This work was supported by the European Research Council (ERC) Starting Grant, under the 7th Framework Program (Project No. 311122, BioProbe). We thank Dr. Julien Autebert and Marcel Buerge for technical assistance and discussions during the development of the protocol and the platform. Prof. Petra Dittrich (ETH Zurich), Prof. Bradley Nelson (ETH Zurich), Dr. Bruno Michel and Dr. Walter Riess are acknowledged for their continuous support.

1. ראש MFP ואת פלטפורמת ניקוי והכנה הערה: פרוטוקול זה משתמש-בכיוון אנכי היברידית סיליקון זכוכית MFP בראש 15,16. המרכיב סיליקון של הראש מכיל את microchannels, אשר חרוט עד לעומק של 100 מיקרומטר. סיליקון החרוט הוא קשור זכוכית באמצעות מליטת anodic. עיצוב הערוץ מורכב דפוס מורכב משישה ערוצים, שתי כל להזרקה ושאיפה, ושתי להזרקת נוזל הטבילה (איור 1). הערוצים המשמשים להזרקת נוזל טבילה לחדש את התקשורת סביב הדגימה הביולוגית, וכך למנוע הפסדים בשל שאיפה ואידוי. הערוצים הפנימיים והערוצים חיצוניים המשמשים ביצירה הנוכחית הם 100 × 100 מיקרומטר ו -200 × 100 מיקרומטר בהתאמה. ייצור ועיבוד פוסט, ראשי MFP עם ערוצים ברורים רכס מלוטש מתקבלים. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכנת תחנת השאיבה-טיפול נוזלמַנגָנוֹן <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> השתמשו נימים עם 1/16 &#39;&#39; (1.59 מ&quot;מ) קוטר חיצוני ו 0.02 &#39;&#39; (0.51 מ&quot;מ) קוטר פנימי לכל וצינור מחובר המזרקים. וארי גודל נימי מבוסס על יישום ולקבל המחברים ואביזרים המתאימים להתממשק ראש MFP עם מזרקים. השתמש במים ultrapure מקום דילולים נחוצים. </li><li style=";text-align:right;direction:rtl"> מזרקים נקיים (250 - 500 נפח μl) ו בוכנות מזרק על ידי sonication בתמיסה אקונומיקה 0.5% ל-לפני המים ultrapure ופוסט דוקטורנטים ניסויים תא חי. יש לשטוף אותן היטב במים. למלא אותם במים על ידי טבילת הטיפים שלהם לחלוטין בתוך אמבט מי aspirating באמצעות הבוכנה. טהר את הנוזל תוך בתוך אמבט מים עם פיר מזרק פנייה חותמת ביציאה של המזרק. לשאוב טיהור חוזר על פעולה עד שאין בועות אוויר נראים במדורי המזרק. </li><li style=";text-align:right;direction:rtl"> חבר מזרקים מלאים עד משאבות המזרק באמצעות מחברי Luer נעילה. השתמש שסתום מתג רכוב עלמשאבות לכוון את הנוזל מן המזרק לאחת משתי נימים מובילות גם אל ראש MFP או למאגרים הנוזליים (איור 6). (אם לא שסתום מתג זמין ראה סעיף 1.4.4). טהר הוא נימים עם מים מן המזרקים בקצב זרימה של כ 10 - 50 μl / דקה, בהתאם לגודל של המזרק עד כ -10 μl של מים נשאר המזרקים. </li><li style=";text-align:right;direction:rtl"> טרום להכניס את הנימים מטוהרים לתוך מתאם מחבר microfluidic מתאים / אשר ממשקים עם vias הערוץ בראש (למשל, מחבר M1 - ראה חומרים). </li></ol></li><li style=";text-align:right;direction:rtl"> הכנת ראש MFP <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> נקו את הראש MFP ידי sonication משימוש בחומרי ניקוי זכוכית לניקוי רגיל או אקונומיקה 0.5% לניקוי מחמירים, במשך 5 דקות. טהר ערוצים במים על ידי טבילה במים איפקס וליישם ואקום vias. </li><li style=";text-align:right;direction:rtl"> בדוק ערוצים תחת סטראו עבור חסימות פוטנציאל (סתימה) מחדשכבול בשלב הקודם במידת הצורך. </li><li style=";text-align:right;direction:rtl"> הר הראש נקי על בעל ראש הבורג המחבר עם צינורות טרום מוכנס מטוהר על ראשו. בורג בעל ראש לבמה-Z, המשמש לשליטה על מרחק הפער בין הראש monolayer התא. </li></ol></li><li style=";text-align:right;direction:rtl"> כיול בשלבי הסריקה של פלטפורמת MFP <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בצע כיול נקודת סיום של ה- X, א- ו- Z-שלבים לפני מחבר את הראש אל הרציף, על פי הפרוטוקול של היצרן עם ממשק תוכנה מתאים. בשלבים מכוילים להבטיח דיוק במיצוב ראש MFP. </li><li style=";text-align:right;direction:rtl"> השג מרחק פער אפס גולמי (איפוס) על ידי הבאת ראש MFP מעל שקופית קאמרית ללא תאים ויורד לאט 5 מיקרומטר צעדים. במגע בדיקה עם המצע, הטבעות של ניוטון יש לשים לב. זוהי הערכה גסה. עמדה מדויקת שתופק לאחר התאמת coplanarity של הקודקוד החללי אל substratדואר. </li><li style=";text-align:right;direction:rtl"> כדי להבטיח coplanarity של הקודקוד החללי, לכוונן את הטיית הראש באמצעות goniometer (על הממשק של ראש במת Z). כאשר נוצר להבטיח כי הטבעות של ניוטון הן סימטרי (איור 1). הזז את מיקרומטר MFP ראש 20 מן המצע ולהתאים להטות באמצעות goniometer. יורד חזרה, מתאפס וכוונון להטות עד הטבעות של ניוטון הם סימטריים על קשר. עם הטיה מותאמת, לקבוע את מיקום z המייצר טבעות ניוטון סימטריות כמו אפס. הערה: בשלב Z שולט ראש אל מצע המרחק, ואילו בשלב XY שולט הסריקה של המצע (איור 2). ניתן למצוא הסבר מפורט ב קודם לכן עבודתנו 14. </li></ol></li><li style=";text-align:right;direction:rtl"> הכנות כימיות להסרה מקומית של שכבות תאים זהירות: במקרה הצורך, ציוד בטיחות השימוש (למשל, כפפות ניטריל, משקפי מגן) עבור כימיקלים שמכינים. השתמש hoo קטרד אם הדרושות להכנת פתרונות. הכן את כל כימיקלי המאגרים עם מי ultrapure כמו diluent. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> כן 50 פתרון המ&quot;מ NaOH בעוד נוזל העיבוד לערוץ ההזרקה הפנימי (i2 עם I2 Q הזרימה באיור 1). </li><li style=";text-align:right;direction:rtl"> הכן את פתרון חיץ החילוץ הנדרש הזרקה החיצונית (i1 עם I1 Q הזרימה באיור 1), מורכב 1 מ&quot;מ חומצת ethylenediaminetetraacetic (EDTA), 0.5% Tween 20, ו -10 מיקרומטר rhodamine B ב 50 המ&quot;מימ טריס (hydroxymethyl) aminomethane ב pH 8. הקאה, להשתמש מי מזרקי השאיפה. </li><li style=";text-align:right;direction:rtl"> לסנן את כל פתרונות באמצעות מסנן מזרק 0.2 מיקרומטר. דגה כל הפתרונים המסוננים באמצעות ייבוש עד תחנת האוויר המומסת מבעבעת על פני השטח. </li><li style=";text-align:right;direction:rtl"> באמצעות קו הניקוז מחובר משאבות המזרק, לטהר את המים שריד לשאוב פתרונות degassed לתוך מזרקי ההזרקה ב 40 μl / min עד המזרקים מלאים (250 או 500 μl).