עבודה זו נתמכה על ידי NIH AI099854 ו- AI126742 למפתח.

1. חישול של vDNA
<ol><li>שלב 1 X 10 מאגר (10 X 10 מניות: 100 מ"מ טריס-HCl, pH 8.0, 1 M NaCl, EDTA 10 מ מ), 10 מיקרומטר Oligo 1 (5' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3', 100 מניות מיקרומטר) ו- 10 מיקרומטר Oligo 2 (5' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3', 100 מניות מיקרומטר באמצעי אחסון הסופי של 1.5 מ ל) . µL 25 aliquot לתוך צינורות תגובת שרשרת (PCR) 0.2-mL פולימראז שישים. הערה: בהתאם ליישום, oligomers עשוי להיות שונה עם fluorophores או תגיות בקצה 5'-Oligo 2 או כמו של פנימי אמינו-טי בגיל 13 הבסיס מקצה 5'-Oligo 1. Oligomers ששונה לטהרו על ידי ביצועים גבוהים כרומטוגרפיה נוזלית (HPLC) לפני חישול. מצאנו כי 5'-סוף Cy3 או Cy5 fluorophore תיוג של Oligo 2 מפחית את היעילות הרכבה intasome 10-fold. תיוג fluorophore פנימי אינו מקטין את יעילות הייצור.</li>
	<li>Anneal באמצעות thermocycler התקופה הבאה על טמפרטורות: 1 מחזור ב 94.0 הלעפה תרוטרפמט 3 דקות, 99 מחזורי ב (94.0 הלעפה תרוטרפמט 1 דקות, הלעפה תרוטרפמט 93.6 1 דקות) יורד הטמפרטורות הן על-ידי הלעפה תרוטרפמט 0.8 לכל מחזור (המחזור האחרון הוא 14.8 הלעפה תרוטרפמט 1 דקות, הלעפה תרוטרפמט 14.4 1 דקות) , ולאחסן ב הלעפה תרוטרפמט 4.0.</li>
	<li>לשלב את התגובות מחזק משפופרות שישים כל. לטעון µL 500 שני 0.5-mL 3 kDa משקל מולקולרי הקיצוץ (MWCO) ultracentrifugal מסנן ריכוז היחידות. לרכז את vDNA annealed על ידי צנטריפוגה ב microcentrifuge ב 14,000 g x 10 דקות בטמפרטורת החדר (RT). הערה: אמצעי האחסון retentate צריך להיות µL ~ 50 בכל יחידת ריכוז.</li>
	<li>למחוק את הזרימה. להוסיף 250 µL של vDNA annealed הנותרים כל יחידת מסנן. חזור על הספין וזורקים את הזרימה. מאגר exchange לתוך מאגר TE (10 מ מ טריס-HCl, pH 8.0, 1 מ"מ EDTA) ע י שטיפת שלוש פעמים עם טה µL 450.</li>
	<li>היפוך של יחידת מסנן ומסתובב ב 1,000 x g למשך 2 דקות ב- RT. האחסון retentate הסופי עבור כל יחידת מסנן צריך להיות µL ~ 50. לשלב את retentates ואת העברת צינור פקקי בורג 1.5 mL.</li>
	<li>למדוד את ספיגת 260 ננומטר אולטרה סגול (UV) של vDNA. השתמש בערך זה כדי לחשב את ריכוז הדנ א מולרי סופית. מקדם הכחדה (חדוה260) vDNA הזה הוא 622,803 ס מ-1 מ'-1 והוא משקל מולקולרי שלה חנות המחוזי 23,972 ב-20 הלעפה תרוטרפמט.</li>
</ol>2. Intasome הרכבה
<ol><li>במידת האפשר, בצע את מכלול intasome בחדר קטן עם תרמוסטט משתנה. לכוון את התרמוסטט כדי כ 18-22 הלעפה תרוטרפמט. הערה: מניסיוננו, intasome assembly הלעפה תרוטרפמט 4 זה לא יעיל.</li>
	<li>להכנת 1 ליטר של מאגר דיאליזה (20 מ מ Bis-טריס פרופאן, pH 7.5, 200 מ"מ NaCl, 2 מ מ dithiothreitol (DTT), מיקרומטר 25 ZnCl2) בתוך 2 ל' עם בר מערבבים בצלחת מערבבים. Equilibrate המאגר בחדר הלעפה תרוטרפמט 18-22 לפחות 6 שעות.</li>
	<li>להרכיב את intasomes, לשלב 50 מ"מ Bis-טריס פרופאן, pH 7.5, 500 מ מ NaCl, 120 מיקרומטר ב PFV ו- vDNA 50 מיקרומטר, הנפח הכולל של 150 µL. הערה: PFV IN צריך להיות חופשי של מזהם נוקלאז פעילות7,8. אם הריכוז של PFV הוא גם לדלל כדי להכיל 120 ב מיקרומטר בכרך µL 150, אז זה אפשרי להגביר את עוצמת הסופי כדי 200 µL. הגורמים הקריטיים של שלב זה הן כדי לשמור על יחס טוחנת של IN כדי vDNA (2.4:1) יש מספיק מתחם להמחיש במהלך כרומטוגרפיה.</li>
	<li>נקה פיסה מוארכת ~ 10-ס מ 10-מ מ 6-8 kDa MWCO דיאליזה אבובים, קליפים עם מים מזוקקים כפול (ddH2O), או המים טוהר הגבוהה ביותר הזמינים. קליפ קצה אחד של הצנרת. הערה: דיאליזה אבובים שצריך לנהוג בזהירות כדי למנוע כל זיהום אפשרי מן המרחב מעבדה.</li>
	<li>להפוך 15 מ"ל דיאליזה מאגר של שטיפה אבובים (50 מ מ Bis-טריס פרופאן, pH 7.5, 500 מ מ NaCl). לשטוף את החלק הפנימי של הצנרת דיאליזה שלוש פעמים עם 1-2 מ ל שטיפה מאגר. להסיר כמה המאגר שטיפה ככל האפשר עם פיפטה, ג'ל דק טעינת עצה.</li>
