Los conjuntos de datos de difracción de rayos X se recogieron en la línea de haz 7A del Laboratorio de Aceleración de Pohang (Corea). Este estudio fue apoyado por el Programa de Investigación Científica Básica administrado por la Fundación Nacional de Investigación de Corea (NRF), financiado por el Ministerio de Ciencia, TIC y Planificación del Futuro (2015R1A1A01057574 a MH).

1. Producción y Purificación de Proteínas Recombinantes de rBC1531 <ol><li> Preparación de un plásmido de expresión recombinante de la proteína BC1531 (rBC1531) <ol><li> Preparar el ADN genómico de B. cereus [ 10] . </li><li> Amplificar el gen bc1531 de una plantilla de ADN genómico de B. cereus por reacción en cadena de la polimerasa (PCR), utilizando cebadores directos e inversos (véase la Lista de Materiales) para crear sitios de enzimas de restricción Bam HI y Sal I, respectivamente 10 . </li><li> Digerir el producto de PCR y un vector pET49b modificado (pET49bm) usando Bam HI y Sal I, como se describe 11 . </li><li> Mezclar el producto de la PCR digerido y el vector (relación 3: 1) de la etapa 1.1.3 usando T4 ADN ligasa en una reacción de 10 μL, tal como se describe en 11 . Incubar a 18 ° C durante 30 min. </li><li> Pipetee 3 μL de la reacción de ligadura en 50 μl deLmente células E. coli DH5α competentes en un tubo. Mezcle suavemente pipeteando hacia arriba y hacia abajo y colóquelo en hielo durante 30 min. De choque térmico durante 45 s a 42 ° C. Añadir 1 mL de medio Luria-Bertani (LB) y cultivar las células mientras se agita vigorosamente (250 rpm, 37ºC, 45 min). </li><li> Tomar 100 μL de las células transformadas de la etapa 1.1.6 y esparcirlas sobre las placas de LB-agar con 100 μg / ml de kanamicina (Kan). Incubar durante ~ 18 ha 37 ° C. </li><li> Recoger las colonias utilizando una punta estéril y cultivar las células en 3 ml de medio LB con 100 μg / ml de Kan; Agitar vigorosamente (250 rpm, 37ºC, 18 h). </li><li> Preparar ADN plasmídico usando un método de lisis alcalino-SDS, como se describe 10 . </li><li> Confirmar la secuencia de nucleótidos de la expresión rBC1531 construir utilizando el ADN de secuenciación [ 12] . </li></ol></li><li> La sobreexpresión de la proteína rBC1531 <ol><li> Re-transformar la E. coli BL21 (DE3) cepa con rBC1531-expPlásmido ressión, como se describe en los pasos 1.1.5-1.1.6, para sobreexpresión. </li><li> Seleccionar una colonia y cultivarla en 10 mL de medio LB que contenga 50 μg / mL de Kan (LB + Kan); Agitar vigorosamente durante 18 h a 37 ° C. </li><li> Inocular 10 ml de cultivo durante la noche en 1 L de medio LB + Kan y crecer a 37 ° C hasta que la DO 600 (densidad óptica a 600 nm) alcance ~ 0,7. </li><li> Sumergir el cultivo en agua helada durante ~ 15 min para enfriar la temperatura a 18 ° C y añadir isopropil β-D-1-tiogalactopiranósido (IPTG) al cultivo a una concentración final de 1 mM para la expresión de proteína recombinante. Cultivar el cultivo a 18 ° C durante un período adicional de ~ 16-18 h. </li></ol></li><li> Purificación de rBC1531 <ol><li> Se cosechan las células por centrifugación (5.000 xg, 4ºC, 30 min). Deseche el sobrenadante cuidadosamente para no alterar las células. Re-suspender las células en 50 ml de solución salina tamponada con fosfato (PBS) que contiene imidazol 10 mM. </li><li> Lyse las células dos veces por sonicación en hielo para evitar el sobrecalentamiento de los lisados ​​celulares (tiempo: 2 min 30 s, ciclo en: 5 s, ciclo off: 10 s, amplitud: 38%). </li><li> Limpiar el lisado celular por centrifugación (~ 25.000 xg, 4 ° C, 30 min). </li><li> Se mezclan 3 ml de perlas de níquel y 60 ml de PBS que contiene imidazol 10 mM y se somete