הדבר מבטיח מילוי חינם בועות של מזרקים, מחברים, ונימים. שסתום ושתיים נימי מזרק-מתג המערכת מאפשרת מילוי של מזרקים באמצע הניסוי. בהעדר מתג שסתום כגון, ניתק את הנימים מהראש ולמלא נימים ואת המזרק ידי aspirating פתרונות degassed לפני החיבור מחדש להם בראש. </li><li style=";text-align:right;direction:rtl"> Aspirating עיבוד מגן נוזלים דרך הנימים מאפשר שימוש של כמויות קטנות במהלך המבצע. אם הכימיקלים ניתן להכין בכמויות גדולות, למלא מזרקים עם הפתרונות הנדרשים ישירות. לדוגמא, מזרקי השאיפה המכילים מים ניתן למלא באמצעות גישה זו. </li><li style=";text-align:right;direction:rtl"> טהר את הנימים לראש MFP עם הנוזלים שהוקצו עבור כל ערוץ כהגדרתו 1.4.1 ו 1.4.2. הערה: פתרון חיץ החילוץ מגן על NaOH ב הכליאה הפנימית ואת רכיב rhodamine למאגר מקל על ויזואליזציה של הדואר hHFC במהלך המבצע. </li><li style=";text-align:right;direction:rtl"> אם התאים יתר ומחוברות, עם אגרגטים תא המופיעים על פני השטח תרבותי, להשלים את מיצוי חיץ עם 10% proteinase ק אלה משלימים את הפעולה של NaOH על אגרגטים אלה על ידי המסת חלבונים מפוגל כמו lysate נכנס ערוצי שאיפה. הדבר מונע סתימת ערוצי במהלך המבצע. </li></ol></li><li style=";text-align:right;direction:rtl"> הכנת monolayers התא בשקופיות קאמרית זהירות: השתמש ברדס תרבית תאים עבור culturing התאים ולטפל ציוד על פי התקנות שנקבעו על ידי קצין הבטיחות הביולוגי של המעבדה. הערת דרישות מיוחדות של שורות תאים ספציפיות להתאים את הפרוטוקול וציוד בהתאם. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> השתמש תא חממות תרבות (ב 5% CO 2 ו ב 37 ºC) לתרבות והרחבת התאים להיות בדוגמת. בצע את ההתרחבות באמצעות פרוטוקולי תרבית תאים סטנדרטיים 17,18 צלוחיות T. השתמש בחומרי הדפסת culturing לפי דרישות של cel הספציפיl קו (למשל, סרום אנטיביוטיקה בתוספת DMEM עבור culturing MCF7 ו MDAMB 231). </li><li style=";text-align:right;direction:rtl"> בהגיעו מפגש תא צלוחיות תרבות, trypsinize ולאסוף תאים וזרעי 2 × 10 5 תאים / 2 ס&quot;מ בכל אחת השקופיות 2 קאמרית עבור דפוסים והתרבות מעל 48 שעות. השתמש תאים באחד החדרים כביקורת על גדילת תא כדאי. </li><li style=";text-align:right;direction:rtl"> בהגיעו מפגש תא בשקופיות הקאמריות, דגירת התאים במשך 45 דקות עם 500 פתרון לצבוע μl תא-גשש (למשל, ירוק - CMFDA או כתום - CMRA) בשעת 10 ריכוז מיקרומטר ערוך סרום ללא בינוני. הדבר נעשה להדמית תא במהלך דפוסים. שוטף את התאים שכותרתו עם PBS על ידי שטיפת כל תא בעדינות בעזרת פיפטה, ולאחר מכן תרבות תאי מדיה-בתוספת סרום עבור ניסויי דפוסים. </li><li style=";text-align:right;direction:rtl"> השג תמונת ייחוס של פני התא מוכתם תאי הגשש לצורך ספירת תאים. הדבר נעשה על מנת להבטיחconfluency של שכבת התאים. בנוסף, הוא משמש ככלי עזר עבור ניסויי כימותים אם התאוששות מדגם וניתוח DNA הם מטרות. הערה: במקרה זה כדאיות התא תוערך במהלך דפוסים, התאים יכולים להיות מוכתם ערכת cytotoxicity Live / Dead בהתאם להוראות היצרן. </li></ol></li></ol> 2. יצירת מאסר זרימת הידרודינמית המבנה ההיררכי (hHFC) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הזז את MFP מעל monolayer תא עד למרחק פער של 50 מיקרומטר משקופית הזכוכית. מרחק פער זה תוך הבטחת מגע של hHFC בחשבון גם משטח בשכבה וריאציה עובי. </li><li style=";text-align:right;direction:rtl"> להזריק NaOH ב -6 או 8 μl / min דרך i2. הערכת ספיקות אחרות (כלומר, ש I1, ש A1 ו- Q A2) באמצעות חוקי הזרימה באיור 3. </li><li style=";text-align:right;direction:rtl"> לווסת את גודל HFC הפנימי על ידי שינוי היחס של Q I2 / Q I1 באמצעות מזרקי ההזרקה.לדוגמה, השתמש Q I1 בין 1.3 μl / min ו -4 μl / דקה, עם ש I2 קבוע ב 8 μl / min, שתוצאתה טביעת רגל NaOH של 150 - 300 תאים (100 - 200 מיקרומטר 2 / תא) ( 3D איור). </li><li style=";text-align:right;direction:rtl"> להזריק בינוני מלא מן הפתחים-החיצוניים ביותר על ראש MFP בקצב זרימה של 20 μl / min לתת דין וחשבון על אידוי של התקשורת ושל השאיפה במהלך המבצע של hHFC. </li></ol> 3. monolayers תא דפוסי שימוש hHFC הערה: תבנית הסריקה קובעת בתחומים בשכבת התא שבו התאים מחולצים (דפוסי תוסף), עוזבים את התאים הנותרים ללמוד שאלות ביולוגיות ספציפיות. דפוס זה יכול להיות קווים ישרים או מערך של כתמים, למשל. תבניות מורכבות דורשות עיצוב של מסלול סריקה מתאים. לדוגמא, מסלול סריקה משובץ מספק רשת של אזורי תא (מוצג למשל איור 4 א </strong&gt;), אשר יאפשר אשר בדק את השפעתו של גירויים שונים על תאי ריבועים שונים בעת היותו בסמיכות. ניתן ליצור דפוסים אלה באמצעות שליטה בשלבי XY של הפלטפורמה, שבו תוכנות השליטה מאפשרת scripting של מסלולי סריקה עבור ראש MFP על monolayer התא. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הגדר את תוכנת הבמה כדי לסרוק את ראש הבדיקה על monolayer התא בדפוסים המוגדר על ידי משתמש (על ידי הגדרת X, Y ו- Z קואורדינטות) בכל מהירות סריקה של 10 מיקרומטר / s במרחק פער של 50 מיקרומטר. </li><li style=";text-align:right;direction:rtl"> עם hHFC מקוננות במבצע במגע עם monolayer, לסרוק את MFP עם מסלולו של התבנית הרצויה לבצע הסרת תא בדוגמת. </li><li style=";text-align:right;direction:rtl"> עבור שיתוף תרבות לאחר הסרת תאי הסוג הראשונה, זרע קו תאים שונה כדי למלא את הפערים, תוך שימוש בשיטות המתוארות בסעיף 1.5. לעבור בין מצבים מקוננים וצבטו (על ידי הגדלת מרחק פער, למשל) כדי לשלוט הסרת תאים. הערה: מהירות הסריקה יכולה להיות investiמגודר עבור שורות תאים אחרות. מהירויות הסריקה המשמשות להסרת תאים להשלים תופעות הפגנה הזאת מעל האזורים סרקו את שטח שורות תאים בשימוש. </li></ol> 4. עיבוד במורד זרם עבור הגברת הדגימה ו- DNA <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן את תחנת דגימה לניתוח במורד הזרם של lysate. עבור תחנת הדגימה, להשתמש 3D מודפס 8-פס בעל צינור PCR. לחלופין, בחר בעל צינור מתאים לשמש מתאם זה, שהוא מסוגל להיות רכוב בטווח סריקה של הראש מחוץ המצע. נגב את בעל צינור עם 70% אתנול או decontaminants משטח אחר המבוססים על חומרא הרצוי עבור היישום. השתמש קליפ מגנטי על בעל צינור לצרף אותו על בעל המצע. </li><li style=";text-align:right;direction:rtl"> לאחר הכנת תחנת הדגימה, מקמו את מיקרומטר MFP ראש 100 מ בשכבה. בגין הפעלת hHFC עם 50 פתרון המ&quot;מ NaOH בעוד נוזל העיבוד לערוץ ההזרקה הפנימי עם ספיקות של 1, 6, -7 ו -17.5 μl / min ש I1, I2 Q, Q A1 ו- Q A2 בהתאמה. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לאחר כליאת הזרימה התייצבה (ב כ 10 שניות), יורד ראש החללית למרחק פער של 50 מיקרומטר לבצע תמוגה מקומית המבוססת NaOH של תת-האוכלוסייה הנבחרת של תאים עם hHFC. לאחר תמוגה של האוכלוסייה משנה תושלם (כ -30 שניות לכל טביעת הרגל), לכוון את הראש כלפי הצינורות בתחנת הדגימה. הוצא את lysate שנאסף לתוך צינורות PCR ישירות (איור 6). </li></ol></li><li style=";text-align:right;direction:rtl"> עבור עיבוד במורד הזרם של lysate, הראשון לנטרל את ה- pH של התמיסה על ידי ערבוב של lysate עם טריס חיץ (1: 1). לאחר נטרול, לחמם את lysate ל -95 ºC למשך 30 דקות. ואז ישירות לטעון את lysate לתוך עבודת qPCR סטנדרטית כפי שנקבע על ידי ספק של המכשיר. </li></ol>

