפרדת הפאזה, השתמש 1-ברומו-3-כלורופרופן במקום כלורופורם.<ol>
<li>הוסף 1 מ"ל של ריאגנט מיצוי RNA המכיל guanidine thiocyanate וחומצה פנול לרקמת הצמח טחון (500 μL לכל 100 רקמת מ"ג). מערבבים היטב על ידי היפוך ולוודא את כל הרקמה רטובה. דגירה במשך 10 דקות בטמפרטורת החדר כדי לנתק את מתחמי ריבונוקלאופרוטאין.</li>
		<li>צנטריפוגה במשך 10 דקות ב 12,000 x גרם ב 4 מעלות צלזיוס ולהעביר את supernatant לצינור חדש 1.5 מ"ל.</li>
		<li>הוסף 200 μL של 1 ברומו-3-כלורופרופן (100 μL לכל 500 μL RNA מיצוי מגיב) ומערבולת במרץ.</li>
		<li>צנטריפוגה במשך 15 דקות ב 12,000 x גרם ב 4 מעלות צלזיוס ולהעביר את השלב מימית העליונה (כ. 500 μL) לצינור חדש 1.5 מ"ל.</li>
		<li>הוסף 1 נפח של איזופרופנול (500 μL) ו 0.1 נפח של 3 M נתרן אצטט pH 5.5 (50 μL), לערבב היטב על ידי היפוך מזרז 10 דקות ב -20 מעלות צלזיוס. הערה: מומלץ להשתמש בנתרן אצטט (NaOAc) על מנת לשפר את המשקעים של ה-RNA. הפרוטוקול יכול להיות מושהה בשלב זה על ידי הארכת המשקעים של RNA במשך כמה שעות או אפילו לילה.</li>
		<li>צנטריפוגה במשך 30 דקות ב 12,000 x גרם ב 4 מעלות צלזיוס ולזרוק את supernatant.</li>
		<li>לשטוף את גלולה פעמיים עם 500 μL של 80% EtOH, צנטריפוגה במשך 5 דקות ב 12,000 x גרם ב 4 מעלות צלזיוס להשליך.</li>
		<li>לשטוף את גלולה פעם אחת עם 500 μL 99% EtOH, צנטריפוגה במשך 5 דקות ב 12,000 x g ב 4 מעלות צלזיוס להשליך.</li>
		<li>יבש את גלולה במשך 5-10 דקות להתמוסס ב 30 μL של RNase חינם H2O. הערה: במקום זאת, השתמש בכל פרוטוקול חילוץ RNA לבחירה (למשל, מערכת מבוססת עמודה). אם תקציר DNase כלול בפרוטוקול, דלג עליו בשלב הבא (שלב 1.3).</li>
	</ol></li>
	<li>למדוד את ריכוז RNA (למשל, עם השימוש בספקטרופוטומטר) ולעכל 20 מיקרוגרם של RNA עם DNase. הערה: הדנ"א עשירב-m 5C והנוגדן אינו מבחין בין דנ"א ל-RNA.<ol>
<li>בתגובת DNase טיפוסית, לטפל 10 מיקרוגרם של RNA בתגובה 50 μL. מערבבים את הרכיבים הבאים ומדגרים את התגובות ב-37°C למשך 30 דקות: 10 מיקרוגרם של RNA x μL מאגר DNase 10x 5 μL DNase 1 μL (2 יחידות) H2O ללא RNase עד 50 μL</li>
		<li>הסר את האנזים או על ידי הוספת נפח מתאים של מגיב איון DNase (אם הוא כלול בערכת DNase ועל פי הוראות היצרן) או על ידי ביצוע צעד ניקוי (למשל, טיהור עמודה או מיצוי פנול / כלורופורם).</li>
	</ol></li>
	<li>בדוק את האיכות והטוהר של RNA מבודד על ידי אלקטרופורזה נימי ולהמשיך אם מספר שלמות RNA (RIN) גבוה מ 7, כדי להבטיח את הדגימות הן באיכות טובה.</li>
	<li>אופציונלי: הסר את RNA ריבוזומלי כדי להעשיר את הדגימות בתוכן mRNA באמצעות ערכת הסרת rRNA ועל פי פרוטוקול היצרן.<ol>
<li>השתמש ב- DNase שטופלו ב- RNA מהשלב הקודם לתגובת דלדול rRNA. בצע תגובות מרובות אם כמות ה- RNA הכוללת היא יותר מהכמות המרבית המוצעת לתגובה.</li>
		<li>שים לב כי רק 5-10% מסכום הקלט יתאושש לאחר דלדול rRNA. המשך עם RNA מדולדל rRNA (כמות שווה עבור כל הדגימות) ולהתעלם הסכומים שהוזכרו בשלבים הבאים, כפי שהם מתייחסים RNA הכולל. הערה: להשוואה ותיאור של שיטות דלדול rRNA זמין ראה הפניות 38,39,40. rRNA הוא החלק העיקרי של RNA הכולל והוא m5C מתילציה באורגניזמים רבים.</li>
	</ol></li>
	<li>הכן מראש תעתיקי במבחנה (IVT) שישמשו כרצפי RNA של בקרה והוסף אותם בדגימות.<ol>
<li>לייצר שני IVTs נפרדים באמצעות ערכת שעתוק במבחנה, אחד עם נוקלאוזידים שאינם מתילציה ואחד שבו rCTP מוחלף על ידי 5-מתיל-rCTP, כדי לשמש פקדים שליליים וחיוביים MeRIP, בהתאמה. התמלילים שהוכנו היו אלה של EGFP ורניה לוציפראז. הערה: IVTs לא צריך להתקיים בתעתיק של האורגניזם שאתה מנתח. אם ה- IVTs הם מאותה תבנית (למשל, שניהם EGFP), הוסף את הפקד החיובי והשלילי בשתי דגימות שונות. אם הרצף שלהם שונה (למשל, EGFP ו- Renilla), ניתן להוסיף אותם לאותה דגימה.</li>
		<li>ספייק בכל מדגם 0.1 ng IVT לכל 3 מיקרוגרם של RNA, כפקדים.</li>
	</ol></li>
	<li>ל סוניק את ה-RNA לכ-100 nt שברים. הערה: התנאים לגזירה RNA חייב להיות מותאם מראש והם שונים עבור כל sonicator. עבור המודל המשמש כאן, sonication מבוצעת עם התנאים הבאים: כוח שיא 174, גורם חובה 10, מחזורים / פרץ 200, 17 דקות.<ol>
<li>Sonicate אותה כמות של RNA עבור כל הדגימות, לפחות 12 מיקרוגרם RNA לכל מדגם ב 80 μL של נפח כולל (מינימום 60 μL, מקסימום 100 μL), מלא RNase חינם H2O.</li>
	</ol></li>
	<li>אשר את היעילות של sonication ואת הריכוז של דגימות RNA על ידי אלקטרופורזה נימי. הגודל הממוצע של RNA מקוטע צריך להיות סביב 100 nt.</li>
</ol>2. מתילציה RNA אימונופרציפיטציה (MeRIP)
<ol><li>בצינורות בעלי כריכה נמוכה, הוסיפו 9 מיקרוגרם של RNA sonicated ו- RNase ללא H2O עד 60 μL (או יותר, בהתאם לריכוז).</li>
	<li>לנתק את המבנים המשניים על ידי חימום RNA ב 70 מעלות צלזיוס באמבט מים במשך 10 דקות וקירור במשך 10 דקות נוספות בתערובת מי קרח.</li>