	<li>אם יש צורך, להשתמש גילוח נקי או אזמל לחתוך את הדיאליזה, אבובים כך טיפ הטעינה ג'ל דק עשוי להגיע לסוף של הצנרת.</li>
	<li>העבר את מכלול intasome מהשלב 2.3 הצנרת דיאליזה פיפטה, ג'ל דק טעינת עצה. קליפ את הקצה הפתוח של הצנרת דיאליזה, למזער את כמות האוויר הציג בתוך הצנרת. מקם את הצנרור למאגר דיאליזה.</li>
	<li>Dialyze לילה (16-20 h) עם ערבוב עדין כך הצנרת מסתובב אך לא נמצא מערבולת. ודא כי הצנרת דיאליזה המשוקע, ניידים. לאחר כשעה, להתבונן על התמיסה גלוי בתוך הצנרת. הערה: Cy3 או Cy5 fluorescently הנקרא vDNA, התמיסה הוא יותר ברור. זה נכון עבור סוף הנקרא והן vDNA פלורסנט פנימי עם תוויות.</li>
</ol>3. Intasome Solubilization
<ol><li>להכין שני רחב נשא פיפטה טיפים על-ידי הסרת 2-4 מ מ מהקצה של טיפ 200 µL עם סכין גילוח או אזמל חדש על משטח נקי. הערה: הטיפים ישמש בשלב 3.3 ו- 3.5.</li>
	<li>הסר את הצנרור דיאליזה המאגר דיאליזה. על מנת למנוע דילול מדגם intasome עם מאגר דיאליזה שעלולים להישאר בסוף הצנרור ליד הפריט, להשתמש micropipette עם טיפ קטן פיפטה כדי להסיר כל מאגר עודף דיאליזה. להסיר את הסרטון מקצה אחד של הצנרת דיאליזה.</li>
	<li>שימוש רחב נשא פיפטה עצה מהשלב 3.1 להעביר את הדגימה כולל את התמיסה בתוך הצנרת דיאליזה כדי צינור 1.5-mL על קרח. הערה הנפח הכולל של החומר המשוחזר; לנפח הכללי הוא בדרך כלל ~ 140 µL.</li>
	<li>המדגם עם התמיסה הוא 200 מ"מ NaCl; להגדיל את המלח כדי ריכוז סופי של 320 מ מ NaCl על-ידי הוספת נפח מתאים של פתרון NaCl 5 מ' מניות. לדוגמה, עבור מדגם של 150 µL, להוסיף µL 3.9 5 מ' NaCl ו- 1.1 µL ddH2O עבור אמצעי אחסון הסופי של 155 µL. העברת קרח בדלי עם לטעום לתוך חדר קר הלעפה תרוטרפמט 4.</li>
	<li>שימוש רחב נשא פיפטה עצה מהשלב 3.1 אל resuspend ואל solubilize את התמיסה על-ידי pipetting. חזור על כל 20 דקות לפחות 1 ח' להתבונן כי רוב התמיסה. כדאי שנלך לשם פתרון. הערה: Pipetting כדי resuspend את המשקע ניתן לעצור כאשר ניכר כי התמיסה מצטמצם עוד ניכר בין נקודות זמן. כאשר vDNA אינו מסומן או תוצמד באופן פנימי, התמיסה הוא מופחת על ידי ~ 90% בהתבסס על בדיקה ויזואלית. במקרה של סיום Cy5 הנקרא vDNA, התמיסה הוא מופחת על ידי ~ 20% בלבד; רוב התמיסה עם סוף fluorophore הנקרא vDNA לא solubilize. הכמות של התמיסה זה ביעילות solubilized משתנה והיא צריכה להיות נחוש מדעית.</li>
</ol>4. Intasome טיהור
<ol><li>להכין 250 מ של גודל אי-הכללה של כרומטוגרפיה (שניות) הפעלת מאגר (20 מ מ Bis-טריס פרופאן, pH 7.5, 320 מ מ NaCl, 10% גליצרול). מסנן סטרילי המאגר עם 0.2-מיקרומטר לסנן יחידת ולאחסן ב 4 הלעפה תרוטרפמט. הערה: כל השלבים טיהור מבוצעות בחדר קר הלעפה תרוטרפמט 4.</li>
	<li>Equilibrate עמודה agarose צולבים שניה (קוטר = 10 מ"מ; אורך = 300 מ"מ; מיטה נפח = 24 mL; לדגום נפח = 25-500 µL; לחץ מרבי = 1.5 מגפ ס; אי-הכללה של מגבלת = 4 x 107 Da; מפריד מולקולרית משקולות בין 5 ל 5,000 kDa, לראות את טבלה של מחצלת erials) עם מאגר הפעלה שניה בספיקה של 0.4 mL/min. הערה: טיהור זה שעשוי להיות מותאם גודל שונה אי-הכללה של עמודות אם הם מסוגלים ביעילות להפריד 300 kDa kDa 44, כגון Superose 12 10/300 GL או להגדיל את Superose 6. Superose 12 10/300 GL יש ברזולוציה נמוכה יותר, שמוביל יותר החפיפה של פסגות. לעומת זאת, Superose 6 להגדיל יש רזולוציה גבוהה יותר והוא מציע הפרדה טובה יותר.</li>
	<li>Centrifuge הדגימה intasome ב microfuge ב 14,000 x g 10 דקות ב 4 הלעפה תרוטרפמט כדי הצניפה כל המשקע הנותרים. הסר בזהירות את תגובת שיקוע. לטעון את תגובת שיקוע ללולאה הזרקת 200 µL (צינורות שיכול להכיל ~ 200 μL). להחיל את הדגימה לעמודה שניה. הערה: כרכים עומס קטן יותר לאפשר רזולוציה גדולה יותר לפי סעיף</li>
	<li>Elute 25 מ ל שניה מפעיל מאגר ולאסוף 95 שברי µL 270. לבחון chromatogram שניה מציג שלוש א280/A260 פסגות (איור 1). הערה: הראשון צריך להיות צבירה (~9.0 - • תנאי 11.5 מ ל), ואחריו את שיא intasome tetramer PFV (~12.0 - 14.75 מ"ל • תנאי) ואת מונומר ב PFV עם שיא vDNA חינם (~15.0 - 18.0 מ ל).</li>