a flujo por gravedad el tampón extra para depositar las perlas de níquel equilibradas en una columna de cromatografía de vidrio de 2,5 x 10 cm. </li><li> Pipetear para transferir el sobrenadante del paso 1.3.3 a la columna con perlas de níquel pre-equilibradas e incubar a 4 ° C durante 2 h en una rueda giratoria a una velocidad baja (~ 20 rpm). </li><li> Dejar que el sobrenadante se drene por gravedad y lavar las perlas de níquel en la columna tres veces con 100 ml de PBS que contiene imidazol 10 mM. </li><li> Eluir la proteína rBC1531 aplicando 4 x 5 ml de PBS que contiene imidazol 250 mM. </li><li> Tomar 15 μL de la elución de la etapa 1.3.7 y ejecutarla en SDS-PAGE al 15%. Visualice las bandas de proteínas enEl gel usando tinción azul de Coomassie 10 . </li></ol></li><li> Eliminación de los marcadores de afinidad de la proteína rBC1531 por proteólisis de trombina <ol><li> Pipetar las fracciones en un tubo de diálisis (peso molecular cortado: 3 kDa) y colocar el tubo en un vaso de precipitados que contenga 4 l de tampón compatible con la escisión de trombina (HEPES 20 mM, pH 7,4, NaCl 150 mM y β-mercaptoetanol 1,5 mM) A 4ºC durante la noche. </li><li> Pipetear las fracciones y transferirlas a un tubo cónico. </li><li> Medir la absorbancia a 280 nm y estimar la concentración de proteína rBC1531, como se describe [ 13] . </li><li> Tomar 50 μg de rBC1531 en un tubo de 0,5 ml y agregar varias cantidades de trombina ( es decir, 2, 1, 0,6 y 0,3 unidades). Incubar las reacciones rBC1531 y trombina a 20 ° C durante ~ 3 h para determinar la menor cantidad de trombina necesaria para escindir la etiqueta de afinidad N-terminal. </li><li> Ejecutar las reacciones rBC1531 y trombina en un 15%SDS-PAGE y determinar la cantidad más baja de trombina ( por ejemplo, 0,3 unidades de trombina por 50 μg de rBC1531) que digiere completamente la etiqueta de afinidad N-terminal y produce un rBC1531 libre de marcadores. </li><li> Añadir 10 mg de proteína rBC1531 y 60 unidades de trombina a un tubo de 15 ml e incubar a 20 ° C durante ~ 3 h para la reacción de proteolisis de trombina. </li><li> Aplicar las normas de filtración en gel a una columna de cromatografía de exclusión de tamaño (SEC) para preparar una curva estándar de pesos moleculares y volúmenes de elución, como se describe 13 . </li><li> Colocar la proteína rBC1531 digerida con trombina de la etapa 1.4.6 en un tubo de filtro centrífugo (peso molecular cortado: 3 kDa) y centrifugar a 3.000 g a 4 ° C para reducir a un volumen de menos de 5 ml. </li><li> Aplicar la proteína concentrada rBC1531 a la columna SEC y recoger 60 fracciones eluidas en 0,5 ml por tubo [ 13] . </li><li> Tomar 15 μL de cada fracción, ejecutarlos en un 15% SDS-PAGE, y staiEn el gel usando una solución de tinción Coomassie (0.15% (p / v) de azul brillante Coomassie, metanol al 40% (v / v) y ácido acético glacial al 10% (v / v) como se describe 10 . </li><li> Pipetear las fracciones que contienen rBC1531 y recogerlos en un tubo. </li></ol></li></ol> 2. Cristalización Tamizaje y Optimización de rBC1531 <ol><li> Condiciones de cribado para la cristalización de la proteína rBC1531 <ol><li> Concentrar el rBC1531 de la etapa 1.4.11 hasta ~ 18,5 mg / mL usando un tubo de filtro centrífugo, como se describe en el paso 1.4.8. </li><li> Añadir 50 μl de cada solución de cribado de cristalización (ver sección 2.2) 14 a los pocillos de placas de cristalización de 96 pocillos. Coloque 0,5 μl de la solución de 18,5 mg / ml de proteína rBC1531 sobre una cama sentada. Mezclar la solución de proteína con 0,5 μL de la solución del pocillo, repitiendo el proceso para toda la placa. </li><li> Cubra la