	<li>לפצל את המדגם בשלושה חלקים: שליש (20 μL, אם 60 μL נלקחו בשלב 2.1) נשמר בצינור נפרד ב -80 מעלות צלזיוס כמדגם הקלט. מלא את 40 μL הנותרים עם RNase חינם H2O עד 860 μL ולאחר מכן לפצל שני צינורות מחייב נמוך: אחד עבור IP ואחד עבור שליטה מדומה (430 μL כל אחד).</li>
	<li>הוסף לשני הצינורות: 50 μL של מאגר MeRIP 10x 10 μL של מעכב RNase 10 μL של נוגדן α-m5C (10 מיקרוגרם) במדגם IP לכל 10 μL של H2O במדגם מדומה הערה: שיבוט הנוגדנים ששימש בעבר אינו זמין מסחרית יותר. עם זאת, כל נוגדן חד שבטי אנטי 5-מתילסיטוסין צריך לעבוד באופן דומה. נוגדנים יש לבדוק את הספציפיות לפני השימוש עבור MeRIP11,23.</li>
	<li>לאטום את הצינורות עם parafilm ודגרת במשך 12-14 שעות ב 4 מעלות צלזיוס, עם סיבוב תקורה.</li>
	<li>למחרת, להכין את החלבון G חרוזים מגנטיים עבור קשירה.<ol>
<li>עבור כל צינור (בקרת IP או Mock), השתמש 40 μL של חרוזים. הוסף את הכמות הכוללת של חרוזים (# של צינורות x 40 μL, לדוגמה, עבור 2 דגימות IP ו 2 דמה, 160 μL של חרוזים נדרשים) בצינור 15 מ"ל ולשטוף שלוש פעמים עם 800 μL של 1x מאגר MeRIP לכל מדגם (# של צינורות x 800 מאגר μL, למשל, 3.2 מ"ל עבור 2 IP ו 2 דגימות מדומה).</li>
		<li>בצע שטיפות בטמפרטורת החדר במשך 5 דקות עם סיבוב תקורה, לאסוף את החרוזים בעזרת מתלה מגנטי להשליך את מאגר הכביסה. לאחר הכביסה השלישית, resuspend את החרוזים באותו נפח של 1x מאגר MeRIP כמו נפח הראשוני של חרוזים נלקח (# של צינורות x 40 μL, למשל, 160 μL של 1x מאגר MeRIP עבור 2 IP ו 2 דגימות מדומה). הערה: כמות החלבון G חרוזים בשימוש נקבעת על ידי יכולת הכריכה של החרוזים עבור סוג הנוגדן הספציפי ואת כמות הנוגדן בשימוש. במקרה זה, החרוזים יש קיבולת מחייבת של כ. 8 מיקרוגרם של העכבר IgG לכל מ"ג של חרוזים ו 30 מ"ג / מ"ל ריכוז. לכן, 40 μL מספיקים כדי לאגד כ. 9.6 מיקרוגרם של נוגדן.</li>
	</ol>
</li>
	<li>הוסף 40 μL של חרוזים בשימוש חוזר לכל מדגם IP ו Mock ודגירה במשך 2 שעות נוספות ב 4 מעלות צלזיוס, עם סיבוב תקורה.</li>
	<li>מניחים את הצינורות על מתלה מגנטי במשך דקה ולזרוק את supernatant או לשמור אותו כפקד (מדגם RNA שאינו מאוגד).</li>
	<li>לשטוף את החרוזים 5 פעמים על ידי resuspending ב 700 μL של 1x מאגר MeRIP מסופק עם 0.01% Tween 20 ודגרת במשך 10 דקות בטמפרטורת החדר עם סיבוב תקורה.</li>
	<li>מוציאים מחדש את החרוזים שנשטפו ב-200 μL של מאגר עיכול Proteinase K ומוסיפים 3.5 μL של Proteinase K. דגירה למשך 3 שעות ב-50°C, רועדים במהירות של 800 סל"ד. מדי פעם, להעיף באופן ידני את החלק התחתון של הצינור אם משקע של חרוזים נוצר במהלך הדגירה.</li>
	<li>לחלץ את ה-RNA על ידי תוספת של 800 μL של מגיב מיצוי RNA בעקבות חומצה guanidinium thiocyanate-פנול-כלורופורם פרוטוקול החילוץ, ולהמשיך כמו בשלב 1.2. כדי להגביר את הראות של גלולת RNA, משקעים צבעוניים ניתן להוסיף isopropanol בשלב המשקעים. Resuspend גלולה ב 20 μL של RNase חינם H2O (או שווה נפח קלט נשמר בשלב 2.3).</li>
</ol>3. ניתוח במורד הזרם
<ol><li>שלח את דוגמאות הקלט וה- IP עבור רצף קצה יחיד עם אורך קריאה של 50 בסיסים (SE50).</li>
	<li>חותכים מתאמי קצה 3' באמצעות cutadapt41 ולזרוק קריאות כי הם קצרים מ 48 nt.</li>
	<li>מפה קצוצה קוראת לגנום Arabidopsis (ביאור TAIR10) באמצעות STAR42 עם ניתוק של 6% עבור אי התאמות וגודל אינטרון מקסימלי של 10 kb. שמור קריאות הממופות באופן ייחודי לצורך ניתוח נוסף.</li>
	<li>זהה שברי RNA מועשרים בדגימות IP בהשוואה לקלט באמצעות שתי שיטות נפרדות ושקול את אלה שנמצאו מועשרים באופן משמעותי על ידי שניהם.<ol>
<li>תחילה, זהה פסגות MeRIP-seq באמצעות MACS2 שיא המתקשר43 על IPs במאגר לעומת קלט.</li>
		<li>שנית, בצע את הניתוח עבור שיחות שיא MeRIP-seq כמתואר מאייר ואח'22 ויאנג ואח'17.<ol>
<li>באמצעות סקריפטים R מותאמים אישית, לחלק את הגנום בחלונות nt 25 nt ייחודי לספור את מספר קריאות ממופה באופן ייחודי עבור כל חלון בהתבסס על המיקום של נוקלאוטידים ממופה האחרון (מאז הקריאות מקורם 100 nt שברי RNA).</li>
			<li>חשב חלונות מועשרים באופן משמעותי בדגימות IP בהשוואה לקלט עם הבדיקה המדויקת של פישר.</li>
			<li>שמור על הפסגות המועשרות באופן משמעותי המשתרעות על פני שני חלונות רצופים לפחות ומשליכות פסגות המכסות חלון אחד בלבד.</li>
		</ol>
</li>
	</ol>
</li>
	<li>זהה אזורים מבוארים של הגנום (תעתיקים) עם פסגות מועשרות באופן משמעותי שנמצאו על ידי שתי השיטות.</li>
	<li>לחלופין או באופן משלים, בדוק יעדי RNA ספציפיים להעשרתם בדגימות ה- IP.<ol>
<li>הפוך לתמלל את RNA (אותו נפח של דגימות קלט, IP ו Mock) עם hexamers אקראי.</li>
		<li>בצע PCR כמותי בזמן אמת על המטרות שנבחרו, השוואת קלט, IP ו Mock באמצעות שיטת ΔΔCt. הערה: המוצר שנוצר לא צריך להיות ארוך יותר מ 100 bp, כמו זה הוא גודל הפיצול הממוצע.</li>
	</ol>
</li>
</ol>