</ol>5. שילוב סטרנד העברה Assay, ובחירת שבר, אחסון
<ol><li>לשלב 2 µL של כל שבר שיא של intasome ו- 50 ng 3 kb supercoiled פלסמיד ה-DNA (ריכוז מניות הוא 50 ng/µL) במאגר התגובה (10 מ מ Bis-טריס פרופאן, pH 7.5, 110 מ מ NaCl, 5 מ מ MgSO4, ZnCl 4 מיקרומטר2, 10 מ מ DTT) באמצעי אחסון התגובה האחרונה של 15 µL. דגירה-37 הלעפה תרוטרפמט במשך 5 דקות.</li>
	<li>כוללות פקד שלילי עם לא intasome PFV נוספת. לעצור את התגובה עם µL 0.75 proteinase K (פתרון מניות 20 מ"ג/מ"ל) ו- 0.75 µL מרחביות (פתרון 10% מניות). דגירה-55 הלעפה תרוטרפמט לדוגמאות החנות ה 1 כנדרש ב-20 הלעפה תרוטרפמט עבור בהמשך מנתח. הערה: זה וזמינותו היא הערכה איכותית של פעילות האינטגרציה. ריכוז מולרי intasome של כל שבר לא נקבע לפני זה וזמינותו. שברים כלול שילוב סטרנד העברה וזמינותו ניתן לאחסן על קרח (כולל אחסון לילה) עד שילוב פעילות הוא אישר, שברים הנבחרים aliquoted. כאן אנו משתמשים pMP2, נגזרות pUC199. אנו משתמשים גם בהצלחה את pcDNA פלסמיד 5.4 kb 3.1. כל פלסמיד שעשויים להיות נחוש בדעתך בהרפיה מעגל, לינארית, טפסים supercoiled עשוי לשמש כמטרה לשילוב.</li>
	<li>להכין משקולת 1% 120 מ לכל אמצעי אחסון (w/v) ג'ל agarose במאגר טה X 1 (40 מ"מ טריס-אצטט, 1 מ"מ EDTA) עם 0.1 μg/mL אתידיום ברומיד (EtBr, פתרון מניות 10 מ"ג/מ"ל)10. להמיס את הפתרון agarose ויוצקים אותו לתוך מגש הליהוק של ג'ל 15 ס"מ, 10 ס"מ. הכנס מסרק 15-ובכן עם 5 מ מ רחב, 0.75 מ מ עבה וולס. הערה: בארות צר יותר תשואה רזולוציה להקה טובה יותר בהשוואה ולס בעובי 1.5 מ מ.</li>
	<li>לאפשר את הג'ל שבמהלכו בטמפרטורת החדר. לטבול את ג'ל טה X 1 עם 0.1 μg/mL EtBr.</li>
	<li>להוסיף 3 גליצרול 50% µL כל התגובה אינטגרציה מהשלב 5.2. לטעון את אמצעי האחסון כולו התגובה הג'ל. לטעון µL 1 של 10 kb DNA גודל סמן (150 ריכוז מניות ng/µL) על הנתיבים משני צדי הדגימות; במילים אחרות, דה מרקר גודל דנ א צריך לאגף המסלולים לדוגמה.</li>
	<li>. בנתיב החיצוני לטעון µL 6 כתום G צבען (0.25% כתום G, 30% גליצרול). הפעל את הג'ל עם מתח קבוע, 10 V/ס מ (100 וולט) בטמפרטורת החדר למשך 1 h, או עד לחזית צבע כתום G מגיע לסוף הג'ל.</li>
	<li>תמונה מיד את הג'ל agarose עם סורק פלורסנט מוגדר לזהות EtBr (532 ננומטר עירור, 610 ננומטר מסנן פליטה). אם נעשה שימוש fluorophore הנקרא vDNAs, גם תמונה עם הגדרות fluorophore המתאים. הערה: לדוגמה, כדי לזהות Cy5 בתווית ה-DNA, התמונה באמצעות עירור nm 633 ומסננים פליטה 670 ננומטר. מוצרים אינטגרציה מתואמת (CI, DNA ליניארי) צריך להפעיל נכון גודל ב ~ 3 kb, פלסמיד supercoiled unreacted (SC) צריך לרוץ מהר יותר (~ 2 kb) ולאחר חצי-אתרים שילוב מוצרים (מצב HSI, רגועה מעגל ה-DNA) לפעול לאט יותר (~3.5 kb). Unreacted vDNA כדאי נכון להפעיל גודל ~ 40 bp.</li>
	<li>לכמת הלהקות בנתיב כל עם תוכנת הדמיה7. לחשב את השבר של ה-DNA בנתיב כל זה CI, מצב HSI או SC; חישוב זה אינו כולל vDNA. הערה: יעילות שילוב, או את חלק SC להמיר מוצר ליניארי, מחושב על ידי חלוקת כמות פיקסלים מתואמת שילוב מוצרים (CI) על ידי כמות הפיקסלים הכולל שלוש להקות (מצב HSI + CI + SC). אם intasomes fluorophore שכותרתו, ייתכן מצב HSI את המוצרים CI גם quantitated על-ידי קרינה פלואורסצנטית.</li>
	<li>בחר בשברים עם פעילות האינטגרציה ביותר מתואמת. הערה: מניסיוננו, פעילות האינטגרציה שיא ופעולה מתואמים עולה בקנה אחד עם הפסגה חלבון המזוהה tetrameric PFV intasomes. למדוד את A280 של כל אלו שברים ולחשב את הריכוז intasome הסופי. חדוה280 עבור tetramer מסוג בר ב PFV עם שני vDNAs המתוארים כאן הוא 908,339 ס מ-1מ'-1 והוא משקל מולקולרי 225.5 kDa. הריכוזים פעל על פי אותו דפוס כמו הפסגה chromatogram שניה ו ב- strand העברה וזמינותו.</li>
	<li>להפיץ כל השבר 5 µL aliquots והכנס להקפיא במצב חנקן נוזלי. חנות aliquots ב-80 הלעפה תרוטרפמט. שברים שנבחר עבור אחסון הם בדרך כלל בין 200-600 ננומטר.</li>
</ol>