placa con una película adhesiva transparente.Colocar las placas de 96 pocillos a 18 ° C y permitir la difusión de vapor. </li><li> Escanee las gotas a una ampliación de 20-40X usando un microscopio de luz para monitorear la formación de cristales diariamente durante 2-3 semanas. </li><li> Recoger datos de difracción de rayos X 12 usando los cristales de proteína rBC1531 obtenidos. </li></ol></li><li> Optimización de las condiciones de cristalización de rBC1531 <ol><li> Preparar 500 μl de la solución de la condición de cristalización inicial seleccionada ( p. Ej., Cacodilato sódico 0,1 M, pH 6,5 y citrato sódico 1,0 M) y rellenar una placa de cristalización de 24 pocillos para la gota sentada. </li><li> Añadir 0,5 μL de la solución de 18,5 mg / ml de proteína rBC1531 a un lecho sentado, mezclar con 0,5 μL de la solución del pocillo y cubrir la placa inmediatamente con una película adhesiva transparente. Coloque la placa a 18 ° C. </li><li> Observe el crecimiento del cristal bajo un microscopio de luz durante una semana. </li><li> Optimizar varias condiciones de cristalización variando el pH ( es decir,, PH 5,5-6,8) de cacodilato 0,1 M y alterando la concentración de sal ( es decir, 0,9-1,2 M) de citrato sódico para obtener cristales singulares. Monitor de crecimiento de cristales durante ~ 1 semana y recoger datos de difracción de rayos X 12 . </li></ol></li></ol> 3. Caracterización de la actividad Nucleósido Trifosfatasa (NTPasa) de rBC1531 <ol><li> Validación del estudio colorimétrico inorgánico dependiente de fosfato <ol><li> Preparar una reserva de pirofosfato (100 mM) y diluir a concentraciones finales de 0,1, 0,25, 0,5, 1,0, 5,0, 10, 50, 100 y 250 μM en 200 μl de tampón de reacción (HEPES 20 mM, pH 7,4; 150 MM de NaCl y 2 mM de MgCl2) en placas de 96 pocillos duplicadas. Utilice la primera placa como control (esto no contiene pirofosfatasa). Asegúrese de que la segunda placa contiene pirofosfatasa como placa de trabajo, como se indica en el paso 3.1.2. </li><li> Añadir 0,01 unidad de Saccharomyces cerevisiae p inorgánicoYrophosphatase (1 μl) a los pocillos de la placa de trabajo e incubar a 20 ° C durante 30-60 min. </li><li> Preparar solución de ácido molibdato mezclando soluciones de molibdato de amonio (0,86% v / v) y ácido ascórbico (14% v / v) en una proporción de 7: 3. Añada 16 μl de solución de ácido molibdato a los pocillos de trabajo y de control y espere 15 min. </li><li> Leer la densidad óptica a 690 nm (OD 690nm ). </li></ol></li><li> Ensayo colorimétrico de NTPasa <ol><li> Preparar una reserva de sustrato de nucleósido trifosfato (NTP) 100 mM y diluir a la concentración deseada ( por ejemplo, 0, 0,2, 4,4, 11, 22, 44, 88 o 132 μM) en 180 μl de tampón de ensayo (HEPES 20 mM, PH 7,4, NaCl 150 mM y MgCl2 2 mM). </li><li> Añadir 20 μg de rBC1531 (1,5 mM) y los sustratos NTP desde el paso 3.2.1 hasta 200 μL por reacción en una placa de 96 pocillos y pipetear arriba y abajo para mezclar bien. Cubrir la placa con su tapa y colocarla en una incubadora a 37 ° C durante 30 minPara realizar la reacción de hidrólisis del sustrato. </li><li> Transferir la placa a un baño de agua a 70 ° C y dejar reposar durante 15 minutos para detener las reacciones catalíticas mediadas por rBC1531. </li><li> Añadir 0,01 unidades de pirofosfatasa inorgánica de S. cerevisiae (1 μl) a cada pocillo de la placa de reacción (de la etapa 3.2.3) e incubar a 20 ° C durante 30 min. Añadir 16 μL de solución de ácido molibdato a la placa de reacción para desarrollar el color (~ 15 min). Leer a DO 690nm . </li><li> Analizar utilizando la ecuación de Michaelis-Menten, como se describe 12 . </li></ol></li></ol>