המחברים אין ניגוד אינטרסים לחשוף.

RNA נושא יותר ממאה שינויים בסיסיים נפרדים4 היוצרים את האפיטראנפרנודום44. שינויים אלה מוסיפים שכבה נוספת של רגולציה של תרגום ואיתות (נבדק ב5,6,8,20,45,46). מחקרים מוקדמים הצליחו לזהות את נוכחותם של שינויים שלאחר שעתוק על RNA28,47 אבל RNAs שונה ספציפי צריך להיות מזוהה על מנת להבין את התפקיד של אפיטראנודיה. MeRIP תוכנן כשיטה למיפוי אתרי מתילציה RNA תעתיק רחב21,22. זה יכול להיות מותאם לכל שינוי, אם נוגדן ספציפי זמין.
החוזק העיקרי של פרוטוקול זה הוא פשוט יחסית, בטוח עבור RNA והמשתמש (למשל, 5-azaC הוא רעיל מאוד עבור צמחים ובני אדם) ואינו דורש רצף או שינוי מידע אנזים. יתר על כן, העשרת RNAs מתילציה על ידי ה-IP מגדילה את הסיכויים של mRNAs בשפע נמוך להתגלות, בניגוד רצף ביסולפיט שאינו מכיל צעד העשרה. כאשר מבוצעים שני סבבים סדרתיים של MeRIP, העשרה בקטעי RNA המכילים אתרי מתילציה עולה עוד22. אחת המגבלות של MeRIP, במיוחד כאשר מוחל על מחקרי מתילציה mRNA, היא כמות גבוהה של RNA הנדרש כקלט עבור התסמכת. ריבודפלציה – או poly(A) העשרה – צעד יקטין את הרקע שנגרם על ידי RNA ריבוזומלי שונה בכבדות אבל זה מסיר יותר מ 90% של RNA הכולל. DNA חייב גם להיות מוסר לחלוטין כפי שהוא עשיר 5-מתילציה ציטוזינות. חיסרון נוסף הוא הרזולוציה הנמוכה יותר של המיקום המדויק של מתילציה. Sonication של RNA לפני הדגירה עם הנוגדן מסייע לכיוון זה על ידי צמצום האזור המכיל את השינוי 100-200 נוקלאוטידים. כאשר MeRIP משולב עם רצף עמוק, הרזולוציה של חיזוי אתר m5C גדלה ככל שהרצף קורא ליצור התפלגות גאוסיאנית סביב אתר מתילציה פוטנציאלי. בנוסף, יש לאשר את הספציפיות של הנוגדן לפני ההסתעפות (למשל, עם מבחני כתמי נקודה RNA, המבוצעים עם אוליגוס מסונתז עם נוקלאוטידים מותאמים), עם זאת, עד כמה נוגדן יכול למעשה להבחין בין שינויים הקשורים קשר הדוק (למשל, m6A ו m6Am) הוא נקודת ויכוח בתחום48,49. יתר על כן, RNAs מובנה מאוד עלול להפריע האינטראקציה נוגדן אנטיגן, הגבלה נוספת כי הוא התייחס בעיקר עם פיצול דנטורציה של RNA לפני IP. להיפך, רצף ביסולפיט המושפע גם על ידי מבנים משניים, אינו כולל שלב פיצול וזו עשויה להיותסיבהאחת שגורמת לפער בין אתרי m 5 C לבין mRNAs החזויים על ידי רצף ביסולפיט16 ו MeRIP-seq11,17. שינויים אחרים ציטוצין (למשל, hm5C) הם גם עמידים deamination בתיווך ביסולפיט35.
שינויים של MeRIP-seq כוללים שלב הצלבה, או עם כניסתה של ריבונוקלאוסייד פוטואקטיבי (צילום-crosslinking בסיוע m6A-seq, PA-m6A-seq 50)או באמצעות אור UV כדי ליצור נוגדן-RNA crosslinks לאחר ה-IP (miCLIP49, שיטה שונה מאשר miCLIP המתואר במבוא30, אלא גם עם רזולוציה אינדיבידואלית-נוקליאוטיד). בעתיד, וכיוון שהידע על מתילציה של RNA מצטבר, גישות ממוקדות יותר עשויות להיות עדיפות, בהתבסס על האנזימים המשנים ו/או רצפי הקונצנזוס שבהם מופיע מתילציה. זיהוי חלבוני הקורא חיוני להבנת הפונקציה המולקולרית והאותתנית של שינויים שלאחר שעתוק. טכנולוגיית ריצוף Nanopore כבר מאפשר זיהוי ישיר של נוקלאוטידים שונה ללא טיפול מוקדם של RNA17 אבל עדיין יש מקום לשיפור בתחום זה לגבי עומק רצף וניתוח ביואינפורמטי. בסך הכל, MeRIP-seq היא כיום גישה מבוססת, אמינה ובלתי משוחדת לזיהוי תעתיקי RNA מתילציה.

An erratum was issued for:&#160;<a href="https://jove.unicartagenaproxy.elogim.com/t/61231">Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis</a>. The author list was updated.
The author list was updated from:
Eleftheria Saplaoura1, Valentina Perrera2, Friedrich Kragler1 
1Max Planck Institute of Molecular Plant Physiology 
2Department of Molecular Medicine, Medical School, University of Padua
to:
Eleftheria Saplaoura1, Valentina Perrera2, Vincent Colot3, Friedrich Kragler1 
1Max Planck Institute of Molecular Plant Physiology 
2Department of Molecular Medicine, Medical School, University of Padua 
3Biologie de l&#39;Ecole Normale Sup&#233;rieure (IBENS),&#160;Paris, France

An erratum was issued for:&#160;<a href="https://jove.unicartagenaproxy.elogim.com/t/61231">Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis</a>. The author list was updated.