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

המחברים אין לחשוף.

תוספות retroviral טופס של multimeric מורכבים עם ה-DNA גנומי הנגיפי לבצע אינטגרציה ולהמשיך את מחזור החיים ויראלי. המספר של מונומרים לכל intasome ייתכן tetramers, octamers או אולי גבוה יותר סדר multimers11,12,13,14. PFV intasomes הם tetramer של רקומביננטי עם כפול גד...

שילוב של הגנום הנגיפי לתוך הגנום המארח הוא צעד הכרחי במחזור החיים של רטרווירוסים כל1. Integrase אנזים ויראלי (ב) מזרז בהצטרפות קוולנטיות בסוף כל הגנום DNA נגיפי למחשב המארח הדנ א. במהלך זיהום הסלולר, הוא חלק ממתחם אינטגרציה קדם המעביר אינטגרציה. ב רקומביננטי ומורכבת עם כפול oligomers DNA נטושים מחקה את הקצוות DNA נגיפי ניתן גם לבצע אינטגרציה לתוך ה-DNA היעד במבחנה2. יישום נפוץ השילוב assay במבחנה מנצל של פלסמיד supercoiled כיעד הדנ א. שילוב של שני oligomers DNA נגיפי (vDNA) כדי פלסמיד התוצאה היא מוצר ליניארי, הנקרא מתואמת אינטגרציה (איור 2 א). שילוב assay במבחנה גם תניב מוצרים עם אחד בלבד vDNA covalently לצרף את פלסמיד המטרה וכתוצאה מכך עיגול רגוע. מוצר זה שילוב חצי-אתר שנראה חפץ של assay בתוך חוץ גופית.
ב רקומביננטי, vDNA ניתן לבצע אינטגרציה במבחנה, אבל הם לא ריאגנטים אידיאלי עבור חקר הדינמיקות או מבנה של אינטגרציה מתחמי כאשר ב monomeric יטשטש ויזואליזציה הרלוונטיים. מתחמי אינטגרציה מטוהרים, או "intasomes", נדרשים ללימודי ניתוח או מבנה דינמי מולקולה בודדת. ב PFV ו- vDNAs עשוי להיות התאספו על-ידי דיאליזה מתוך מאגר ריכוז המלח גבוה יחסית ל-3,ריכוז מלח נמוך4. במהלך דיאליזה, התמיסה טפסים. המשקע הזה יוסר דיאליזה, ריכוזי המלח הוא גדל. ריכוז המלח גבוה יותר solubilizes את intasomes PFV המכיל precipitate. Intasomes כבר אז טהור לפי גודל אי-הכללה של כרומטוגרפיה (שניות). אב טיפוס רקומביננטי קצפית וירוס (PFV) ב הוכח קיימים מונומר בפתרון בריכוזים עד מיקרומטר 2255. Fractionation שניה מפריד ביעילות את intasomes PFV (225.5 kDa), הכוללת של tetramer PFV IN, שני vDNAs, PFV monomeric ב (44.4 kDa), חינם vDNA (24.0 kDa). Intasomes PFV יתכן מוקפאות ולשמר את פעילות האינטגרציה במשך לפחות שישה חודשים של אחסון ב-80 הלעפה תרוטרפמט.
Intasomes PFV רקומביננטי ניתן לשינוי כדי לכלול החלפות חומצת אמינו או לחיתוך מוטציות או vDNAs עם4,fluorophores או ביוטין6תוויות. Intasomes PFV מטוהרים בקלות לבצע אינטגרציה לתוך פלסמיד supercoiled יעד ה-DNA במבחנה. תפזורת מבחני הביוכימי אינטגרציה עם intasomes עשוי לבחון את ההשפעות של מוטציות, מעכבי, או תוספים כימיים אחרים. Biotinylated intasomes יכול לשמש כדי לחקור זיקה עם חומצות גרעין או חלבונים. PFV intasomes פונקציונליים בטמפרטורת הסביבה ומאפשר לבדיקה מיקרוסקופית מולקולה בודדת על-ידי פינצטה מגנטי כדי למדוד את הזמן בין הצטרפות של שני הקצוות vDNA או קרינה פלואורסצנטית גמורה להמחיש את החיפוש intasome על המטרה דנ א6. בנוסף, PFV intasomes היו הראשונים להיות מבנית מאופיין להשפיע באופן משמעותי בתחום של שילוב retroviral3.