<ol>
	<li>Ivanova, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+Bacillus+cereus+and+comparative+analysis+with+Bacillus+anthracis.">Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis.</a> Nature. 423, 87-91 (2003).</li><li>Spencer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacillus+anthracis.">Bacillus anthracis.</a> J Clin Pathol. 56, 182-187 (2003).</li><li>Deli, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LmbE+proteins+from+Bacillus+cereus+are+de-N-acetylases+with+broad+substrate+specificity+and+are+highly+similar+to+proteins+in+Bacillus+anthracis.">LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis.</a> FEBS J. 277, 2740-2753 (2010).</li><li>Gross, M., Marianovsky, I., Glaser, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MazG+--+a+regulator+of+programmed+cell+death+in+Escherichia+coli.">MazG -- a regulator of programmed cell death in Escherichia coli.</a> Mol Microbiol. 59, 590-601 (2006).</li><li>Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=House+cleaning,+a+part+of+good+housekeeping.">House cleaning, a part of good housekeeping.</a> Mol Microbiol. 59, 5-19 (2006).</li><li>Lee, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+Escherichia+coli+MazG,+the+regulator+of+nutritional+stress+response.">Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response.</a> J Biol Chem. 283, 15232-15240 (2008).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimeric+dUTPases,+HisE,+and+MazG+belong+to+a+new+superfamily+of+all-alpha+NTP+pyrophosphohydrolases+with+potential+&amp;#34;house-cleaning&amp;#34;+functions.">Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential &amp;#34;house-cleaning&amp;#34; functions.</a> J Mol Biol. 347, 243-255 (2005).</li><li>Robinson, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+putative+house-cleaning+enzyme+encoded+within+an+integron+array:+1.8+A+crystal+structure+defines+a+new+MazG+subtype.">A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype.</a> Mol Microbiol. 66, 610-621 (2007).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+crystal+structure+of+a+complex+of+Campylobacter+jejuni+dUTPase+with+substrate+analogue+sheds+light+on+the+mechanism+and+suggests+the+&amp;#34;basic+module&amp;#34;+for+dimeric+d(C/U)TPases.">The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the &amp;#34;basic module&amp;#34; for dimeric d(C/U)TPases.</a> J Mol Biol. 342, 1583-1597 (2004).</li><li>Green, M., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning: A laboratory Manual. 1, (2012).</li><li>Brown, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Gene cloning an introduction. , (1986).</li><li>Kim, M. I., Hong, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Bacillus-conserved+MazG+protein,+a+nucleotide+pyrophosphohydrolase.">Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase.</a> Biochem Biophys Res Commun. 472, 237-242 (2016).</li><li>Sheehan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Physical biochemistry: Principles and applications. , (2009).</li><li>Lesley, S. A., Wilson, I. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+and+crystallization+at+the+joint+center+for+structural+genomics.">Protein production and crystallization at the joint center for structural genomics.</a> J Struct Funct Genomics. 6, 71-79 (2005).</li><li>Jeon, Y. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+biochemical+characterization+of+bacterial+YpgQ+protein+reveals+a+metal-dependent+nucleotide+pyrophosphohydrolase.">Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase.</a> J Struct Biol. 195, 113-122 (2016).</li></ol>