Erratum: Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

בכל שלוש ממלכות החיים, מיני RNA עוברים שינויים פוסט-שעתוק ומחקר על שינויים ביוכימיים רלוונטיים מבחינה תפקודית אלה נקרא "אפיטרנקריפטומיקה". אפיטראנודומיקה היא תחום גדל ושיטות שונות מפותחות כדי ללמוד ולמפות את השינויים על מולקולות RNA (נבדק ב1,2). יותר ממאה שינויים RNA נמצאו, זוהו rRNAs, tRNAs, ncRNAs אחרים, כמו גם mRNAs3,4. למרות הנוכחות והתפקוד של שינויים פוסט שעתוק מגוונים מבחינה כימית tRNAs ו rRNAs נחקרים בהרחבה5,6,7,8, רק לאחרונה יש שינויים mRNA התאפיינו. בצמחים זוהו עד כה שינויים רבים ב- mRNA, כולל m7G במבנה הכובע9, m1A10,hm 5C11,12, ו uridylation13. עם זאת, רק m6A10,14,15, m5C11,16,17, ו פסאודורידין18 מופו תעתיק רחב ערבידופסיס. שינויים בבסיס mRNA לאחר שעתוק מעורבים במספר תהליכים התפתחותיים19,20.
אחת הגישות הנפוצות ביותר באפיטראנודומיקה היא האימונופרציפיטציה המתילציה של RNA בשילוב עם רצף עמוק (MeRIP-seq). MeRIP-seq פותחה בשנת 2012 כדי לחקור m6A בתאי יונקים21,22. זה דורש שימוש בנוגדן לשינוי הרצוי ומטרתו להעשיר עבור שברי RNA הנושאים את הנוקלאוטידים ששונו. זה בדרך כלל ואחריו רצף עמוק כדי לזהות ולמפות את שברים מועשרים או PCR כמותי כדי לאמת מטרות RNA ספציפיות. הדיוק של MeRIP מבוסס על הספציפיות של הנוגדן לזהות את הנוקלאוטידים ששונו על פני שינויים דומים (למשל, מ'5C ו hm5C11,23). מלבד m6A, MeRIP-seq הוחל גם ללמוד m1A ו m5C RNA מתילציה בכמה אורגניזמים11,17,23,24,25.
מתילציה של ציטוצין בתנוחת הפחמן החמישית (m5C) היא שינוי הדנ"א השכיח ביותר26,27 ואחד השינויים הנפוצים ביותר RNA מדי3,4. בעוד m5C זוהה ב mRNAs eukaryotic בשנת 197528, רק לאחרונה יש מחקרים התמקדו במיפוי תעתיק השינוי רחב, קידוד ולא קידוד RNAs11,16,17,23,29,30,31,32,33,34.
שיטות חלופיות המשמשות במחקר m5C RNA כוללות המרה כימית של ציטוסינים לא מתילציה לתוך uracils (רצף ביסולפיט) ו immunoprecipitation assays מבוסס על כריכה בלתי הפיכה של ציטוסין RNA ידוע מתילטרנספראז למטרות RNA שלה (miCLIP, aza-IP). בקצרה, רצף ביסולפיט מנצל את התכונה של ציטוצין 5-מתילציה להיות עמיד לטיפול דו-סולפיט נתרן כי deaminates ציטוסינים ללא שינוי כדי uracil. השיטה פותחה לראשונה עבור DNA אך הותאמה גם עבור RNA ומחקרים רבים בחרו בגישה זו כדי לזהות m5C אתרים RNA16,23,29,32,34,35. הן miCLIP והן aza-IP דורשים ידע קודם של RNA ציטוסין מתילטרנספראז ושימוש בנוגדן בהתאמה. במקרה של miCLIP (מתילציה אישית-נוקלאוטידים ברזולוציה הצלבה ו immunoprecipitation), מתיל טרנספראז נושאת מוטציה אחת חומצת אמינו, כך שהוא נקשר למצע RNA אבל לא ניתן לשחרר30. ב aza-IP (5-azacytidine-בתיווך RNA immunoprecipitation), הכריכה הבלתי הפיכה נוצרת בין נוקלאוזיד 5-azaC לבין RNA ציטוצין מתילטרנספראז כאשר מסופק אקסוגני 5-azaC משולב על ידי פולימראזים RNA לתוך מולקולת RNA היעד31.
היתרון העיקרי של שלוש שיטות אלה הוא שהם מאפשרים מיפוי רזולוציה נוקלאוטידים יחיד של m5C. בנוסף, miCLIP ו- aza-IP מספקים מידע על המטרות הספציפיות של RNA נבחר ציטוסין מתילטרנספראז, פענוח עמוק יותר את המנגנון והתפקיד של שינויים RNA שלאחר שעתוק. עם זאת, הגישה MeRIP-seq יכול לזהות תמלול רחב m5C אזורים ללא כל ידע קודם נדרש ומונע תנאים כימיים וטמפרטורה קשים, כגון טיפול ביסולפיט או דגירה עם 5-azaC. ניתן לעכב הן את מריפט והן את רצף הביסולפיט על ידי מבני RNA משניים36. שלב הפיצול הכלול במבחן MeRIP לפני immunoprecipitation נועד להקל על מחייב נוגדנים ולהגדיל את הרזולוציה של זיהוי m5C.
שיטה נוספת שראוי להזכיר היא ספקטרומטריית מסה (MS) של גרעיני RNA. טרשת נפוצה יכולה לזהות ולהבחין בכל סוג של שינוי הן בדנ"א והן ב- RNA. בקצרה, RNA מופק DNase מתעכל, אז התפלה מתעכל נוקלאוזידים בודדים. נוקלאוזידים RNA מנותחים על ידי ספקטרומטר מסה. שיטה זו יכולה לשמש לכימות הרמות של כל שינוי והיא אינה מסתמכת על נוגדן או המרה כימית. עם זאת, חיסרון גדול הוא שהוא מספק מידע בתפזורת על נוכחות של שינויים RNA. על מנת למפות את השינויים, טרשת נפוצה צריכה להיות משולבת עם עיכול RNase ומידע רצף על מולקולות RNA ספציפיות, כמו במקרה של tRNAלאואנושי(CAA)37.
כאן, אנו מתארים ומשוחחים על מבחני MeRIP כפי שרגילים ללמוד m5C RNA מתילציה ב Arabidopsis17.