<table>
	<tbody>
		<tr>
			<td>DNA Oligomers</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Custom DNA Oligos</td>
		</tr>
		<tr>
			<td>Tris Ultra Pure</td>
			<td>Gojira Fine Chemicals</td>
			<td>UTS1003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>P212121</td>
			<td>RP-S23020</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure EDTA</td>
			<td>Invitrogen/Gibco</td>
			<td>15575</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra 0.5 mL centrifugal filters</td>
			<td>Sigma-Aldrich</td>
			<td>Z677094-24EA</td>
			<td>3 kDa MWCO</td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>P212121</td>
			<td>SV-DTT</td>
			<td></td>
		</tr>
		<tr>
			<td>BIS-TRIS propane,&#62;=99.0% (titration)</td>
			<td>Sigma-Aldrich</td>
			<td>B6755-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>ZnCl2</td>
			<td>Sigma-Aldrich</td>
			<td>208086</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>Amresco</td>
			<td>0662</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>G37-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel-loading tips, 1 - 200 &#956;L</td>
			<td>Corning</td>
			<td>CLS4853-400EA</td>
			<td></td>
		</tr>
		<tr>
			<td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td>
			<td>Fisher Scientific</td>
			<td>12-640</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Disposable Filter Units with PES Membrane &#62; 250mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>568-0020</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis tubing clips</td>
			<td>Spectrum Labs</td>
			<td>132734</td>
			<td></td>
		</tr>
		<tr>
			<td>6-8 kDa 10 mm Dialysis Tubing</td>
			<td>Spectrum Medical</td>
			<td>132645</td>
			<td></td>
		</tr>
		<tr>
			<td>Superose 6 10/300 GL</td>
			<td>GE Healthcare Life Sciences</td>
			<td>17517201</td>
			<td></td>
		</tr>
		<tr>
			<td>Hi-Res Standard Agarose</td>
			<td>AGTC Bioproducts</td>
			<td>AG500D1</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP1302</td>
			<td></td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Fisher Scientific</td>
			<td>0-267</td>
			<td></td>
		</tr>
		<tr>
			<td>Hyladder 10kb, 500 lanes</td>
			<td>Denville Scientific</td>
			<td>CB4225-4</td>
			<td></td>
		</tr>
	</tbody>
</table>

assembly and purification of prototype foamy virus intasomes

א הגדרת תכונה, צעד הכרחי של מחזור חיי הרטרווירוס הוא השילוב של הגנום הנגיפי לתוך הגנום המארח. כל רטרווירוסים לקודד אנזים integrase (ב) אשר מזרז קוולנטיות בהצטרפות של נגיפי למארח ה-DNA, הידוע בשם strand העברה. שילוב יכול להיות מעוצבת במבחנה עם IN retroviral רקומביננטי ו- DNA oligomers מחקה את הקצוות של הגנום הנגיפי. על מנת לסכם באופן הדוק יותר התגובה אינטגרציה המתרחשת ויוו, אינטגרציה מתחמי are התכנסו from IN רקומביננטי, oligomers סינתטי על-ידי דיאליזה במאגר מלח בריכוז. מורכבות, השילוב של intasome, שנקרא יכולים להיטהר על-ידי גודל אי-הכללה של כרומטוגרפיה. במקרה של אב-טיפוס קצפית וירוס (PFV), intasome של tetramer של oligomers דנ א שני והוא מופרד ברצון monomeric IN, אוליגומר חינם הדנ א. יעילות שילוב PFV intasomes ייתכן לבדיקה תחת מגוון תנאים ניסיוני כדי להבין טוב יותר את הדינמיקה, מכניקה של retroviral אינטגרציה.

PFV intasomes are התכנסו from רקומביננטי IN ו- vDNA. לאחר ההרכבה, intasomes כבר טהור על ידי שניה (איור 1). שילוב פעילות של כל שבר לבדיקה עם supercoiled DNA היעד ואת agarose בג'ל (איור 2). הג'ל הזה הוא עם תמונה עם סורק פלורסנט מוגדר לזהות EtBr (וגם fluorophore, אם התווית על-ידי fluorophore v...

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

Integrase retroviral רקומביננטי oligomers DNA מחקה מסתיים DNA נגיפי יכול יוצרים קומפלקס פעיל enzymatically המכונה של intasome. Intasomes עשוי לשמש ללימודי הביוכימי, מבניים קינטי. פרוטוקול זה מפרט כיצד להרכיב ולטהר intasomes וירוס קצפית אב-טיפוס.

הרכבה ולטיהור Intasomes וירוס קצפית אב-טיפוס

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

assembly-and-purification-of-prototype-foamy-virus-intasomes

Universidad de Cartagena UDEC

Research

JoVE Journal

Immunology and Infection

5.4K Views.  The Ohio State University College of Medicine. Integrase retroviral רקומביננטי oligomers DNA מחקה מסתיים DNA נגיפי יכול יוצרים קומפלקס פעיל enzymatically המכונה של intasome. Intasomes עשוי לשמש ללימודי הביוכימי, מבניים קינטי. פרוטוקול זה מפרט כיצד להרכיב ולטהר intasomes וירוס קצפית אב-טיפוס.