<ol>
	<li>Th&#233;ry, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Micropatterning+as+a+tool+to+decipher+cell+morphogenesis+and+functions.">Micropatterning as a tool to decipher cell morphogenesis and functions.</a> J. Cell Sci. 123 (Pt 24), 4201-4213 (2010).</li><li>Goubko, C. A., Cao, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patterning+multiple+cell+types+in+co-cultures:+A+review.">Patterning multiple cell types in co-cultures: A review.</a> Mater. Sci. Eng. C. 29 (6), 1855-1868 (2009).</li><li>Kaji, H., Camci-Unal, G., Langer, R., Khademhosseini, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+systems+for+the+generation+of+patterned+co-cultures+for+controlling+cell-cell+interactions.">Engineering systems for the generation of patterned co-cultures for controlling cell-cell interactions.</a> Biochim. Biophys. Acta. 1810 (3), 239-250 (2011).</li><li>Cho, C. H., Park, J., Tilles, A. W., Berthiaume, F., Toner, M., Yarmush, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Layered+patterning+of+hepatocytes+in+co-culture+systems+using+microfabricated+stencils.">Layered patterning of hepatocytes in co-culture systems using microfabricated stencils.</a> Biotechniques. 48 (1), 47-52 (2010).</li><li>Sch&#252;tze, K., Lahr, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+expressed+genes+by+laser-mediated+manipulation+of+single+cells.">Identification of expressed genes by laser-mediated manipulation of single cells.</a> Nat. Biotechnol. 16 (8), 737-742 (1998).</li><li>Salazar, G. T. A., Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Micropallet+arrays+for+the+separation+of+single,+adherent+cells.">Micropallet arrays for the separation of single, adherent cells.</a> Anal. Chem. 79 (2), 682-687 (2007).</li><li>Guillaume-Gentil, O., Zambelli, T., Vorholt, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+single+mammalian+cells+from+adherent+cultures+by+fluidic+force+microscopy.">Isolation of single mammalian cells from adherent cultures by fluidic force microscopy.</a> Lab Chip. 14 (2), 402-414 (2014).</li><li>Iwata, F., Adachi, M., Hashimoto, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single-cell+scraper+based+on+an+atomic+force+microscope+for+detaching+a+living+cell+from+a+substrate.">A single-cell scraper based on an atomic force microscope for detaching a living cell from a substrate.</a> J. Appl. Phys. 118 (13), (2015).</li><li>Riahi, R., Yang, Y., Zhang, D. D., Wong, P. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+wound-healing+assays+for+probing+collective+cell+migration.">Advances in wound-healing assays for probing collective cell migration.</a> J. Lab. Autom. 17 (1), 59-65 (2012).</li><li>Juncker, D., Schmid, H., Delamarche, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multipurpose+microfluidic+probe.">Multipurpose microfluidic probe.</a> Nat. Mater. 4 (8), 622-628 (2005).</li><li>Kaigala, G. V., Lovchik, R. D., Delamarche, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidics+in+the+&amp;#34;open+space&amp;#34;+for+performing+localized+chemistry+on+biological+interfaces.">Microfluidics in the &amp;#34;open space&amp;#34; for performing localized chemistry on biological interfaces.</a> Angew. Chem. Int. Ed. Engl. 51 (45), 11224-11240 (2012).</li><li>Qasaimeh, M. A., Gervais, T., Juncker, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+quadrupole+and+floating+concentration+gradient.">Microfluidic quadrupole and floating concentration gradient.</a> Nat. Commun. 2 (May), 464 (2011).</li><li>Christ, K. V., Turner, K. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+of+hydrodynamically+confined+microfluidics:+controlling+flow+envelope+and+pressure.">Design of hydrodynamically confined microfluidics: controlling flow envelope and pressure.</a> Lab Chip. 11 (8), 1491-1501 (2011).</li><li>Autebert, J., Kashyap, A., Lovchik, R. D., Delamarche, E., Kaigala, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hierarchical+hydrodynamic+flow+confinement:+efficient+use+and+retrieval+of+chemicals+for+microscale+chemistry+on+surfaces.">Hierarchical hydrodynamic flow confinement: efficient use and retrieval of chemicals for microscale chemistry on surfaces.</a> Langmuir. 30 (12), 3640-3645 (2014).</li><li>Kaigala, G. V., Lovchik, R. D., Drechsler, U., Delamarche, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Vertical+Microfluidic+Probe.">A Vertical Microfluidic Probe.</a> Langmuir. 27 (9), 5686-5693 (2011).</li><li>Cors, J. F., Lovchik, R. D., Delamarche, E., Kaigala, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+compact+and+versatile+microfluidic+probe+for+local+processing+of+tissue+sections+and+biological+specimens.">A compact and versatile microfluidic probe for local processing of tissue sections and biological specimens.</a> Rev. Sci. Instrum. 85 (3), 034301 (2014).</li><li>Pollard, J. W., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Basic Cell Culture Protocols. , (1997).</li><li>Mitry, R. R., Hughes, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+cell+culture+protocols.">Human cell culture protocols.</a> Methods Mol. Biol. Springer. 531 (1), (2012).</li><li>Sakai, K., Ushida, T., Nagase, T., Nakamigawa, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+cell+detachment+by+shear+stress.">Quantitative analysis of cell detachment by shear stress.</a> Mater. Sci. Eng. C. 17 (1-2), 55-58 (2001).</li><li>Rodriguez, N. M., Desai, R. A., Trappmann, B., Baker, B. M., Chen, C. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Micropatterned+multicolor+dynamically+adhesive+substrates+to+control+cell+adhesion+and+multicellular+organization.">Micropatterned multicolor dynamically adhesive substrates to control cell adhesion and multicellular organization.</a> Langmuir. 30 (5), 1327-1335 (2014).</li><li>Tasoglu, S., Demirci, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioprinting+for+stem+cell+research.">Bioprinting for stem cell research.</a> Trends Biotechnol. 31 (1), 10-19 (2013).</li></ol>

The authors have nothing to disclose.

אנו מציגים פרוטוקול צדדי עבור דפוסי התוסף של monolayers תא, המאפשרים לדור מהיר של תבניות תא מוגדרות מרחבית. תמוגה סלקטיבי של monolayers התא מתבצעת באמצעות NaOH בעוד נוזל עיבוד hHFC. NaOH מידה denatures החלבונים הכלולים קרום התא. אנו ממליצים על שימוש של ריכוז 50 מ&quot;מ של NaOH כדי להבטיח עיבוד במורד הזרם של lysate. ריכוז זה יכול להיות מוגבר להסרת תאים מהירים יותר, העיבוד במורד זרם lysate שסופק אינו אובייקטיבי. HHFC מבטיח כי בסביבותיה לא מעובדים של monolayer תא נותרות בעינן וזמינים גם הרחבת דפוס או חיטוט נכסים נוספים של התאים. שיעור הסרת תאים היא פונקציה של שני בכימיה גזירה שהציג את הזרימה. אנחנו בוחרים טווח הפעלה של ספיקות יש הסרת תאי כימיה דומיננטית. מהירויות סריקה של 10 - 20 &amp; #181; מ &#39;/ שני באמצעות קצב זרימת הזרקת NaOH של 6 - 8 μl / min משמש כדי להקל דפוסי תוסף&#39; מהירים &#39;. הקצב המהיר של הסרת תאים כמה כתובות אתגרים העומדים בפני דפוס משטח דפוסים מבוססי גישות 20,21. שיטות אלו דורשים מנגנון שמגביל את הצמיחה של תאים באזורים המוגדרים מרחבית, למשל, על ידי בתצהיר סלקטיבית של חלבונים הידבקות התא באמצעות הדפסה מיקרו מגע וזריעה הבאות של תאים כדי להשיג את התבנית. הם מוגבלים על ידי תפוקה נמוכה ודורשים כמה צעדים רציפים עבור דור דפוס וכן חותמת / סטנסיל חדשה עבור כל תבנית. השיטה המתוארת אינה דורשת צמיחה סלקטיבית של תאים על אזורים מוגדרים, מתגברת מספר מגבלות על ידי ביצוע דפוסי תוסף בניגוד הדפסה, בעוד שאינה דורש כל טיפול נוסף של מצע תרבית תאים. עם הפרוטוקול המתואר במאמר זה, התפוקה של monolayers תא דפוסיםהוא גדל, תוך קבלת משוב חזותי מיידי של הדפוס שנוצר. זה הופך לפשוט שינוי בזמן אמת של תבניות. שליטה כזו תהיה חיונית תרחישים בהם כדאיות התא על משטח נתון אינה הומוגנית. יתרון נוסף של השיטה הוא אותו הראש והכימיה יכולים לשמש כדי ליצור דפוסים מרובים, ובכך להפחית את מספר הצעדים המעורבים ביצירת monolayer תא בדוגמת. הממדים של הערוצים בראש גיאומטרית הראש וניתן לשנותם בהתאם לדרישות של היישום, ובכך מאפשרים שליטה על ההחלטה של ​​הדפוסים. כל הניסויים בעבודה הנוכחית בוצעו באמצעות ראש MFP עם ממדי צמצם קבועים, במיוחד עם פתחים פנימיים ב 100 × 100 מיקרומטר ו פתחים חיצוניים ב 200 × 100 מיקרומטר. עיצוב זה עם פתחים חיצוניים גדולים נבחר על מנת להבטיח פעולה רציפה של hHFC מבלי לסתום של הפתחים ידיפסולת תא תועה. בדקנו ראשים עם ממדי צמצם פנימיים 50 × 50 מיקרומטר ו 50 מיקרומטר רווחים ביניהם, עם תוצאות מוצלחות הסרת תאים. השתמש פתחים קטנים, עד 10 × 10 מיקרומטר עם 10 מיקרומטר מרווחים, ותאפשר דרוגים לגודל טביעת רגל קטן יותר (~ 30 × 30 מיקרומטר), ובכך לאפשר רזולוציה גבוהה דפוסים. צפינו ונושאים תפעוליים עם צמצם בגדלים קטן יותר מ -10 מיקרומטר עקב סתימה מ וחלקיקים. בגלל קשיים תפעוליים כגון, 100 מיקרומטר הוא הגבול הנוכחי של רזולוציה ולכן מגבלה של הטכניקה המתוארת. עם זאת, אנו יכולים לתת מענה זה באמצעות היכולת בעיצוב הנוזלית של hHFC. אנחנו הוכחנו כי ההחלטה של הסרת תאים יכולה להיות מכוונת עבור קבוצת נתונה של ממדי צמצם ידי השליטה ש I2 / Q ט &#39;1 (איור 4 ב) ופער איפקס אל מצע 10,14. השלבים המשמשים העבודה הנוכחית יש גודל צעד מינימאלי של 100 ננומטר.שילוב של פרמטרים לשליטה אלה יכול לשפר את הרזולוציה המרחבית של הסרת תאים במונחים של גודל טביעת הרגל ומרחק סריקה. אם שיתוף תרבויות בדוגמת הם רצויים כדי לחקור אינטראקציות תאי תאים ספציפיות בין סוגי תאים שונים, זריעת רציפי דפוסים יכולים להתבצע באמצעות הפרוטוקול המתואר. לבסוף, DNA amplifiable באיכות גבוהה ניתן להשיג מן lysate, כפי שבאו לידי ביטוי על ידי השיא היחיד ב- DNA להמס עקומה (ראה איור 7). הערכנו כמות ה- DNA של כ -1.6 ng מן טביעת רגל אחת (כ -300 תאים) באמצעות qPCR, מקורב הציפייה תיאורטית (6-8 pg / תא). דבר זה מצביע על כמות ה- DNA החילוץ המתאים מספר תהליכים במורד תוך שלילת שימוש בכל שיטות בידוד DNA. זה פותח אפיקי DNA-ניתוח מקומי מבוסס חיטוט של תאים בתרבית. היכולת של hHFC לעצב נוזלים יכול לשמש גם להפקיד תאים וחלבונים חיו על acמשטחי tivated, אשר בשילוב עם דפוסי התוסף ושיתוף culturing הרציף שהוצגו בפרוטוקול זה מאפשר יצירת דפוסי תא ותא-מטריצה ​​מורכבים על מצעי תרבות. הרבגוניות ואת השליטה המתאפשרת על ידי דפוסי תוסף מבוססים hHFC של monolayers תא ואת האפשרות של ביצוע ניתוח דנ&quot;א על ​​תאי חילוץ, מספק כלי חדש ורב עצמה מוגדרת ביולוגים לבצע מחקרים שכללו אינטראקציות תא נפתרו מרחבית.