Los autores no tienen nada que revelar.

Studies of true pathogens are limited due to safety restrictions and regulations. Alternatively, pathogens can be studied using evolutionarily related non-pathogens or less pathogenic species. The ba1554 gene is considered a critical gene in B. anthracis. Fortunately, an identical gene is present in nonclinical B. cereus. Thus, without serious safety concerns, recombinant BC1531 protein can be used for biophysical and enzymatic characterization. Here, we described detailed procedures, moving fr...

La expresión de proteínas recombinantes se utiliza ampliamente para superar problemas asociados con fuentes de proteínas naturales, tales como cantidades limitadas de proteínas y contaminación perjudicial. Además, en estudios de genes y proteínas patógenos, se puede utilizar una cepa alternativa de laboratorio que no requiere precauciones de seguridad adicionales. Por ejemplo, Bacillus cereus es un modelo útil para estudiar Bacillus anthracis debido a su estrecha relación evolutiva 1 . B. anthracis es un patógeno obligado que causa el ántrax mortal por inhalación en humanos y ganado y potencialmente puede ser utilizado como bioweapon 2 . Por lo tanto, los estudios de laboratorio sobre B. anthracis están estrictamente regulados por los Centros para el Control y la Prevención de Enfermedades de los Estados Unidos, que requieren prácticas de nivel de bioseguridad 3 (BSL-3) que obligan a separar el área del laboratorio con presión negativa. En contraste con B. anthracis </eM&gt;, B. cereus se clasifica como un agente BSL-1 y por lo tanto tiene preocupaciones mínimas de seguridad. B. cereus es un patógeno oportunista que, tras la infección, causa intoxicación alimentaria que puede ser tratada sin asistencia médica. Sin embargo, debido a que B. cereus comparte muchos genes críticos con B. anthracis , las funciones de las proteínas de B. anthracis se pueden estudiar usando los correspondientes homólogos de B. cereus 1 . El grupo de genes ba1554 - ba1558 de B. anthracis se conserva altamente con el grupo bc1531 - bc1535 De B. cereus , así como con el grupo bt1364-bt1368 de Bacillus thuringiensis , en términos de organización de genes y secuencia. Además, los primeros genes ( ba1554 , bc1531 y bt1364 ) de los respectivos grupos están absolutamente conservados ( es decir, 100% de identidad de secuencia de nucleótidos), implyiNg un papel crítico del producto génico en las especies de Bacillus . Debido a su ubicación en estos grupos de genes, ba1554 fue mal identificado como un regulador de transcripción putativo [ 3] . Sin embargo, el análisis de la secuencia de aminoácidos del producto ba1554 indica que pertenece a la familia MazG, que tiene actividad de nucleótido pirofosfohidrolasa y no está asociada con la actividad del factor de transcripción 4 , 5 . Aunque las proteínas pertenecientes a la familia MazG son diversas con respecto a la secuencia y longitud totales, comparten un dominio MazG común de ~ 100-residuo caracterizado por un motivo EXXE 12-28 EXXD (&quot;X&quot; representa cualquier residuo de aminoácido, y el número Indica el número de residuos X). El dominio MazG no siempre explica directamente una cierta actividad catalítica. Un miembro MazG de Escherichia coli (EcMazG) posee dos dominios MazG, pero enLy el dominio C-terminal MazG es enzimáticamente activo [ 6] . Por otra parte, la especificidad del sustrato de las enzimas MazG varía de nucleoside trifosfatos no específicos (para EcMazG) a dCTP / dATP específicos (para integrinas asociadas a MazG) y dUTP (para dUTPases) 6 , 7 , 8 , 9 . Por lo tanto, los análisis biofísicoquímicos de la proteína BA1554 son necesarios para confirmar su actividad NTPasa y para descifrar su especificidad de sustrato. En este sentido, proporcionamos un protocolo paso a paso que la mayoría de los laboratorios sin un BSL-3 puede seguir para caracterizar el producto proteico del gen B. cereus bc1531 , que es un ortólogo de B. anthracis ba1554 , a nivel molecular. Brevemente, el BC1531 recombinante (rBC1531) se expresó en E. coli y se purificó usando una etiqueta de afinidad. Para los experimentos cristalográficos de rayos X,Zación de la proteína rBC1531 se seleccionaron y optimizaron. Para evaluar la actividad enzimática de rBC1531, la actividad de NTPasa se monitorizó colorimétricamente para evitar nucleótidos radiactivamente marcados que se han usado convencionalmente. Finalmente, los análisis de los datos biofísicoquímicos obtenidos nos permitieron determinar el estado de oligomerización y los parámetros catalíticos de rBC1531, así como obtener datos de difracción de rayos X del cristal rBC1531.