Video: Assembly and Purification of Prototype Foamy Virus Intasomes

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal phase during establishment of infection in a given host. Consequently, study of encapsidation deciphers the information regarding the know-how of the mechanism regulating virus assembly to form infectious virions. Such information is vital in formulating novel methods of curbing virus spread and disease control. Virus encapsidation can be studied in vivo and in vitro. Genome encapsidation in vivo is a highly regulated selective process involving macromolecular interactions and subcellular compartmentalization. Therefore, study leading to dissect events encompassing virus encapsidation in vivo would provide basic knowledge to understand how viruses proliferate and assemble. Recently in vitro encapsidation has been exploited for the research in the area of biomedical imaging and therapeutic applications. Non-enveloped plant viruses stand far ahead in the venture of in vitro encapsidation of the negatively charged foreign material. Brome mosaic virus (BMV), a non-enveloped multicomponent RNA virus pathogenic to plants, has been used as a model system for studying genome packaging in vivo and in vitro. For encapsidation assays in Nicotiana benthamiana plants, Agrobacterium -mediated transient expression, refer to as agroinfiltration, is an efficient and robust technique for the synchronized delivery and expression of multiple components to the same cell. In this approach, a suspension of Agrobacterium tumefaciens cells carrying binary plasmid vectors carrying cDNAs of desiredviral mRNAs is infiltrated into the intercellular space withina leaf using nothing more sophisticated than a 1 ml disposable syringe (without needle). This process results in the transfer of DNA insert into plant cells; the T-DNA insert remains transiently in the nucleus and is then transcribed by the host polymerase II, leading to the transient expression. The resulting mRNA transcript (capped and polyadenylated) is then exported to the cytoplasm for translation. After approximately 24 to 48 hours of incubation,sections of infiltrated leaves can be sampled for microscopyor biochemical analyses. Agroinfiltration permits large numbers (hundreds to thousands) of cells to be transfected simultaneously. For in vitro encapsidation, purified virions of BMV are dissociated into capsid protein by dialyzing against dissociation buffer containing calcium chloride followed by removal of RNA and un-dissociated virions by centrifugation. Genome depleted capsid protein subunits are then reassembled with desired viral genome components or non-viral components such as indocyanine dye.

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

A simple, efficient and robust way to synchronize the delivery of multiple viral components to plant cells via Agrobacterium-mediated transient expression is described. This approach is amenable for studying replication, encapsidation followed by in vitro reassembly of non-viral components into genome depleted optical viral ghosts suitable for biomedical applications.

פשוט וחזק In vivo ו במבחנה גישה ללימוד הרכבה וירוס

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Affinity Purification of Influenza Virus Ribonucleoprotein Complexes from the Chromatin of Infected Cells

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the single-stranded genome is encapsidated by the nucleoprotein (NP), and associated with the trimeric polymerase complex consisting of the PA, PB1, and PB2 subunits. However, in contrast to most RNA viruses, influenza viruses perform viral RNA synthesis in the nuclei of infected cells. Interestingly, viral mRNA synthesis uses cellular pre-mRNAs as primers, and it has been proposed that this process takes place on chromatin1. Interactions between the viral polymerase and the host RNA polymerase II, as well as between NP and host nucleosomes have also been characterized1,2.
Recently, the generation of recombinant influenza viruses encoding a One-Strep-Tag genetically fused to the C-terminus of the PB2 subunit of the viral polymerase (rWSN-PB2-Strep3) has been described. These recombinant viruses allow the purification of PB2-containing complexes, including vRNPs, from infected cells. To obtain purified vRNPs, cell cultures are infected, and vRNPs are affinity purified from lysates derived from these cells. However, the lysis procedures used to date have been based on one-step detergent lysis, which, despite the presence of a general nuclease, often extract chromatin-bound material only inefficiently. 
Our preliminary work suggested that a large portion of nuclear vRNPs were not extracted during traditional cell lysis, and therefore could not be affinity purified. To increase this extraction efficiency, and to separate chromatin-bound from non-chromatin-bound nuclear vRNPs, we adapted a step-wise subcellular extraction protocol to influenza virus-infected cells. Briefly, this procedure first separates the nuclei from the cell and then extracts soluble nuclear proteins (here termed the "nucleoplasmic" fraction). The remaining insoluble nuclear material is then digested with Benzonase, an unspecific DNA/RNA nuclease, followed by two salt extraction steps: first using 150 mM NaCl (termed "ch150"), then 500 mM NaCl ("ch500") (Fig. 1). These salt extraction steps were chosen based on our observation that 500 mM NaCl was sufficient to solubilize over 85% of nuclear vRNPs yet still allow binding of tagged vRNPs to the affinity matrix.
After subcellular fractionation of infected cells, it is possible to affinity purify PB2-tagged vRNPs from each individual fraction and analyze their protein and RNA components using Western Blot and primer extension, respectively. Recently, we utilized this method to discover that vRNP export complexes form during late points after infection on the chromatin fraction extracted with 500 mM NaCl (ch500)3.

Influenza viruses replicate their RNA genome in association with host-cell chromatin. Here, we present a method to purify intact viral ribonucleoprotein complexes from the chromatin of infected cells. Purified viral complexes can be analyzed by both Western blot and primer extension of protein and RNA content, respectively.

זיקה טיהור של נגיף השפעת תסביכים Ribonucleoprotein של הכרומטין של תאים נגועים

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the ...