בסביבה מולדתם, תאים ברקמות ביולוגיות תופסים מגוון של רמזים ביוכימיים ופיזיים בהכוונת הצמיחה, הארגון שלהם, ופיתוח. הבנת רמזים אלה מחייב חקירה סלקטיבית של אינטראקציות תאים תאים ותא-מטריקס. זה מחייב פיתוח של שיטות monolayers התא דפוסים. שיטות תאים מסוגים שונים נפרדים גיאומטרי בתרבות (דפוסים) לאפשר לימודים רחבים של רמזים פיסיים וכימיים בביולוגיה של תא. רוב הגישות הנוכחיות עבור שכבות תאי דפוסים 1 - 4 תלוי הפקדת חלבונים-הידבקות תא על גבי משטחים או באמצעות שבלונות microfabricated לצמיחה סלקטיבית על מצעים. לעומת זאת, כאן אנו מציגים שיטת monolayers תא דפוס במהירות באתרו, כלומר, תאים בתרבית, על ידי הסרת תאים באזורים נבחרים של בשכבה. שיטות מבצע דפוסי תוסף כזה 5 - 9 usually דורש מצעים מיוחדים, טיפול פני שטח, מבצע מורכב, מגע פיזי או אבלציה באמצעות ליזר, המשפיע על תאי חיים בטעות. אנחנו כאן להשתמש בדיקת microfluidic (MFP) 10,11, טכנולוגית microfluidic סריקה ללא מגע כי hydrodynamically תוחמת נוזל על מצע. אחד המרכיבים החשובים של MFP הוא ראש microfabricated המכיל microchannels (איור 1). הפלטפורמה הקשורה מורכבת משאבות מזרק לבקרה נוזלית, בשלבים לסריקה מלא מיקרוסקופ הפוכה להדמיה ומשוב (איור 2). בתצורה הבסיסית שלו, ראש MFP כולל שני microchannels עם פתחים בשיא, אחד להזרקת נוזל עיבוד ושני עבור aspirating נוזל העיבוד מוזרק יחד עם מעט נוזל טבילה (איור 3 א). במהלך מבצע MFP, איפקס הוא במרחק קבוע מן המצע. כאשר קצב זרימת שאיפה (QA) הוא sufficiently גבוה משיעור זרימת זריקה (אני Q), כלומר, Q א: Q אני ≥ 2.5, נוזל העיבוד מוגבל על פני המצע. התוצאה היא כליאה זרימה הידרודינמית (פיקוד העורף). האזור שבו נוזל העיבוד נמצא בקשר ישיר עם המצע נקרא את טביעת הרגל. לקבלת תנאי הפעלה טיפוסיות, את זרימת נוזל העיבוד בתוך HFC מאופיין מספר ריינולדס נמוך (Re ≈ 10 -2) ומספר Péclet הגבוה (PE ≈ 10 2). זה מרמז תזרימי נזילים המשטר למינרית בלהיות הסעה במצב הראשוני של העברת מסה של לתרכובות כימיות. המודלים המספריים ואנליטית כליאת זרימה מתואר במקומות אחרים 12 - 14. במאמר זה, אנו משתמשים בגישה של נוזלי עיבוד מרובים כליאת זמנית, אשר נקראת HFC ההיררכי (hHFC) 14. כדי ליישם hHFC עם MFP, שני additionaפתחי l נדרשים לספק מקור משני של הזרקה ושאיפה. זה מאפשר לנו להגביל נוזל אחד בתוך נוזל שני. היתרונות הפנימיים (עיבוד) הנוזלים מלהיות מוגנים מפני פסולת תועה על פני המצע על ידי הנוזל החיצוני (מיגון). בנוסף, hHFC מאפשר פעולה בשני מצבים: (i) המצב המקונן, שבו נוזל העיבוד במגעי HFC הפנימיים פני השטח (איור 3), וכן (ii) במצב הצבוט, שבו הנוזל הפנימי מאבד קשר רק הנוזל החיצוני נמצא בקשר עם המצע (איור 3 ג). מעבר בין שני המצבים מאפשר למשתמשים לבצע או להפסיק את טיפול המצע מושג על ידי שליטה על הראש-קרקע הפער או על ידי שינוי היחס בין שני שיעורי זרימת ההזרקה (Q i2 / Q i1). עבור גיאומטרית ערוץ נתונה, את טביעת הרגל של נוזל העיבוד על פני המצע יכולה להיות נשלטה על ידי ויסות תנאי זרימה (איור 3D). נתרן hydrתחמוצת (NaOH) משמשת נוזל העיבוד הפנימי lyse התאים, ואת lysate הוא aspirated ברציפות מפני השטח. מכיוון ההשפעות הכימיות של נוזל העיבוד הן נקודות כדי טביעת רגל HFC הפנימית, מהתאים הסמוכים להישאר רגועים, המאפשר מחקרי spatiotemporal של אינטראקציות תאי תאים. פונקציונלי הסריקה של MFP מאפשרת יצירת גיאומטריות המוגדרים על ידי משתמש של דפוסי תא (איור 4). יתר על כן, הבחירה של NaOH כמו נוזל עיבוד להכיל ניתוח דנ&quot;א במורד הזרם (איור 7).