<table><tbody><tr><td>anti-m&lt;sup&gt;5&lt;/sup&gt;C antibody</td><td>ZymoResearch</td><td>A3001 (discontinued), A3002 available</td><td>Clone 10G4 (discontinued), 7D21 available</td></tr><tr><td>Chip and reagents for capillary electrophoresis</td><td>Agilent</td><td>5067-1511</td><td>RNA 6000 Nano kit</td></tr><tr><td>Dnase</td><td>Ambion</td><td>AM1907</td><td>TURBO DNA-free kit</td></tr><tr><td>Co-precipitant of nucleic acids</td><td>Ambion</td><td>AM9515</td><td>Glycoblue, 15 mg/mL</td></tr><tr><td>&lt;em&gt;In vitro&lt;/em&gt; transcription kit</td><td>Promega</td><td>P1300</td><td>T7 RiboMAX Large Scale RNA Production System</td></tr><tr><td>Low-binding reaction tubes</td><td>Kisker Biotech</td><td>G017</td><td>1.7 ml microcentrifuge tubes</td></tr><tr><td>Protein G magnetic beads</td><td>Invitrogen</td><td>10003D</td><td>Dynabeads Protein G</td></tr><tr><td>Proteinase K</td><td>Ambion</td><td>AM2546</td><td>20mg/mL stock solution, RNA grade</td></tr><tr><td>RNase inhibitor</td><td>Promega</td><td>N2615</td><td>RNasin Plus 40 U/&amp;mu;l</td></tr><tr><td>rRNA removal kit</td><td>Epicentre</td><td>RZPL11016</td><td>Ribo-Zero rRNA removal kit (Plant leaf)</td></tr><tr><td>Sonication tubes</td><td>Covaris</td><td>520045</td><td>microtube AFA Fiber Pre-Slit Snap-Cap 6x16mm</td></tr><tr><td>RNA extraction reagent</td><td>Ambion</td><td>15596018</td><td>TRIzol reagent</td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Capillary electrophoresis machine</td><td>Agilent</td><td>G2939BA</td><td>2100 Bioanalyzer System</td></tr><tr><td>Magnetic rack</td><td>Invitrogen</td><td>12321D</td><td>DynaMag-2</td></tr><tr><td>Microcentrifuge</td><td>Eppendorf</td><td>discontinued</td><td>5417R model</td></tr><tr><td>Rotator</td><td>Benchmark</td><td>R4040</td><td>RotoBot Mini</td></tr><tr><td>Sonicator</td><td>Covaris</td><td>500217</td><td>S220 Focused-ultrasonicator</td></tr><tr><td>Spectrophotometer</td><td>ThermoFisher Scientific</td><td>ND-ONEC-W</td><td>NanoDrop OneC</td></tr><tr><td>Waterbath</td><td>GFL</td><td>1012</td><td>1012 Incubation bath</td></tr></tbody></table>

methylated rna immunoprecipitation assay to study m5c modification in arabidopsis

שינויים משניים בבסיס על RNA, כגון m5C, משפיעים על המבנה והתפקוד של מולקולות ה- RNA ששונו. מתילציה RNA אימונואוציאציה רצף (MeRIP-seq) היא שיטה שמטרתה להעשיר עבור RNA מתילציה ובסופו של דבר לזהות תעתיקים שונה. בקצרה, RNA sonicated הוא דגירה עם נוגדן עבור 5-מתילציה ציטוזינות, זירז בסיוע חרוזי חלבון G. לאחר מכן, הקטעים המועשרים רצפים ואתרי המתילציה הפוטנציאליים ממופים על סמך התפלגות הקריאות וזיהוי השיא. MeRIP יכול להיות מיושם על כל אורגניזם, כפי שהוא אינו דורש כל רצף קודם או שינוי ידע אנזים. בנוסף, מלבד פיצול, RNA אינו נתון לכל טיפול כימי או טמפרטורה אחר. עם זאת, MeRIP-seq אינו מספק חיזוי חד-נוקלאוטידים של אתר המתילציה כפי שעושות שיטות אחרות, אם כי ניתן לצמצם את האזור המתילציה לכמה נוקלאוטידים. השימוש בנוגדנים ספציפיים לשינויים שונים מאפשר ל- MeRIP להיות מותאם לשינויי הבסיס השונים הקיימים ב- RNA, ולהרחיב את היישומים האפשריים של שיטה זו.

סכמטי של השיטה מסופק באיור 1. השלבים הקריטיים הראשונים של הפרוטוקול הם להשיג RNA באיכות טובה (RIN ≥ 7) ולהסתנן אותו כ 100 nt שברים. היעילות של שני השלבים נבחנת על ידי מכונת אלקטרופורזה נימי מבוסס שבב. באיור 2Aמוצגת הפעלה מייצגת של דגימת RNA טובה. המדגם מדולל 1:10 לפני טעינה על השבב על מנת לקבל ריכוז כי הוא בטווח של זיהוי של הערכה בשימוש (5-500 ng/μL). אותה דגימה מופעלת גם לאחר sonication ומוצגת באיור 2B. שים לב שנוכחותו של פסגה אחידה אחת עברה משמאל לדיאגרמה, בגודל של כ-100 נוקלאוטידים. הריכוז הנמוך נגרם הן על ידי אובדן RNA במהלך הפיצול, אלא גם בגלל נפח מוגבר של הדגימות (60-100 μL, שלב 1.7.1).
ניתן להעריך את איכות דגימות ה- IP וה- Mock על-ידי qRT-PCR. לשם כך, IVTs זינק לשמש פקדים חיוביים ושליליים: IVT מתילציה, שבו בכל תנוחות ציטוצין יש m5C, צפוי להיות מועשר מאוד במדגם ה-IP; להיפך, IVT שאינו מתילציה לא צריך להיות הבדל בין IP ו Mock. הפריימריז המשמשים ב- qRT-PCR לבדיקת שני ה- IVTs של הפקד(EGFP ורנילה לוציפראז) מפורטים בטבלה 1. ואכן, כפי שמוצג באיור 3, כ-80% מה-IVT המתילציה נמצאו במדגם ה-IP, ורק כ-2% ב-Mock. עבור פקד שאינו מתילציה, ההתאוששות הייתה מתחת 1% הן דגימות IP ו Mock. זה מאמת את היעילות של MeRIP כי שברי RNA מתילציה היו זירז מועשר, והוא אינדיקטור טוב כי הדגימות ניתן להשתמש לניתוח במורד הזרם. בנוסף, העשרת הקיפול של IVT שאינו מתילציה (יחס IP ל- Mock) ניתן להחיל כסף להערכת המשמעות של העשרה ב- qRT-PCR מבחנים.
לאחר יישור הקריאות לגנום (איור 4), אלגוריתמי הקריאה הגבוהים המתוארים בשלבים 3.4.1 ו- 3.4.2 מוחלים כדי לזהות את החלונות המשמעותיים סטטיסטית, המועשרים בדגימות ה- IP בהשוואה לקלט. ניתן להשתמש ברצפים התואמים לחלונות אלה עוד יותר, לדוגמה כדי לחפש מוטיבים שמורים הקשורים למתילציה11,17.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/61231/61231fig01.jpg"> איור 1: ייצוג סכמטי של פרוטוקול MeRIP-seq. דגימות RNA הם דגירה עם נוגדן עבור 5-מתילציה ציטוזינות ואת המתחמים נמשכים למטה עם חלבון G חרוזים מגנטיים הלוכדים את הנוגדנים יחד עם RNA קשור. דגימות RNA eluted מנותחים על ידי רצף עמוק qRT-PCR. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/61231/61231fig01large.jpg" target="_blank">לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/61231/61231fig02.jpg"> איור 2: תוצאות מייצגות מניתוח איכות של דגימות RNA. (A) פרופיל מייצג של מדגם מפעל RNA כולל מוסמך. (B) פרופיל מייצג של דגימת RNA לאחר sonication ל 100 nt שברים. קבצי פלט מתוכנת אלקטרופורזה נימי. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/61231/61231fig02large.jpg" target="_blank">לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/61231/61231fig03.jpg"> איור 3: ניתוח qRT-PCR של IVTs בקרה. תעתיקים מתילציה ולא מתילציה במבחנה שימשו כפקדים חיוביים ושליליים של מבחני MeRIP, בהתאמה. לאחר immunoprecipitation, IVT מתילציה מועשר מאוד מדגם IP (ירוק) אבל לא במדגם מדומה (ללא נוגדן אנטי מ'5C; סגול). IVT שאינו מתילציה לא הראה שום העשרה ואין הבדל בין IP ו Mock. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/61231/61231fig03large.jpg" target="_blank">לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/61231/61231fig04.jpg"> איור 4: קרא יישור לפני ואחרי MeRIP סביב תעתיק מייצג. קריאות מיושרות לתעתיק ספציפי בדוגמת הקלט (השורה העליונה) ובשני משכפלי IP (שורה אמצעית ותחתונה). הקופסה השחורה מציגה חלון ארוך מועשר מזוהה של 50 nt המבוסס על MACS243 וניתוחי שיחות שיא של MeRIP-seq22. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/61231/61231fig04large.jpg" target="_blank">לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>היעד</td>
			<td colspan="2">זוג פריימרים</td>
			<td colspan="2">רצף מוצרים</td>
			<td>אורך מוצר</td>
		</tr>
<tr>
<td rowspan="2">EGFP (EGFP)</td>
			<td colspan="2">עבור: 5 '- GGCAACTACAAGACCCGCC -3'</td>
			<td colspan="2" rowspan="2">GGקאקטאקאקאגאגג'יג'יגה-ג'אג GTGAAGTTCGGGCGACCCTG GTGAACCGקטגקטגאגאגג'ק</td>
			<td rowspan="2">72 סיביות לשנייה</td>
		</tr>
<tr>
<td colspan="2">Rev: 5'- GCCCTTCTCCTCGATGCGGTT -3'</td>
		</tr>
<tr>
<td rowspan="2">רנילה לוציפראז</td>
			<td colspan="2">עבור: 5'- GGAGAATAACTTCCGTGGAAAC -3'</td>
			<td colspan="2" rowspan="2">GGאגאטקטקטקטג'יגטגאגא3 אטגטגקאקאקאאאאטקטגה אגטגאקאקאגאגאטגג'ק</td>
			<td rowspan="2">75 סיביות לשנייה</td>
		</tr>
<tr>
<td colspan="2">Rev: 5'- GCTGCAACTCTTCTCTCTCTAA -3'</td>
		</tr>
</tbody></table>טבלה 1: מידע על פריימרים ומוצרים שנוצרו עבור ניתוח qRT-PCR.
חיץ מתכונים. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/61231/Buffer%20Recipes%20MeRIP.xlsx" target="_blank">אנא לחץ כאן כדי להוריד קובץ זה.</a>