<table><tbody><tr><td>&lt;em&gt;Bacillus cereus&lt;/em&gt; ATCC14579</td><td>Korean Collection for Tissue Culture</td><td>3624</td><td></td></tr><tr><td>Genomic DNA prep kit</td><td>GeneAll</td><td>106-101</td><td>Genomic DNA preparation</td></tr><tr><td>Forward primer</td><td>Macrogen</td><td>GAAGGATCCGGAAGCAAAAA&lt;br/&gt; CGATGAAAGATATGCA</td><td>&lt;em&gt;Bam&lt;/em&gt;HI site is underlined</td></tr><tr><td>Reverse primer</td><td>Macrogen</td><td>CTTGTCGACTTATTCTTTCTCT&lt;br/&gt; CCCTCATCAATACGTG</td><td>&lt;em&gt;Sal&lt;/em&gt;I site is underlined</td></tr><tr><td>nPfu-Forte</td><td>Enzynomics</td><td>P410</td><td>PCR polymerase</td></tr><tr><td>&lt;em&gt;Bam&lt;/em&gt;HI</td><td>Enzynomics</td><td>R003S</td><td></td></tr><tr><td>&lt;em&gt;Sal&lt;/em&gt;I</td><td>Enzynomics</td><td>R009S</td><td></td></tr><tr><td>pET49b expression vector</td><td>Novagen</td><td>71463</td><td>Expression vector was modified to add affinity tags and BamHI/SalI sites&lt;sup&gt;10&lt;/sup&gt;</td></tr><tr><td>T4 DNA ligase</td><td>Enzynomics</td><td>M001S</td><td></td></tr><tr><td>Dialysis memebrane</td><td>Thermofisher</td><td>18265017</td><td></td></tr><tr><td>Dry block heater</td><td>JSR</td><td>JSBL-02T</td><td></td></tr><tr><td>LB broth (Luria-Bertani)</td><td>LPS solution</td><td>LB-05</td><td></td></tr><tr><td>LB Agar, Miller (Luria-Bertani)</td><td>Becton, Dickinson and Company</td><td></td><td></td></tr><tr><td>Kanamycin</td><td>LPS solution</td><td>KAN025</td><td></td></tr><tr><td>Mini-prep kit</td><td>Favorgen</td><td>FAPDE300</td><td>Plasmid DNA preparation</td></tr><tr><td>BL21(DE3) Competent cell</td><td>Novagen</td><td>69450-3CN</td><td></td></tr><tr><td>Isopropyl &amp;beta;-D-1-thiogalactopyranoside (IPTG)</td><td>Fisher BioReagents</td><td>50-213-378</td><td></td></tr><tr><td>Sodium chloride</td><td>Daejung</td><td>7548-4100</td><td>PBS material</td></tr><tr><td>Potassium chloride</td><td>Daejung</td><td>6566-4405</td><td>PBS material</td></tr><tr><td>Potassium phosphate</td><td>Bio Basic Inc</td><td>PB0445</td><td>PBS material</td></tr><tr><td>Sodium phosphate</td><td>Bio Basic Inc</td><td>S0404</td><td>PBS material</td></tr><tr><td>Imidazole</td><td>Bio Basic Inc</td><td>IB0277</td><td></td></tr><tr><td>Sonicator</td><td>Sonics</td><td>VCX 130</td><td></td></tr><tr><td>Ni-NTA agaros</td><td>Qiagen</td><td>30210</td><td>Nickel bead</td></tr><tr><td>Rotator</td><td>Finepcr</td><td>AG</td><td></td></tr><tr><td>Precision Plus Protein Dual Color Standards</td><td>Bio-rad</td><td>1610374</td><td>SDS-PAGE protein standard</td></tr><tr><td>Coonmassie Brilliant Blue R-250</td><td>Fisher BioReagents</td><td>BP101-25</td><td>Coomassie staining solution</td></tr><tr><td>Methyl alcohol</td><td>Samchun chemical</td><td>M0585</td><td>Coomassie staining solution</td></tr><tr><td>Acetic acid</td><td>Daejung</td><td>1002-4105</td><td>Coomassie staining solution</td></tr><tr><td>Dialysis memebrane</td><td>Thermofisher</td><td>68035</td><td></td></tr><tr><td>2-Mercaptoethanol</td><td>Sigma-aldrich</td><td>M6250</td><td></td></tr><tr><td>Thrombin</td><td>Merckmillipore</td><td>605157-1KUCN</td><td>Prepare aliquots of 20 &amp;mu;L (1 Unit per &amp;mu;L) and store at 70 &amp;deg;C and thaw before use</td></tr><tr><td>Superdex 200 16/600</td><td>General Electric</td><td>28989335</td><td>Size exclusion chromatography</td></tr><tr><td>Gel filtration standard</td><td>Bio-rad</td><td>151-1901</td><td></td></tr><tr><td>Centrifugal filter</td><td>Amicon</td><td>UFC800396</td><td></td></tr><tr><td>Crystralization plates</td><td>Hampton research</td><td>HR3-083</td><td>96-well sitting drop plate</td></tr><tr><td>The JCSG core suite I-IV</td><td>Qiagen</td><td>130924-130927</td><td>Crystallization secreening solution</td></tr><tr><td>Microscope</td><td>Nikon</td><td>SMZ745T</td><td></td></tr><tr><td>Cryschem plates</td><td>Hampton research</td><td>HR3-158</td><td>24-well sitting drop plate</td></tr><tr><td>Inorganic pyrophosphatase</td><td>Sigma</td><td>10108987001</td><td></td></tr><tr><td>Ammonium molybdate solution</td><td>Sigma</td><td>13106-76-8</td><td></td></tr><tr><td>L-ascorbic acid</td><td>Sigma</td><td>50-81-7</td><td></td></tr><tr><td>NTP substrate</td><td>Startagene</td><td>200415-51</td><td></td></tr><tr><td>Spectrophotometer</td><td>Biotek</td><td>SynergyH1</td><td>microplate reader</td></tr><tr><td>GraphPad Prism 5</td><td>GraphPad</td><td>Prism 5 for Window</td><td></td></tr></tbody></table>

recombinant protein expression, crystallization, and biophysical studies of a bacillus-conserved nucleotide pyrophosphorylase, bcmazg

Para superar las restricciones de seguridad y las regulaciones al estudiar genes y proteínas de patógenos verdaderos, sus homólogos pueden ser estudiados. Bacillus anthracis es un patógeno obligado que causa el ántrax mortal por inhalación. Bacillus cereus es considerado un modelo útil para estudiar B. anthracis debido a su estrecha relación evolutiva. El grupo de genes ba1554 - ba1558 de B. anthracis está altamente conservado con el grupo bc1531 - bc1535 en B. cereus , así como con el grupo bt1364 - bt1368 en Bacillus thuringiensis, lo que indica el papel crítico de los genes asociados en el género Bacillus . Este manuscrito describe métodos para preparar y caracterizar un producto proteico del primer gen ( ba1554 ) del grupo genético en B. anthracis usando una proteína recombinante de su ortholog en B. cereus , bc1531.