<table border="0" cellpadding="0" cellspacing="0" width="870">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:291px;">Materials</td>
			<td style="width:235px;"></td>
			<td style="width:119px;"></td>
			<td style="width:227px;"></td>
		</tr>
		<tr height="101">
			<td height="101" style="height:101px;width:291px;">Microfluidic Probe (MFP)</td>
			<td style="width:235px;">NA</td>
			<td style="width:119px;">NA</td>
			<td style="width:227px;">Silicon/glass hybrid probe head with channels patterned in silicon. Fabrication done in-house at IBM Research - Z&#252;rich</td>
		</tr>
		<tr height="100">
			<td height="100" style="height:100px;width:291px;">Lab Tek II Chamber slides with 2 chambers</td>
			<td style="width:235px;">ThermoFisher scientific, USA</td>
			<td style="width:119px;">154461</td>
			<td style="width:227px;">2 Chamber chamber slides for cell culture with each chamber providing an area of 4 cm^2 and capable of holding upto 3 ml of media volume</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:291px;">Chemicals and cell lines used</td>
			<td style="width:235px;"></td>
			<td style="width:119px;"></td>
			<td style="width:227px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:291px;">Sodium Hydroxide, Tris-Cl, Ethylenediaminetetraaceticacid, Rhodamine B</td>
			<td style="width:235px;">SigmaAldrich chemicals, USA</td>
			<td style="width:119px;">S5881, 252859,&#160; E9884, R6626</td>
			<td style="width:227px;">Chemicals used for processing and shielding liquids</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:291px;">Proteinase K</td>
			<td style="width:235px;">Qiagen, Germany</td>
			<td style="width:119px;">19131</td>
			<td style="width:227px;">protease to digest denatuired proteins</td>
		</tr>
		<tr height="60">
			<td height="60" style="height:60px;width:291px;">Deconex 16 Plus</td>
			<td style="width:235px;">Bohrer Chemie, Switzerland</td>
			<td style="width:119px;">NA</td>
			<td style="width:227px;">Universal cleaning agent for labaratory consumables. Used for non stringent cleaning.</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:291px;">DNA away&#160;</td>
			<td style="width:235px;">ThermoFisher scientific, USA</td>
			<td style="width:119px;">7010</td>
			<td style="width:227px;">Surface decontaminant that denatures DNA and DNAases.</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:291px;">DMEM, high glucose, GLUTAMAX supplement</td>
			<td style="width:235px;">ThermoFisher scientific, USA</td>
			<td style="width:119px;">10566-016</td>
			<td style="width:227px;">Culturing medium for epithelial cells.</td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:291px;">CellTracker Green CMFDA dye</td>
			<td style="width:235px;">ThermoFisher scientific, USA</td>
			<td style="width:119px;">C7025</td>
			<td rowspan="2" style="width:227px;">Membrane permeant live cell labeling dye. Dye active for 72 hours.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:291px;">CellTracker Orange CMRA dye</td>
			<td style="width:235px;">ThermoFisher scientific, USA</td>
			<td style="width:119px;">C34551</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:291px;">&#946;-actin genomic primers for qPCR</td>
			<td style="width:235px;">Integrated DNA technologies, USA</td>
			<td style="width:119px;">NA</td>
			<td style="width:227px;">Custom oligos used for DNA quality validation and qPCR.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:291px;">MCF7 breast carcinoma cells</td>
			<td style="width:235px;">ATCC, USA</td>
			<td style="width:119px;">ATCC HTB-22</td>
			<td rowspan="2" style="width:227px;">Cell lines used to produce co-cultures.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:291px;">MDA-MB-231 breast carcinoma cells</td>
			<td style="width:235px;">ATCC, USA</td>
			<td style="width:119px;">ATCC HTB-26</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:291px;">Equipment and fluidic connections</td>
			<td style="width:235px;"></td>
			<td style="width:119px;"></td>
			<td style="width:227px;"></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:291px;">Motorized high precision stages</td>
			<td style="width:235px;">Custom machined components.&#160; Linear axis motors from LANG GmBH, Germany</td>
			<td style="width:119px;">Customized linear axis stages from LT series</td>
			<td style="width:227px;">3 &#215; LT for 3 axes. LSTEP controller used for interfacing stages and PC through RS 232 port.</td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:291px;">Syringes</td>
			<td style="width:235px;">Hamilton, Switzerland</td>
			<td style="width:119px;">1700 TLLX series</td>
			<td style="width:227px;">Interchangeable with syringes provided by other manufacturers with a 250-500 &#181;l range.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:291px;">Nemesys low pressure syringe pumps</td>
			<td style="width:235px;">cetoni GmbH, Germany</td>
			<td style="width:119px;">NA</td>
			<td style="width:227px;">Component of pumping station.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:291px;">Circular M1-connector</td>
			<td style="width:235px;">Dolomite microfluidics, United Kingdom&#160;</td>
			<td>3000051</td>
			<td style="width:227px;">Interface between vias in MFP head and tubing</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:291px;">Tilt/rotation stage Goniometer</td>
			<td style="width:235px;">OptoSigma, USA</td>
			<td style="width:119px;">KKD-25C</td>
			<td style="width:227px;">Goniometer to adjust coplanarity of MFP apex</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:291px;">DS Fi2 HD color camera (CCD)&#160;</td>
			<td style="width:235px;">Nikon, Switzerland</td>
			<td style="width:119px;">NA</td>
			<td style="width:227px;">Controlled using DS-U3 controller unit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:291px;">Software</td>
			<td style="width:235px;"></td>
			<td style="width:119px;"></td>
			<td style="width:227px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:291px;">Win - Commander</td>
			<td style="width:235px;">LANG GmBH, Germany</td>
			<td style="width:119px;">NA</td>
			<td style="width:227px;">Stage control software.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:291px;">Qmix Elements</td>
			<td style="width:235px;">cetoni GmbH, Germany</td>
			<td style="width:119px;">NA</td>
			<td style="width:227px;">Pump control software.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:291px;">NIS Elements</td>
			<td style="width:235px;">Nikon, Switzerland</td>
			<td style="width:119px;">NA</td>
			<td style="width:227px;">Basic research module for image acquisition and analysis.</td>
		</tr>
	</tbody>
</table>

rapid subtractive patterning of live cell layers with a microfluidic probe

החללית microfluidic (MFP) הופך לפשוט ביצוע כימיה המקומית על מצעים ביולוגיים ידי כליאת כרכים nanoliter של נוזלים. באמצעות יישום המיוחד של MFP, כליאת הזרימה הידרודינמית ההיררכית (hHFC), נוזלים מרובים מובאים במקביל מגעים עם מצע. פעולה כימית מקומית ועיצוב נוזלי באמצעות hHFC, מנוצל כדי ליצור דפוסי תא על ידי מקומי lysing והסרת תאים. על ידי ניצול יכולת הסריקה של MFP, דפוסים המוגדר על ידי משתמש של monolayers תא נוצרים. פרוטוקול זה מאפשר דפוסים תאים מהירה, בזמן אמת ומבוקר מרחבית, אשר יכול לאפשר מחקרים אינטראקציה תאים תאים ותא-מטריקס סלקטיבית.