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe pneumonia "Legionnaires' disease"1. In protozoan and mammalian phagocytes, L. pneumophila employs a conserved mechanism to form a specific, replication-permissive compartment, the "Legionella-containing vacuole" (LCV). LCV formation requires the bacterial Icm/Dot type IV secretion system (T4SS), which translocates as many as 275 "effector" proteins into host cells. The effectors manipulate host proteins as well as lipids and communicate with secretory, endosomal and mitochondrial organelles2-4.
The formation of LCVs represents a complex, robust and redundant process, which is difficult to grasp in a reductionist manner. An integrative approach is required to comprehensively understand LCV formation, including a global analysis of pathogen-host factor interactions and their temporal and spatial dynamics. As a first step towards this goal, intact LCVs are purified and analyzed by proteomics and lipidomics.
The composition and formation of pathogen-containing vacuoles has been investigated by proteomic analysis using liquid chromatography or 2-D gel electrophoresis coupled to mass-spectrometry. Vacuoles isolated from either the social soil amoeba Dictyostelium discoideum or mammalian phagocytes harboured Leishmania5, Listeria6, Mycobacterium7, Rhodococcus8, Salmonella9 or Legionella spp.10. However, the purification protocols employed in these studies are time-consuming and tedious, as they require e.g. electron microscopy to analyse LCV morphology, integrity and purity. Additionally, these protocols do not exploit specific features of the pathogen vacuole for enrichment.
The method presented here overcomes these limitations by employing D. discoideum producing a fluorescent LCV marker and by targeting the bacterial effector protein SidC, which selectively anchors to the LCV membrane by binding to phosphatidylinositol 4-phosphate (PtdIns(4)P)3,11 . LCVs are enriched in a first step by immuno-magnetic separation using an affinity-purified primary antibody against SidC and a secondary antibody coupled to magnetic beads, followed in a second step by a classical Histodenz density gradient centrifugation12,13 (Fig. 1).
A proteome study of isolated LCVs from D. discoideum revealed more than 560 host cell proteins, including proteins associated with phagocytic vesicles, mitochondria, ER and Golgi, as well as several GTPases, which have not been implicated in LCV formation before13. LCVs enriched and purified with the protocol outlined here can be further analyzed by microscopy (immunofluorescence, electron microscopy), biochemical methods (Western blot) and proteomic or lipidomic approaches.

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

This article describes a method for the isolation and purification of intact Legionella-containing vacuoles (LCVs) from amoeba and macrophages. The two-step protocol comprises LCV enrichment by immuno-magnetic separation using an antibody against a bacterial LCV marker and further purification by density gradient centrifugation.

טיהור vacuoles הפתוגן מ<em&gt; הלגיונלה</em&gt; נגועים phagocytes

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Newcastle disease virus (NDV), the prototype member of the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented, negative-sense, single-stranded, enveloped RNA virus (Figure 1) with potential applications as a vector for vaccination and treatment of human diseases. In-depth exploration of these applications has only become possible after the establishment of reverse genetics techniques to rescue recombinant viruses from plasmids encoding their complete genomes as cDNA2-5. Viral cDNA can be conveniently modified in vitro by using standard cloning procedures to alter the genotype of the virus and/or to include new transcriptional units. Rescue of such genetically modified viruses provides a valuable tool to understand factors affecting multiple stages of infection, as well as allows for the development and improvement of vectors for the expression and delivery of antigens for vaccination and therapy. Here we describe a protocol for the rescue of recombinant NDVs.

Newcastle disease virus (NDV) has been extensively studied in the last few years in order to develop new vectors for vaccination and therapy, among others. These studies have been possible due to techniques to rescue recombinant virus from cDNA, such as those we describe here.

הצלה של וירוס רקומביננטי ניוקאסל מחלות מcDNA

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Isolation, Identification, and Purification of Murine Thymic Epithelial Cells

The thymus is a vital organ for T lymphocyte development. Of thymic stromal cells, thymic epithelial cells (TECs) are particularly crucial at multiple stages of T cell development: T cell commitment, positive selection and negative selection. However, the function of TECs in the thymus remains incompletely understood. In the article, we provide a method to isolate TEC subsets from fresh mouse thymus using a combination of mechanical disruption and enzymatic digestion. The method allows thymic stromal cells and thymocytes to be efficiently released from cell-cell and cell-extracellular matrix connections and to form a single-cell suspension. Using the isolated cells, multiparameter flow cytometry can be applied to identification and characterization of TECs and dendritic cells. Because TECs are a rare cell population in the thymus, we also describe an effective way to enrich and purify TECs by depleting thymocytes, the most abundant cell type in the thymus. Following the enrichment, cell sorting time can be decreased so that loss of cell viability can be minimized during purification of TECs. Purified cells are suitable for various downstream analyses like Real Time-PCR, Western blot and gene expression profiling. The protocol will promote research of TEC function and as well as the development of in vitro T cell reconstitution.

Here we describe an efficient method for isolation, identification, and purification of mouse thymic epithelial cells (TECs). The protocol can be utilized for studies of thymus function for normal T cell development, thymus dysfunction, and T cell reconstitution.

בידוד, זיהוי, וטיהור של תאי Murine הרתי אפיתל

The thymus is a vital organ for T lymphocyte development. Of thymic stromal cells, thymic epithelial cells (TECs) are particularly crucial at multiple ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of inflammation. They are key players in the innate immune system and play major roles in cancer biology. Neutrophils have been proposed as key mediators of malignant transformation, tumor progression, angiogenesis and in the modulation of the antitumor immunity; through their release of soluble factors or their interaction with tumor cells. To characterize the specific functions of neutrophils, a fast and reliable method is coveted for in vitro isolation of neutrophils from human blood. Here, a density gradient separation method is demonstrated to isolate neutrophils as well as mononuclear cells from the blood. The procedure consists of layering the density gradient solution such as Ficoll carefully above the diluted blood obtained from patients diagnosed with chronic lymphocytic leukemia (CLL), followed by centrifugation, isolation of mononuclear layer, separation of neutrophils from RBCsby dextran then lysis of residual erythrocytes. This method has been shown to isolate neutrophils &#8805; 90 % pure. To mimic the tumor microenvironment, 3-dimensional (3D) experiments were performed using basement membrane matrix such as Matrigel. Given the short half-life of neutrophils in vitro, 3D experiments with fresh human neutrophils cannot be performed. For this reason promyelocytic HL60 cells are differentiated along the granulocytic pathway using the differentiation inducers dimethyl sulfoxide (DMSO) and retinoic acid (RA). The aim of our experiments is to study the role of neutrophils on the sensitivity of lymphoma cells to anti-lymphoma agents. However these methods can be generalized to study the interactions of neutrophils or neutrophil-like cells with a large range of cell types in different situations.