Watch this Scientific Journal Video about Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis at JoVE.com

Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

מבחני האימונו-פסיכוטיציה של ה-RNA המתילציה הם שיטה מבוססת נוגדנים המשמשת להעשרה עבור שברי RNA מתילציה. יחד עם רצף עמוק, זה מוביל לזיהוי של תעתיקים הנושאים את שינוי m5C.

מתילציה RNA אימונואוציאציה Assay ללמוד m5C שינוי ערבידופסיס

Secondary base modifications on RNA, such as m5C, affect the structure and function of the modified RNA molecules. Methylated RNA Immunoprecipitation and ...

methylated-rna-immunoprecipitation-assay-to-study-m5c-modification

Universidad de Cartagena UDEC

Research

JoVE Journal

Genetics

Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

6.5K Views.  Max Planck Institute of Molecular Plant Physiology. מבחני האימונו-פסיכוטיציה של ה-RNA המתילציה הם שיטה מבוססת נוגדנים המשמשת להעשרה עבור שברי RNA מתילציה. יחד עם רצף עמוק, זה מוביל לזיהוי של תעתיקים הנושאים את שינוי m5C.

Video: Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

A Method for Measuring RNA N6-methyladenosine Modifications in Cells and Tissues

N6-Methyladenosine (m6A) modifications of RNA are diverse and ubiquitous amongst eukaryotes. They occur in mRNA, rRNA, tRNA, and microRNA. Recent studies have revealed that these reversible RNA modifications affect RNA splicing, translation, degradation, and localization. Multiple physiological processes, like circadian rhythms, stem cell pluripotency, fibrosis, triglyceride metabolism, and obesity are also controlled by m6A modifications. Immunoprecipitation/sequencing, mass spectrometry, and modified northern blotting are some of the methods commonly employed to measure m6A modifications. Herein, we present a northeastern blotting technique for measuring m6A modifications. The current protocol provides good size separation of RNA, better accommodation and standardization for various experimental designs, and clear delineation of m6A modifications in various sources of RNA. While m6A modifications are known to have a crucial impact on human physiology relating to circadian rhythms and obesity, their roles in other (patho)physiological states are unclear. Therefore, investigations on m6A modifications have immense possibility to provide key insights into molecular physiology.

A Method for Measuring RNA N6-methyladenosine Modifications in Cells and Tissues

A modified northern blotting method for measuring N6-methyladenosine (m6A) modifications in RNA is described. The current method can detect modifications in diverse RNAs and controls under various experimental designs.

שיטה למדידת RNA<em&gt; N</em<sup&gt; 6</sup&gt; שינויי -methyladenosine ב תאים ורקמות

N6-Methyladenosine (m6A) modifications of RNA are diverse and ubiquitous amongst eukaryotes. They occur in mRNA, rRNA, tRNA, and microRNA. Recent studies ...

Biochemistry

Immunostaining for DNA Modifications: Computational Analysis of Confocal Images

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of enzymatic oxidation of 5mC to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) as well as detection of N6-methyladenine (6mA) in the DNA of multicellular organisms provided additional degrees of complexity to the epigenetic research. According to a growing body of experimental evidence, these novel DNA modifications may play specific roles in different cellular and developmental processes. Importantly, as some of these marks (e. g. 5hmC, 5fC and 5caC) exhibit tissue- and developmental stage-specific occurrence in vertebrates, immunochemistry represents an important tool allowing assessment of spatial distribution of DNA modifications in different biological contexts. Here the methods for computational analysis of DNA modifications visualized by immunostaining followed by confocal microscopy are described. Specifically, the generation of 2.5 dimension (2.5D) signal intensity plots, signal intensity profiles, quantification of staining intensity in multiple cells and determination of signal colocalization coefficients are shown. Collectively, these techniques may be operational in evaluating the levels and localization of these DNA modifications in the nucleus, contributing to elucidating their biological roles in metazoans.

Newly discovered oxidized forms of 5-methylcytosine (oxi-mCs), 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) may represent distinct DNA modifications with unique functional roles. Here a semi-quantitative workflow for visualization of oxi-mCs' spatial distribution, signal intensity profiling and colocalization is described.

Immunostaining עבור שינויים DNA: ניתוח חישובית של תמונות קונפוקלי

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of ...