הפרוטוקול המתואר עבור דפוסי תוסף מהירים של monolayers התא מודגם באמצעות פלטפורמת MFP מרכיב רבה (איורים 1 ו -2). הפרוטוקול מעסיק כליאת הזרימה הידרודינמית ההיררכית (hHFC; איור 3) כדי מקומית לטפל ולהסיר תאי monolayers תא, באמצעות NaOH בעוד נוזל העיבוד. תצורת hHFC כוללת HFC פנימי לבין פיקוד עורף חיצוני. מרותק NaOH ב hHFC הפנימי מציג פעולה כימית גזירה על התאים במגע. בתוך טביעת רגל זה, התאים נחשפים בצורה הומוגנית על הפעולה הכימית של NaOH, בשל העברת מסה מונעת הסעה בתוך עם דיפוזיה זניח לאזור מחוץ הכליאה. גזירה על התאים מצד שני, ניתן לשנות על ידי שינוי קצב הזרימה של NaOH. כדי לפשט פרמטרים תפעוליים, בחרנו לעשות פעולה כימיה המנגנון הדומיננטי של הסרת תאים בהשוואת הגזירה. ללהעריך את כוח הגזירה שמיישם hHFC על פני השטח, מודל סופי, אלמנט נבנה באמצעות Comsol Multiphysics 5.0. סימולציות נוהלו באמצעות מודול CFD לתזרימי למינרית. שני תנאי שפת כניסה אל פתחי הזרקת הגיאומטריה ושני תנאי שפה מוצאים אל פתחי השאיפה (איור 5) יושמו עבור הטווח של ספיקות וממדי צמצם המשמש בהפגנה הנוכחית. במודל שנתקבל, חוקי הזרימה הכתיבו את פרופיל הגזירה, ואילו הספיקות הגדירו את סדר הגודל של הגזירה על פני השטח. למעשה, שילוב של שניהם קובע אם hHFC קשרי פני השטח. שמירה על גורמים אלה בחשבון, יצאנו כדי למצוא מגוון רחב של ספיקות לפעולה על מנת להשיג סרת תא דומיננטית מבחינה כימי. כדי ליצור hHFC, נשתמש כלל זרימת שאיפה הכוללת יחס קצב זרימת הזרקה של 3.5. כללי זרימת אחרים המשמשים הוגדרו למזער סתימה בתוך הערוצים שהאיפה,אשר יכול להיגרם על ידי חלבונים מפוגלים דבק משטחי הערוץ. באמצעות המודל שפותח, מצאנו ספיקות בין 5 ל 10 μl / min תרגום כדי מתח גזירה בין 1 ו -3 N / m 2. ללא ההשפעה הכימית של NaOH, למשל במקרה של מיצוי חיץ, מאמץ הגזירה לא יהיה גבוה מספיק כדי להסיר את התאים 19. בטווח שנצפה, נציין כי מבצע ברמות ספיקה גבוהה יותר מעשי בשל הפרעות בנתיב הזרימה ברמות ספיקת שאיפה נמוכה (כלומר, ש I2 &lt;4 μl / min) בשל פסולת תא באפיקים. בהתחשב בפרופיל גזירה למד ושיקולים מעשיים, ספיקות NaOH (I2 Q) של 6 ו -8 μl / min משמשים הניסויים דפוסים ש I1, ש A1 ו- Q A2 על פי חוקי הזרימה שמוצג באיור 3. יחס תזרימי ההזרקה (ש I2 / Q I1) מאפשר us להמשיך לווסת את גודל טביעת הרגל hHFC (איור 3D ואיור 4B), עם העיקרון הבסיסי פירט ידי Autebert et al. 14. באמצעות היכולת הנוזלית בעיצוב hHFC בשילוב עם יכולת סריקה ברזולוציה גבוהה של פלטפורמת MFP, אנחנו מדגימים הדורים לרשת תא חי בקני מידה מרובות ויותר מזה להראות את היישום של הפרוטוקול הנתון בפיתוח שיתוף תרבויות (איור 4C). הפלטפורמה גם מאפשר לנו לבצע אחזור lysate מדגם לניתוח במורד הזרם. כדי להציג את האיכות של lysate שהושג, דגמנו מקומית lysed תאים מאחד וחמישה עקבות בשני ניסויים בלתי תלויים, מראה את הווריאציה בכמויות של DNA המתקבל lysate (איור 7). כאן, אנו DNA מוגבר כלולים lysate באמצעות פריימרים β-יקטין (קדימה: GGATGCAGAAGGAGATCACT הפוכה: CGATCCACACGGAGTACTTG<html> ) באמצעות 4 μl של lysate לניטרול כל תגובת PCR. <img alt="איור 1" src="/files/ftp_upload/54447/54447fig1.jpg" /> מודולים באיור 1. של פלטפורמת MFP ואת הראש. (א) מודולים התפעוליים של הפלטפורמה מהווים ממונע מזרקים, בשלבים ממונעים לבין בקר. שההתקן מחובר הבמה-Z ממונע לשלוט מרחוק הפער בין הראש ואת המצע, ואת בעל המצע מצורף ה- X ו- בשלבים מוטורי Y המהווים את מערכת הסריקה. (ב) ראש MFP יש vias fluidic לחבר את תחנת השאיבה, הרכבה חורים לעגן את הראש על הבמה Z, וערוצים יוצא איפקס מלוטש. איפקס מוגדר coplanar למצע תרבית תאים. הטבעות של סימטרי ניוטון ניתן להבחין כאשר הקודקוד ואת המצע הוא coplanar ובמגע.<html> &quot;Target =&quot; p_upload / 54,447 / 54447fig1large.jpg _ blank &quot;&gt; לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו. <img alt="איור 2" src="/files/ftp_upload/54447/54447fig2.jpg" /> פלטפורמת MFP איור 2.. פלטפורמת הסריקה ברזולוציה הגבוהה מצוידת בעל ראש במכונת התממשקות עם Z-הבמה ממונע דיוק גבוה. בעל המצע מחובר במת XY לסריקה למטרות. עבור התאוששות של lysate לניתוח במורד זרם, תחנת דגימה מודפסת 3D נחתכת מגנטית לצד של בעל המצע (מוצג הבלעה). משאבות מזרק, מיקרוסקופ הפוכה, הבקרים ומציג ממוקמים סביב הפלטפורמה. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/54447/54447fig2large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> 3 &quot;src =&quot; / files / ftp_upload / 54,447 / 54447fig3.jpg &quot;/&gt; איור 3. כליאת זרימת הידרודינמית מבנה היררכית (hHFC) לשליטה במרחב ובזמן של הסרת תאים. (א) סכמטי של פיקוד עורף יחיד. (ב) מקוננות (C) מצב צבט פעולת hHFC. (ד) תמונה של טביעת הרגל עבור שני יחסי זרימת זריקה / שאיפה שונות. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/54447/54447fig3large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 4" src="/files/ftp_upload/54447/54447fig4.jpg" /> איור 4. דפוסי monolayers התא באמצעות MFP. (א) דור Cell-הרשת על ידי סריקה מתוכנת של MFP על monolayer תא מד&quot;א- MB-231. תאים הוכתמו לצבוע תאים גשש ירוק. (ב) טביעת הרגל על יחסי הזרקה השונים (n) על monolayer תא MCF7. סכמטית מראה את השוני הצפוי בצורה של פיקוד העורף הפנימי עם שינוי n. (C) Patterned שיתוף התרבות ידי דפוסי תוסף של monolayer MCF7 ואחריו זריעת תאי מד&quot;א- MB-231 באזורים המופחתים. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/54447/54447fig4large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 5" src="/files/ftp_upload/54447/54447fig5.jpg" /> איור 5. שאר מתח על פני השטח בעת החלת hHFC. מאמץ הגזירה על עליות השטח באופן ליניארי עם קצב זרימת הזרקה הפנימי. הנקודה הגבוהה ביותר הגזירה נמצאת בין שני הפתחים פנימיים (הבלעה ימנית תחתונה), שבו נוזל העיבוד מוגבל (קווי זרימה אדומה, הבלעה שמאלית עליונה). ממדי הצמצם ששמשו במודל הסופי, האלמנט הם 200, 100, 100 ו -200 מיקרומטר עבור i1, i2, a1ו- A2, בהתאמה. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/54447/54447fig5large.jpg" target="_blank">לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 6" src="/files/ftp_upload/54447/54447fig6.jpg" /> מצבי הפעלת איור 6. של פלטפורמת MFP לבצע תא הסרת דפוסים. (א) סכמטי של נתיב הזרימה עבור דפוסי תוסף ידי תמוגה תא. לשם פשטות, רק אחד מכל נתיבי הזרקה ותזרים שאיפה מוצג. המזרקים מלאים באמצעות שסתום ניקוז המשאבות. i1 ו- i2 משמשים להזרקת חיץ מיצוי NaOH, בהתאמה. (ב) סכמטי של נתיב הזרימה להתאוששות lysate. נתיב הזרימה זו מופעלת לאחר איסוף lysate תא לניתוח באמצעות נתיב הזרימה ב (א). <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/54447/54447fig6large.jpg" target="_blank">אנא Clic</a>k כאן כדי לצפות בגרסה גדולה יותר של דמות זו. <img alt="איור 7" src="/files/ftp_upload/54447/54447fig7.jpg" /> איור 7. ניתוח במורד הזרם של דנ&quot;א lysate התא באמצעות qPCR. (א) מגרשים הגברה של ה- DNA lysate מופק 5 עקבות (5 FP) ו -1 טביעת הרגל (1 FP). בקרות חולצו לאחר איסוף lysate עבור בשני המקרים. (ב) ממיסים עקומות של דנ&quot;א מוגבר מן lysate מראה את האיכות של ה- DNA חילוץ. qPCR בוצע (N = 2, n = 3) כדי להגביר את גן β-יקטין. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/54447/54447fig7large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור S" src="/files/ftp_upload/54447/54447figS.jpg" /> איור S1. תמונה מותאמת של עיצוב ערוץ ראש MFP 6 ערוציםערוצים המשמשים בניסויי דפוסים. ביצוע hHFC הם 200, 100, 100, 200 מיקרומטר רחב, ו 100 מיקרומטר עמוקים. שני הערוצים החיצוניים, אשר לחדש נוזל טבילה הם 500 מיקרומטר רחב ו 100 מיקרומטר עמוקים. קובץ GDS עבור אותו העיצוב סופק בתור משלים למאמר זה. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/54447/54447figSlarge.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a>

Watch this Scientific Journal Video about Rapid Subtractive Patterning of Live Cell Layers with a Microfluidic Probe at JoVE.com

Rapid Subtractive Patterning of Live Cell Layers with a Microfluidic Probe

We present a protocol to perform subtractive patterning of live cell monolayers on a surface. This is achieved by local and selective lysis of adherent cells using a microfluidic probe (MFP). The cell lysate retrieved from local regions can be used for downstream analysis, enabling molecular profiling studies.

דפוסי Subtractive מהירים של שכבות תא חיות עם בדיקת Microfluidic

The microfluidic probe (MFP) facilitates performing local chemistry on biological substrates by confining nanoliter volumes of liquids. Using one ...

rapid-subtractive-patterning-live-cell-layers-with-microfluidic

Universidad de Cartagena UDEC

Research

JoVE Journal

Bioengineering

7.0K Views.  IBM Research - Zurich. We present a protocol to perform subtractive patterning of live cell monolayers on a surface. This is achieved by local and selective lysis of adherent cells using a microfluidic probe (MFP). The cell lysate retrieved from local regions can be used for downstream analysis, enabling molecular profiling studies.