La caracterización de la proteína de interés en este estudio comenzó preparando una cantidad suficiente de proteína B.cereus recombinante bc1531 (rBC1531), preferiblemente más de varios miligramos. El fragmento de ADN que codifica la proteína BC1531 se preparó por PCR utilizando el ADN genómico de B. cereus como plantilla, ya que contiene genes ortólogos idénticos a ba1554 . RBC1531 se sobreexpresó como una proteína soluble en células de E. co...

Watch this Scientific Journal Video about Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG at JoVE.com

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Bacillus anthracis es el patógeno obligado del ántrax por inhalación fatal, por lo que los estudios de sus genes y proteínas están estrictamente regulados. Un enfoque alternativo es estudiar los genes ortólogos. Se describen los estudios biofísicoquímicos de un B. orthracis ortholog en B. cereus , bc1531, que requiere un mínimo de equipo experimental y la falta de graves preocupaciones de seguridad.

Expresión de Proteínas Recombinantes, Cristalización y Estudios Biofísicos de un<em&gt; Bacillus</em&gt; -conservado Nucleótido Pirofosforilasa, BcMazG

To overcome safety restrictions and regulations when studying genes and proteins from true pathogens, their homologues can be studied. Bacillus anthracis ...

recombinant-protein-expression-crystallization-biophysical-studies

Universidad de Cartagena UDEC

Research

JoVE Journal

Biochemistry

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

7.4K vistas.  Yonsei University.  Bacillus anthracis es el patógeno obligado del ántrax por inhalación fatal, por lo que los estudios de sus genes y proteínas están estrictamente regulados. Un enfoque alternativo es estudiar los genes ortólogos. Se describen los estudios biofísicoquímicos de un B. orthracis ortholog en B. cereus , bc1531, que requiere un mínimo de equipo experimental y la falta de graves preocupaciones de seguridad. 

Video: Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a target for future development of inhibitors to decrease the virulence of the pathogen. To perform biophysical and structural characterization as well as inhibitor screening, large amounts of pure and active protein will be needed. We have developed a protocol for efficient production and purification of PPEP-1 by the use of E. coli as the expression host yielding sufficient amounts and purity of protein for crystallization and structure determination. Additionally, using microseeding, highly intergrown crystals of PPEP-1 can be grown to well-ordered crystals suitable for X-ray diffraction analysis. The methods could also be used to produce other recombinant proteins and to study the structures of other proteins producing intergrown crystals.

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

Proline-proline endopeptidase-1 (PPEP-1) is a secreted metalloprotease and promising drug-target from the human pathogen Clostridium difficile. Here we describe all methods necessary for the production and structure determination of this protein.

Producción, Cristalización y determinación de la estructura de<em&gt; C. difícil</em&gt; PPEP-1 a través de microsiembra y Zinc-SAD

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a ...

Investigación

Bioquímica

Microcrystallography of Protein Crystals and In Cellulo Diffraction

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in their largest dimension, which used to represent a challenge. We present two alternative workflows for the structure determination of protein microcrystals by X-ray crystallography with a particular focus on crystals grown in vivo. The microcrystals are either extracted from cells by sonication and purified by differential centrifugation, or analyzed in cellulo after cell sorting by flow cytometry of crystal-containing cells. Optionally, purified crystals or crystal-containing cells are soaked in heavy atom solutions for experimental phasing. These samples are then prepared for diffraction experiments in a similar way by application onto a micromesh support and flash cooling in liquid nitrogen. We briefly describe and compare serial diffraction experiments of isolated microcrystals and crystal-containing cells using a microfocus synchrotron beamline to produce datasets suitable for phasing, model building and refinement.
These workflows are exemplified with crystals of the Bombyx mori cypovirus 1 (BmCPV1) polyhedrin produced by infection of insect cells with a recombinant baculovirus. In this case study, in cellulo analysis is more efficient than analysis of purified crystals and yields a structure in ~8 days from expression to refinement.

Microcrystallography of Protein Crystals and In Cellulo Diffraction

A protocol is presented for X-ray crystallography using protein microcrystals. Two examples analyzing in vivo-grown microcrystals after purification or in cellulo are compared.

Microcristalografía de Protein Crystals y<em&gt; En Cellulo</em&gt; Difracción

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in ...