An In Vitro Assay to Detect tRNA-Isopentenyl Transferase Activity

N6-isopentenyladenosine RNA modifications are functionally diverse and highly conserved among prokaryotes and eukaryotes. One of the most highly conserved N6-isopentenyladenosine modifications occurs at the A37 position in a subset of tRNAs. This modification improves translation efficiency and fidelity by increasing the affinity of the tRNA for the ribosome. Mutation of enzymes responsible for this modification in eukaryotes are associated with several disease states, including mitochondrial dysfunction and cancer. Therefore, understanding the substrate specificity and biochemical activities of these enzymes is important for understanding of normal and pathologic eukaryotic biology. A diverse array of methods has been employed to characterize i6A modifications. Herein is described a direct approach for the detection of isopentenylation by Mod5. This method utilizes incubation of RNAs with a recombinant isopentenyl transferase, followed by RNase T1 digestion, and 1-dimensional gel electrophoresis analysis to detect i6A modifications. In addition, the potential adaptability of this protocol to characterize other RNA-modifying enzymes is discussed.

An In Vitro Assay to Detect tRNA-Isopentenyl Transferase Activity

Here, we describe a protocol for the biochemical characterization of the yeast RNA-modifying enzyme, Mod5, and discuss how this protocol could be applied to other RNA-modifying enzymes.

Assay ב Vitro לגילוי פעילות טרנספראז tRNA-Isopentenyl

N6-isopentenyladenosine RNA modifications are functionally diverse and highly conserved among prokaryotes and eukaryotes. One of the most highly conserved ...

Antibody-Free Assay for RNA Methyltransferase Activity Analysis

There are more than 100 chemically distinct modifications of RNA, two thirds of which consist of methylations. Interest in RNA modifications, and especially methylations, has re-emerged due to the important roles played by the enzymes that write and erase them in biological processes relevant to disease and cancer. Here, a sensitive in vitro assay for accurate analysis of RNA methylation writer activity on synthetic or in vitro transcribed RNAs is provided. This assay uses a tritiated form of S-adenosyl-methionine, resulting in direct labeling of methylated RNA with tritium. The low energy of tritium radiation makes the method safe, and pre-existing methods of tritium signal amplification, make it possible to quantify and to visualize the methylated RNA without the use of antibodies, which are commonly prone to artifacts. While this method is written for RNA methylation, few tweaks make it applicable to the study of other RNA modifications that can be radioactively labeled, such as RNA acetylation with 14C acetyl coenzyme A. Overall, this assay allows to quickly assess RNA methylation conditions, inhibition with small molecule inhibitors, or the effect of RNA or enzyme mutants, and provides a powerful tool to validate and expand results obtained in cells.

Here, an antibody-free in vitro assay for direct analysis of methyltransferase activity on synthetic or in vitro transcribed RNA is described.

טיפול ללא נוגדנים עבור RNA מתילטרנספראז ניתוח פעילות

There are more than 100 chemically distinct modifications of RNA, two thirds of which consist of methylations. Interest in RNA modifications, and ...

Immunohistochemical Detection of 5-Methylcytosine and 5-Hydroxymethylcytosine in Developing and Postmitotic Mouse Retina

The epigenetics of retinal development is a well-studied research field, which promises to bring a new level of understanding about the mechanisms of a variety of human retinal degenerative diseases and pinpoint new treatment approaches. The nuclear architecture of mouse retina is organized in two different patterns: conventional and inverted. Conventional pattern is universal where heterochromatin is localized to the periphery of the nucleus, while active euchromatin resides in the nuclear interior. In contrast, inverted nuclear pattern is unique to the adult rod photoreceptor cell nuclei where heterochromatin localizes to the nuclear center, and euchromatin resides in the nuclear periphery. DNA methylation is predominantly observed in chromocenters. DNA methylation is a dynamic covalent modification on the cytosine residues (5-methylcytosine, 5mC) of CpG dinucleotides that are enriched in the promoter regions of many genes. Three DNA methyltransferases (DNMT1, DNMT3A and DNMT3B) participate in methylation of DNA during development. Detecting 5mC with immunohistochemical techniques is very challenging, contributing to variability in results, as all DNA bases including 5mC modified bases are hidden within the double-stranded DNA helix. However, detailed delineation of 5mC distribution during development is very informative. Here, we describe a reproducible technique for robust immunohistochemical detection of 5mC and another epigenetic DNA marker 5-hydroxymethylcytosine (5hmC), which colocalizes with the &#34;open&#34;, transcriptionally active chromatin in developing and postmitotic mouse retina.

The objective of this report is to describe the protocol for robust immunohistochemical detection of epigenetic markers, 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC) in developing and postmitotic mouse retina.

Immunohistochemical זיהוי של 5-Methylcytosine, 5-Hydroxymethylcytosine בפיתוח ואת הרשתית העכבר Postmitotic

The epigenetics of retinal development is a well-studied research field, which promises to bring a new level of understanding about the mechanisms of a ...

Developmental Biology

Characterizing RNA Modifications in Single Neurons Using Mass Spectrometry

Post-transcriptional modifications (PTMs) of RNA represent an understudied mechanism involved in the regulation of translation in the central nervous system (CNS). Recent evidence has linked specific neuronal RNA modifications to learning and memory paradigms. Unfortunately, conventional methods for the detection of these epitranscriptomic features are only capable of characterizing highly abundant RNA modifications in bulk tissues, precluding the assessment of unique PTM profiles that may exist for individual neurons within the activated behavioral circuits. In this protocol, an approach is described&#8212;single-neuron RNA modification analysis by mass spectrometry (SNRMA-MS)&#8212;to simultaneously detect and quantify numerous modified ribonucleosides in single neurons. The approach is validated using individual neurons of the marine mollusk, Aplysia californica, beginning with surgical isolation and enzymatic treatment of major CNS ganglia to expose neuron cell bodies, followed by manual single-neuron isolation using sharp needles and a micropipette. Next, mechanical and thermal treatment of the sample in a small volume of buffer is done to liberate RNA from an individual cell for subsequent RNA digestion. Modified nucleosides are then identified and quantified using an optimized liquid chromatography-mass spectrometry method. SNRMA-MS is employed to establish RNA modification patterns for single, identified neurons from A. californica that have known morphologies and functions. Examples of qualitative and quantitative SNRMA-MS are presented that highlight the heterogeneous distribution of RNA modifications across individual neurons in neuronal networks.

Post-transcriptional modifications of RNA represent an understudied layer of translation regulation that has recently been linked to central nervous system plasticity. Here, sample preparation and liquid chromatography-tandem mass spectrometry approach is described for simultaneous characterization of numerous RNA modifications in single neurons.

אפיון שינויי RNA בתאי עצב בודדים באמצעות ספקטרומטריית מסה

Post-transcriptional modifications (PTMs) of RNA represent an understudied mechanism involved in the regulation of translation in the central nervous ...