Video: Rapid Subtractive Patterning of Live Cell Layers with a Microfluidic Probe

Measurement of Bioelectric Current with a Vibrating Probe

Electric fields, generated by active transport of ions, are present in many biological systems and often serve important functions in tissues and organs. For example, they play an important role in directing cell migration during wound healing. Here we describe the manufacture and use of ultrasensitive vibrating probes for measuring extracellular electric currents. The probe is an insulated, sharpened metal wire with a small platinum-black tip (30-35 &mu;m), which can detect ionic currents in the &mu;A/cm2 range in physiological saline. The probe is vibrated at about 200 Hz by a piezoelectric bender. In the presence of an ionic current, the probe detects a voltage difference between the extremes of its movement. A lock-in amplifier filters out extraneous noise by locking on to the probe's frequency of vibration. Data are recorded onto computer. The probe is calibrated at the start and end of experiments in appropriate saline, using a chamber which applies a current of exactly 1.5 &mu;A/cm2. We describe how to make the probes, set up the system and calibrate. We also demonstrate the technique of cornea measurement, and show some representative results from different specimens (cornea, skin, brain).

The manufacture, calibration and use of non-invasive vibrating probes to measure bioelectric current in various biological systems is described.

מדידת נוכחי Bioelectric עם בדיקה רטט

Electric fields, generated by active transport of ions, are present in many biological systems and often serve important functions in tissues and organs. ...

Visualization of Cortex Organization and Dynamics in Microorganisms, using Total Internal Reflection Fluorescence Microscopy

TIRF microscopy has emerged as a powerful imaging technology to study spatio-temporal dynamics of fluorescent molecules in vitro and in living cells1. The optical phenomenon of total internal reflection occurs when light passes from a medium with high refractive index into a medium with low refractive index at an angle larger than a characteristic critical angle (i.e. closer to being parallel with the boundary). Although all light is reflected back under such conditions, an evanescent wave is created that propagates across and along the boundary, which decays exponentially with distance, and only penetrates sample areas that are 100-200 nm near the interface2. In addition to providing superior axial resolution, the reduced excitation of out of focus fluorophores creates a very high signal to noise ratios and minimizes damaging effects of photobleaching2,3. Being a widefield technique, TIRF also allows faster image acquisition than most scanning based confocal setups.
At first glance, the low penetration depth of TIRF seems to be incompatible with imaging of bacterial and fungal cells, which are often surrounded by thick cell walls. On the contrary, we have found that the cell walls of yeast and bacterial cells actually improve the usability of TIRF and increase the range of observable structures4-8. Many cellular processes can therefore be directly accessed by TIRF in small, single-cell microorganisms, which often offer powerful genetic manipulation techniques. This allows us to perform in vivo biochemistry experiments, where kinetics of protein interactions and activities can be directly assessed in living cells.
We describe here the individual steps required to obtain high quality TIRF images for Saccharomyces cerevisiae or Bacillus subtilis cells. We point out various problems that can affect TIRF visualization of fluorescent probes in cells and illustrate the procedure with several application examples. Finally, we demonstrate how TIRF images can be further improved using established image restoration techniques.

Total Internal Reflection Fluorescence (TIRF) microscopy is a powerful approach to observe structures close to the cell surface at high contrast and temporal resolution. We demonstrate how TIRF can be employed to study protein dynamics at the cortex of cell wall-enclosed bacterial and fungal cells.

ויזואליזציה של קליפת הארגון ואת הדינמיקה של מיקרואורגניזמים, באמצעות Fluorescence סה&quot;כ פנימי מיקרוסקופית השתקפות

TIRF microscopy has emerged as  a powerful imaging technology to study spatio-temporal dynamics of fluorescent molecules  in vitro and in living cells1. ...

Cell Patterning on Photolithographically Defined 
Parylene-C: SiO2 Substrates

Cell patterning platforms support broad research goals, such as construction of predefined in vitro neuronal networks and the exploration of certain central aspects of cellular physiology. To easily combine cell patterning with Multi-Electrode Arrays (MEAs) and silicon-based &#8216;lab on a chip&#8217; technologies, a microfabrication-compatible protocol is required. We describe a method that utilizes deposition of the polymer parylene-C on SiO2&#160;wafers. Photolithography enables accurate and reliable patterning of parylene-C at micron-level resolution. Subsequent activation by immersion in fetal bovine serum (or another specific activation solution) results in a substrate in which cultured cells adhere to, or are repulsed by, parylene or SiO2 regions respectively. This technique has allowed patterning of a broad range of cell types (including primary murine hippocampal cells, HEK 293 cell line, human neuron-like teratocarcinoma cell line, primary murine cerebellar granule cells, and primary human glioma-derived stem-like cells). Interestingly, however, the platform is not universal; reflecting the importance of cell-specific adhesion molecules. This cell patterning process is cost effective, reliable, and importantly can be incorporated into standard microfabrication (chip manufacturing) protocols, paving the way for integration of microelectronic technology.

Cell Patterning on Photolithographically Defined 
Parylene-C: SiO2 Substrates

This protocol describes a microfabrication-compatible method for cell patterning on SiO2. A predefined parylene-C design is photolithographically printed on SiO2 wafers. Following incubation with serum (or other activation solution) cells adhere specifically to (and grow according to the conformity of) underlying parylene-C, whilst being repulsed by SiO2 regions.

תא דפוסים על photolithographically מוגדר Parylene-C: SiO<sub&gt; 2</sub&gt; מצעים

Cell patterning platforms support broad research goals, such as construction of predefined in vitro neuronal networks and the exploration of certain ...

Microfluidic Fabrication of Polymeric and Biohybrid Fibers with Predesigned Size and Shape

A &#8220;sheath&#8221; fluid passing through a microfluidic channel at low Reynolds number can be directed around another &#8220;core&#8221; stream and used to dictate the shape as well as the diameter of a core stream.&#160;Grooves in the top and bottom of a microfluidic channel were designed to direct the sheath fluid and shape the core fluid.&#160;By matching the viscosity and hydrophilicity of the sheath and core fluids, the interfacial effects are minimized and complex fluid shapes can be formed.&#160;Controlling the relative flow rates of the sheath and core fluids determines the cross-sectional area of the core fluid.&#160;Fibers have been produced with sizes ranging from 300 nm to ~1 mm, and fiber cross-sections can be round, flat, square, or complex as in the case with double anchor fibers. Polymerization of the core fluid downstream from the shaping region solidifies the fibers.&#160;Photoinitiated click chemistries are well suited for rapid polymerization of the core fluid by irradiation with ultraviolet light.&#160;Fibers with a wide variety of shapes have been produced from a list of polymers including liquid crystals, poly(methylmethacrylate), thiol-ene and thiol-yne resins, polyethylene glycol, and hydrogel derivatives. Minimal shear during the shaping process and mild polymerization conditions also makes the fabrication process well suited for encapsulation of cells and other biological components.

Two adjacent fluids passing through a grooved microfluidic channel can be directed to form a sheath around a prepolymer core; thereby&#160;determining both shape and cross-section. Photoinitiated polymerization, such as thiol click chemistry, is well suited for rapidly solidifying the core fluid into a microfiber with predetermined size and shape.

ייצור מיקרופלואידי של סיבים פולימריים וביוהיברידים עם גודל וצורה מעוצבים מראש

A &#8220;sheath&#8221; fluid passing through a microfluidic channel at low Reynolds number can be directed around another &#8220;core&#8221; stream and ...

A Microfluidic Technique to Probe Cell Deformability

Here we detail the design, fabrication, and use of a microfluidic device to evaluate the deformability of a large number of individual cells in an efficient manner. Typically, data for ~102 cells can be acquired within a 1 hr experiment. An automated image analysis program enables efficient post-experiment analysis of image data, enabling processing to be complete within a few hours. Our device geometry is unique in that cells must deform through a series of micron-scale constrictions, thereby enabling the initial deformation and time-dependent relaxation of individual cells to be assayed. The applicability of this method to human promyelocytic leukemia (HL-60) cells is demonstrated. Driving cells to deform through micron-scale constrictions using pressure-driven flow, we observe that human promyelocytic (HL-60) cells momentarily occlude the first constriction for a median time of 9.3 msec before passaging more quickly through the subsequent constrictions with a median transit time of 4.0 msec per constriction. By contrast, all-trans retinoic acid-treated (neutrophil-type) HL-60 cells occlude the first constriction for only 4.3 msec before passaging through the subsequent constrictions with a median transit time of 3.3 msec. This method can provide insight into the viscoelastic nature of cells, and ultimately reveal the molecular origins of this behavior.

We demonstrate a microfluidics-based assay to measure the timescale for cells to transit through a sequence of micron-scale constrictions.