Neutrophils are the most abundant type of white blood cells. The isolation of neutrophils from human blood by density gradient separation method and the differentiation of human promyelocytic (HL60) cells along the granulocytic pathway are described here; to test their role on sensitivity of lymphoma cells to anti-lymphoma agents.

בידוד נויטרופילים וניתוח כדי לקבוע את תפקידם רגישות תאים לימפומה לסוכנים טיפוליים

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential to be used as drug therapies for HIV-1 infection. Post-integration inhibitors include ribozymes, short hairpin (sh) RNAs, small interfering (si) RNAs, U1 interference (U1i) RNAs and RNA aptamers. Many of these have been identified using transient co-transfection assays with an HIV-1 expression plasmid and some have advanced to clinical trials. In addition to measures of efficacy, small RNAs have been evaluated for their potential to affect the expression of human RNAs, alter cell growth and/or differentiation, and elicit innate immune responses. In the protocols described here, a set of transient transfection assays designed to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps in the HIV-1 replication cycle are described. We have used these assays to identify new ribozymes and optimize the format of shRNAs and siRNAs targeting HIV-1 RNA. The methods provide a quick set of assays that are useful for screening new anti-HIV-1 RNAs and could be adapted to screen other post-integration inhibitors of HIV-1 replication.

Methods to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps of the HIV-1 replication cycle are described. These methods are useful for screening new molecules and optimizing the format of existing ones.

הערכת היעילות והרעילות של RNAs מיקוד ייצור HIV-1 לשימוש ב ג&#39;ין או טיפול תרופתי

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral evolution. Here we describe the construction of an infectious clone for Zika virus (ZIKV), which is currently causing an explosive outbreak in the Americas. To prevent toxicity to bacteria that is commonly observed with flavivirus-derived plasmids, we generated a two-plasmid system which separates the genome at the NS1 gene and is more stable than full-length constructs that could not be successfully recovered without mutations. After digestion and ligation to join the two fragments, full-length viral RNA can be generated by in vitro transcription with T7 RNA polymerase. Following electroporation of transcribed RNA into cells, virus was recovered that exhibited similar in vitro growth kinetics and in vivo virulence and infection phenotypes in mice and mosquitoes, respectively.

This protocol describes the recovery of infectious Zika virus from a two-plasmid infectious cDNA clone.

הצלה אפיון של וירוס רקומביננטי מעולם חדש Zika וירוס זיהום מזוהם

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared to IN from other retroviruses, PFV IN is more soluble and more amenable to experimental manipulation. Additionally, it is sensitive to clinically relevant human immunodeficiency virus (HIV-1) IN inhibitors, suggesting that the catalytic mechanism of PFV IN is similar to that of HIV-1 IN. IN catalyzes the covalent joining of viral complementary DNA (cDNA) to target DNA in a process called strand transfer. This strand transfer reaction introduces nicks to the target DNA. Analysis of integration reaction products can be confounded by the presence of nucleases that similarly nick DNA. A bacterial nuclease has been shown to co-purify with recombinant PFV IN expressed in Escherichia coli (E. coli). Here we describe a method to isolate PFV IN from the contaminating nuclease by heparin affinity chromatography. Fractions are easily screened for nuclease contamination with a supercoiled plasmid and agarose gel electrophoresis. PFV IN and the contaminating nuclease display alternative affinities for heparin sepharose allowing a nuclease-free preparation of recombinant PFV IN suitable for bulk biochemical or single molecule analysis of integration.

Recombinant prototype foamy virus integrase protein is often contaminated with a bacterial nuclease during purification. This method identifies nuclease contamination and removes it from the final preparation of the enzyme.

האיתור וההסרה של נוקלאז זיהום במהלך טיהור של אב טיפוס רקומביננטי קצפית וירוס Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for the rapid bedside inactivation of the Ebola virus during blood sampling for safe nucleic acid (NA) tests by adding a commercial lysis/binding buffer directly into the vacuum blood collection tubes. Using this bedside inactivation approach, we have developed a safe, rapid, and simplified bedside NA extraction method for the subsequent detection of a virus in lysis/binding buffer-inactivated whole blood. The NA extraction is directly performed in the blood collection tubes and requires no equipment or electricity. 
After the blood is collected into the lysis/binding buffer, the contents are mixed by flipping the tube by hand, and the mixture is incubated for 20 min at room temperature. Magnetic glass particles (MGPs) are added to the tube, and the contents are mixed by flipping the collection tube by hand. The MGPs are then collected on the side of the blood collection tube using a magnetic holder or a magnet and a rubber band. The MGPs are washed three times, and after the addition of elution buffer directly into the collection tube, the NAs are ready for NA tests, such as qPCR or isothermal loop amplification (LAMP), without the removal of the MGPs from the reaction. The NA extraction method is not dependent on any laboratory facilities and can easily be used anywhere (e.g., in field hospitals and hospital isolation wards). When this NA extraction method is combined with LAMP and a portable instrument, a diagnosis can be obtained within 40 min of the blood collection.

Here, we present a protocol for the rapid virus nucleic acid extraction from the virus-inactivated whole blood. The extraction is performed directly in the blood collection tubes and requires no equipment or electricity. The method is not dependent on laboratory facilities and can be used anywhere (e.g., in field hospitals).

חילוץ מהיר, בטוח, ופשוט ידנית המיטה חומצת גרעין איתור וירוס בדגימות דם מלא

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...

הרכבה ולטיהור Intasomes וירוס קצפית אב-טיפוס

Summary

Explore More Videos

Chapters in this video