Chemistry

Determination of DNA Methylation of Imprinted Genes in Arabidopsis Endosperm

Arabidopsis thaliana is an excellent model organism for studying epigenetic mechanisms. One of the reasons is the loss-of-function null mutant of DNA methyltransferases is viable, thus providing a system to study how loss of DNA methylation in a genome affects growth and development. Imprinting refers to differential expression of maternal and paternal alleles and plays an important role in reproduction development in both mammal and plants. DNA methylation is critical for determining whether the maternal or paternal alleles of an imprinted gene is expressed or silenced. In flowering plants, there is a double fertilization event in reproduction: one sperm cell fertilizes the egg cell to form embryo and a second sperm fuses with the central cell to give rise to endosperm. Endosperm is the tissue where imprinting occurs in plants. MEDEA, a SET domain Polycomb group gene, and FWA, a transcription factor regulating flowering, are the first two genes shown to be imprinted in endosperm and their expression is controlled by DNA methylation and demethylation in plants. In order to determine imprinting status of a gene and methylation pattern in endosperm, we need to be able to isolate endosperm first. Since seed is tiny in Arabidopsis, it remains challenging to isolate Arabidopsis endosperm and examine its methylation. In this video protocol, we report how to conduct a genetic cross, to isolate endosperm tissue from seeds, and to determine the methylation status by bisulfite sequencing.

Determination of DNA Methylation of Imprinted Genes in Arabidopsis Endosperm

Imprinting is a phenomenon in plant and mammal reproduction. DNA methylation plays an important role in mechanisms of imprinting. Isolating endosperm and determining methylation status of imprinted genes in Arabidopsis can be difficult. In this protocol, we describe how to isolate endosperm and determine methylation by bisulfite sequencing.

קביעת מתילציה DNA של גנים מוטבעים ארבידופסיס האנדוספרם

Arabidopsis thaliana is an excellent model organism for studying epigenetic mechanisms. One of the reasons is the loss-of-function null mutant of DNA ...

Biology

Detection of Histone Modifications in Plant Leaves

Chromatin structure is important for the regulation of gene expression in eukaryotes. In this process, chromatin remodeling, DNA methylation, and covalent modifications on the amino-terminal tails of histones H3 and H4 play essential roles1-2. H3 and H4 histone modifications include methylation of lysine and arginine, acetylation of lysine, and phosphorylation of serine residues1-2. These modifications are associated either with gene activation, repression, or a primed state of gene that supports more rapid and robust activation of expression after perception of appropriate signals (microbe-associated molecular patterns, light, hormones, etc.)3-7. 
Here, we present a method for the reliable and sensitive detection of specific chromatin modifications on selected plant genes. The technique is based on the crosslinking of (modified) histones and DNA with formaldehyde8,9, extraction and sonication of chromatin, chromatin immunoprecipitation (ChIP) with modification-specific antibodies9,10, de-crosslinking of histone-DNA complexes, and gene-specific real-time quantitative PCR. The approach has proven useful for detecting specific histone modifications associated with C4 photosynthesis in maize5,11 and systemic immunity in Arabidopsis3.

A reliable and useful approach to detect histone modifications on specific plant genes is described. The approach combines chromatin immunoprecipitation (ChIP) and real-time quantitative PCR. It allows detection of histone modifications on specific genes with a role in diverse physiological processes.

זיהוי של שינויים היסטון בעלים הצמח

Chromatin structure is important for the regulation of gene expression in eukaryotes. In this process, chromatin remodeling, DNA methylation, and covalent ...

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and silencing of genes mediate the response of plants to environmental signals and developmental cues. Therefore, insights into the mechanisms that control plant gene expression are essential to gain a deep understanding of how biological processes are regulated in plants. The chromatin immunoprecipitation (ChIP) technique described here is a procedure to identify the DNA-binding sites of proteins in genes or genomic regions of the model species Arabidopsis thaliana. The interactions with DNA of proteins of interest such as transcription factors, chromatin proteins or posttranslationally modified versions of histones can be efficiently analyzed with the ChIP protocol. This method is based on the fixation of protein-DNA interactions in vivo, random fragmentation of chromatin, immunoprecipitation of protein-DNA complexes with specific antibodies, and quantification of the DNA associated with the protein of interest by PCR techniques. The use of this methodology in Arabidopsis has contributed significantly to unveil transcriptional regulatory mechanisms that control a variety of plant biological processes. This approach allowed the identification of the binding sites of the Arabidopsis chromatin protein EBS to regulatory regions of the master gene of flowering FT. The impact of this protein in the accumulation of particular histone marks in the genomic region of FT was also revealed through ChIP analysis.

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Chromatin immunoprecipitation is a powerful technique for the identification of DNA binding sites of Arabidopsis proteins in vivo. This procedure includes chromatin cross-linking and fragmentation, immunoprecipitation with selective antibodies against the protein of interest, and qPCR analysis of bound DNA. We describe a simple ChIP assay optimized for Arabidopsis plants.

הכרומטין immunoprecipitation Assay עבור זיהוי של אינטראקציות החלבון-דנ&quot;א ארבידופסיס<em&gt; In vivo</em

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and ...

Exploring m6A and m5C Epitranscriptomes upon Viral Infection: an Example with HIV

The role of RNA modifications in biological processes has been the focus of an increasing number of studies in the last few years and is known nowadays as epitranscriptomics. Among others, N6-methyladenosine (m6A) and 5-methylcytosine (m5C) RNA modifications have been described on mRNA molecules and may have a role in modulating cellular processes. Epitranscriptomics is thus a new layer of regulation that must be considered in addition to transcriptomic analyses, as it can also be altered or modulated by exposure to any chemical or biological agent, including viral infections.
Here, we present a workflow that allows analysis of the joint cellular and viral epitranscriptomic landscape of the m6A and m5C marks simultaneously, in cells infected or not with the human immunodeficiency virus (HIV). Upon mRNA isolation and fragmentation from HIV- infected and non-infected cells, we used two different procedures: MeRIP-Seq, an RNA immunoprecipitation-based technique, to enrich for RNA fragments containing the m6A mark and BS-Seq, a bisulfite conversion-based technique, to identify the m5C mark at a single nucleotide resolution. Upon methylation-specific capture, RNA libraries are prepared for high-throughput sequencing. We also developed a dedicated bioinformatics pipeline to identify differentially methylated (DM) transcripts independently from their basal expression profile.
Overall, the methodology allows exploration of multiple epitranscriptomic marks simultaneously and provides an atlas of DM transcripts upon viral infection or any other cell perturbation. This approach offers new opportunities to identify novel players and novel mechanisms of cell response, such as cellular factors promoting or restricting viral replication.

Exploring m6A and m5C Epitranscriptomes upon Viral Infection: an Example with HIV

The role of RNA modifications in viral infections is just starting to be explored and could highlight new viral-host interaction mechanisms. In this work, we provide a pipeline to investigate m6A and m5C RNA modifications in the context of viral infections.

לחקור m6A ו- m5C Epitranscriptomes על זיהום ויראלי: דוגמה עם HIV

The role of RNA modifications in biological processes has been the focus of an increasing number of studies in the last few years and is known nowadays as ...

מתילציה RNA אימונואוציאציה Assay ללמוד m⁵C שינוי ערבידופסיס

Summary

Explore More Videos

Chapters in this video

שיטה למדידת RNA