טכניקת Microfluidic לחקור deformability הסלולרי

Here we detail the design, fabrication, and use of a microfluidic device to evaluate the deformability of a large number of individual cells in an ...

Using Adhesive Patterning to Construct 3D Paper Microfluidic Devices

We demonstrate the use of patterned aerosol adhesives to construct both planar and nonplanar 3D paper microfluidic devices. By spraying an aerosol adhesive through a metal stencil, the overall amount of adhesive used in assembling paper microfluidic devices can be significantly reduced. We show on a simple 4-layer planar paper microfluidic device that the optimal adhesive application technique and device construction style depends heavily on desired performance characteristics. By moderately increasing the overall area of a device, it is possible to dramatically decrease the wicking time and increase device success rates while also reducing the amount of adhesive required to keep the device together. Such adhesive application also causes the adhesive to form semi-permanent bonds instead of permanent bonds between paper layers, enabling single-use devices to be non-destructively disassembled after use. Nonplanar 3D origami devices also benefit from the semi-permanent bonds during folding, as it reduces the likelihood that unrelated faces may accidently stick together. Like planar devices, nonplanar structures see reduced wicking times with patterned adhesive application vs uniformly applied adhesive.

We demonstrate the use of patterned aerosol adhesives to construct 3D paper microfluidic devices. This method of adhesive application forms semi-permanent bonds between layers, enabling single-use devices to be non-destructively disassembled after use and to ease folding complex nonplanar structures.

באמצעות דפוסים דבקים כדי לבנות התקני 3D נייר Microfluidic

We demonstrate the use of patterned aerosol adhesives to construct both planar and nonplanar 3D paper microfluidic devices. By spraying an aerosol ...

Light-mediated Formation and Patterning of Hydrogels for Cell Culture Applications

Click chemistries have been investigated for use in numerous biomaterials applications, including drug delivery, tissue engineering, and cell culture. In particular, light-mediated click reactions, such as photoinitiated thiol&#8722;ene and thiol&#8722;yne reactions, afford spatiotemporal control over material properties and allow the design of systems with a high degree of user-directed property control. Fabrication and modification of hydrogel-based biomaterials using the precision afforded by light and the versatility offered by these thiol&#8722;X photoclick chemistries are of growing interest, particularly for the culture of cells within well-defined, biomimetic microenvironments. Here, we describe methods for the photoencapsulation of cells and subsequent photopatterning of biochemical cues within hydrogel matrices using versatile and modular building blocks polymerized by a thiol&#8722;ene photoclick reaction. Specifically, an approach is presented for constructing hydrogels from allyloxycarbonyl (Alloc)-functionalized peptide crosslinks and pendant peptide moieties and thiol-functionalized poly(ethylene glycol) (PEG) that rapidly polymerize in the presence of lithium acylphosphinate photoinitiator and cytocompatible doses of long wavelength ultraviolet (UV) light. Facile techniques to visualize photopatterning and quantify the concentration of peptides added are described. Additionally, methods are established for encapsulating cells, specifically human mesenchymal stem cells, and determining their viability and activity. While the formation and initial patterning of thiol-alloc hydrogels are shown here, these techniques broadly may be applied to a number of other light and radical-initiated material systems (e.g., thiol-norbornene, thiol-acrylate) to generate patterned substrates.

We describe a sequential process for light-mediated formation and subsequent biochemical patterning of synthetic hydrogel matrices for three-dimensional cell culture applications. The construction and modification of hydrogels with cytocompatible photoclick chemistry is demonstrated. Additionally, facile techniques to quantify and observe patterns and determine cell viability within these hydrogels are presented.

אור בתיווך גיבוש דפוסים של הידרוג עבור יישומי תרבית תאים

Click chemistries have been investigated for use in numerous biomaterials applications, including drug delivery, tissue engineering, and cell culture. In ...

A Microfluidic System with Surface Patterning for Investigating Cavitation Bubble(s)&#8211;Cell Interaction and the Resultant Bioeffects at the Single-cell Level

In this manuscript, we first describe the fabrication protocol of a microfluidic chip, with gold dots and fibronectin-coated regions on the same glass substrate, that precisely controls the generation of tandem bubbles and individual cells patterned nearby with well-defined locations and shapes. We then demonstrate the generation of tandem bubbles by using two pulsed lasers illuminating a pair of gold dots with a few-microsecond time delay. We visualize the bubble-bubble interaction and jet formation by high-speed imaging and characterize the resultant flow field using particle image velocimetry (PIV). Finally, we present some applications of this technique for single cell analysis, including cell membrane poration with macromolecule uptake, localized membrane deformation determined by the displacements of attached integrin-binding beads, and intracellular calcium response from ratiometric imaging. Our results show that a fast and directional jetting flow is produced by the tandem bubble interaction, which can impose a highly localized shear stress on the surface of a cell grown in close proximity. Furthermore, different bioeffects can be induced by altering the strength of the jetting flow by adjusting the standoff distance from the cell to the tandem bubbles.

A microfluidic chip was fabricated to produce pairs of gold dots for tandem bubble generation and fibronectin-coated islands for single-cell patterning nearby. The resultant flow field was characterized by particle image velocimetry and was employed to study various bioeffects, including cell membrane poration, membrane deformation, and intracellular calcium response.

מערכת Microfluidic עם דפוסי Surface לחקירת בועת Cavitation (ים) אינטראקציה דו תא ואת Bioeffects הנובע מהן ברמת התא הבודד

In this manuscript, we first describe the fabrication protocol of a microfluidic chip, with gold dots and fibronectin-coated regions on the same glass ...

A Versatile Method of Patterning Proteins and Cells

Substrate and cell patterning techniques are widely used in cell biology to study cell-to-cell and cell-to-substrate interactions. Conventional patterning techniques work well only with simple shapes, small areas and selected bio-materials. This article describes a method to distribute cell suspensions as well as substrate solutions into complex, long, closed (dead-end) polydimethylsiloxane (PDMS) microchannels using negative pressure. This method enables researchers to pattern multiple substrates including fibronectin, collagen, antibodies (Sal-1), poly-D-lysine (PDL), and laminin. Patterning of substrates allows one to indirectly pattern a variety of cells. We have tested C2C12 myoblasts, the PC12 neuronal cell line, embryonic rat cortical neurons, and amphibian retinal neurons. In addition, we demonstrate that this technique can directly pattern fibroblasts in microfluidic channels via brief application of a low vacuum on cell suspensions. The low vacuum does not significantly decrease cell viability as shown by cell viability assays. Modifications are discussed for application of the method to different cell and substrate types. This technique allows researchers to pattern cells and proteins in specific patterns without the need for exotic materials or equipment and can be done in any laboratory with a vacuum.

This report describes a simple, easy to perform technique, using low pressure vacuum, to fill microfluidic channels with cells and substrates for biological research.

שיטה צדדית של חלבוני דפוסי תאים

Substrate and cell patterning techniques are widely used in cell biology to study cell-to-cell and cell-to-substrate interactions. Conventional patterning ...

Three-dimensional Patterning of Engineered Biofilms with a Do-it-yourself Bioprinter

Biofilms are aggregates of bacteria embedded in a self-produced spatially-patterned extracellular matrix. Bacteria within a biofilm develop enhanced antibiotic resistance, which poses potential health dangers, but can also be beneficial for environmental applications such as purification of drinking water. The further development of anti-bacterial therapeutics and biofilm-inspired applications will require the development of reproducible, engineerable methods for biofilm creation. Recently, a novel method of biofilm preparation using a modified three-dimensional (3D) printer with a bacterial ink has been developed. This article describes the steps necessary to build this efficient, low-cost 3D bioprinter that offers multiple applications in bacterially-induced materials processing. The protocol begins with an adapted commercial 3D printer in which the extruder has been replaced with a bio-ink dispenser connected to a syringe pump system enabling a controllable, continuous flow of bio-ink. To develop a bio-ink suitable for biofilm printing, engineered Escherichia coli bacteria were suspended in a solution of alginate, so that they solidify in contact with a surface containing calcium. The inclusion of an inducer chemical within the printing substrate drives expression of biofilm proteins within the printed bio-ink. This method enables 3D printing of various spatial patterns composed of discrete layers of printed biofilms. Such spatially-controlled biofilms can serve as model systems and can find applications in multiple fields that have a wide-ranging impact on society, including antibiotic resistance prevention or drinking water purification, among others.

This article describes a method of transforming a low-cost commercial 3D printer into a bacterial 3D printer that can facilitate printing of patterned biofilms. All necessary aspects of preparing the bioprinter and bio-ink are described, as well as verification methods to assess the formation of biofilms.

המשך תלת-מימדי של ביוריאמים מהונדסים עם מעשה-זה-בעצמך ביורינטר

Biofilms are aggregates of bacteria embedded in a self-produced spatially-patterned extracellular matrix. Bacteria within a biofilm develop enhanced ...

דפוסי Subtractive מהירים של שכבות תא חיות עם בדיקת Microfluidic

Summary

Explore More Videos

Chapters in this video