Expression and Purification of Mammalian Bestrophin Ion Channels

The human genome encodes four bestrophin paralogs, namely BEST1, BEST2, BEST3, and BEST4. BEST1, encoded by the BEST1 gene, is a Ca2+-activated Cl- channel (CaCC) predominantly expressed in retinal pigment epithelium (RPE). The physiological and pathological significance of BEST1 is highlighted by the fact that over 200 distinct mutations in the BEST1 gene have been genetically linked to a spectrum of at least five retinal degenerative disorders, such as Best vitelliform macular dystrophy (Best disease). Therefore, understanding the biophysics of bestrophin channels at the single-molecule level holds tremendous significance. However, obtaining purified mammalian ion channels is often a challenging task. Here, we report a protocol for the expression of mammalian bestrophin proteins with the BacMam baculovirus gene transfer system and their purification by affinity and size-exclusion chromatography. The purified proteins have the potential to be utilized in subsequent functional and structural analyses, such as electrophysiological recording in lipid bilayers and crystallography. Importantly, this pipeline can be adapted to study the functions and structures of other ion channels.

The purification of ion channels is often challenging, but once achieved, it can potentially allow in vitro investigations of the functions and structures of the channels. Here, we describe the stepwise procedures for the expression and purification of mammalian bestrophin proteins, a family of Ca2+-activated Cl- channels.

Expresión y purificación de los canales iónicos de mamíferos Bestrophin

The human genome encodes four bestrophin paralogs, namely BEST1, BEST2, BEST3, and BEST4. BEST1, encoded by the BEST1 gene, is a Ca2+-activated Cl- ...

Multi-target Parallel Processing Approach for Gene-to-structure Determination of the Influenza Polymerase PB2 Subunit

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States alone, an average of 41,400 deaths and 1.86 million hospitalizations are caused by influenza virus infection each year 1. Point mutations in the polymerase basic protein 2 subunit (PB2) have been linked to the adaptation of the viral infection in humans 2. Findings from such studies have revealed the biological significance of PB2 as a virulence factor, thus highlighting its potential as an antiviral drug target.
The structural genomics program put forth by the National Institute of Allergy and Infectious Disease (NIAID) provides funding to Emerald Bio and three other Pacific Northwest institutions that together make up the Seattle Structural Genomics Center for Infectious Disease (SSGCID). The SSGCID is dedicated to providing the scientific community with three-dimensional protein structures of NIAID category A-C pathogens. Making such structural information available to the scientific community serves to accelerate structure-based drug design.
Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for new lead discovery by targeting a pathway or an entire protein family. Emerald Bio has developed a high-throughput, multi-target parallel processing pipeline (MTPP) for gene-to-structure determination to support the consortium. Here we describe the protocols used to determine the structure of the PB2 subunit from four different influenza A strains.

Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for lead discovery. The following article highlights how the Seattle Structural Genomics Center for Infectious Disease utilizes a multi-target approach for gene-to-structure determination of the PB2 influenza A subunit.

Multi-objetivo enfoque de procesamiento paralelo para Gene a la estructura de determinación de la polimerasa subunidad PB2 Influenza

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States ...

Inmunología e Infección

Expression and Purification of the Human Lipid-sensitive Cation Channel TRPC3 for Structural Determination by Single-particle Cryo-electron Microscopy

Transient receptor potential channels (TRPCs) of the canonical TRP subfamily are nonselective cation channels that play an essential role in calcium homeostasis, particularly store-operated calcium entry, which is critical to maintaining proper function of synaptic vesicle release and intracellular signaling pathways. Accordingly, TRPC channels have been implicated in a variety of human diseases including cardiovascular disorders such as cardiac hypertrophy, neurodegenerative disorders such as Parkinson&#39;s disease, and neurologic disorders such as spinocerebellar ataxia. Therefore, TRPC channels represent a potential pharmacologic target in human diseases. However, the molecular mechanisms of gating in these channels are still unclear. The difficulty in obtaining large quantities of stable, homogeneous, and purified protein has been a limiting factor in structure determination studies, particularly for mammalian membrane proteins such as the TRPC ion channels. Here, we present a protocol for the large-scale expression of mammalian ion channel membrane proteins using a modified baculovirus gene transfer system and the purification of these proteins by affinity and size-exclusion chromatography. We further present a protocol to collect single-particle cryo-electron microscopy images from purified protein and to use these images to determine the protein structure. Structure determination is a powerful method for understanding the mechanisms of gating and function in ion channels.

This protocol describes techniques used to determine ion channel structures by cryo-electron microscopy, including a baculovirus system used to efficiently express genes in mammalian cells with minimum effort and toxicity, protein extraction, purification, and quality checking, sample grid preparation and screening, as well as data collection and processing.

Expresión y purificación de los humanos sensibles a lípido catiónico canal TRPC3 para la determinación estructural por microscopia del Cryo-electrón de solo-partícula

Transient receptor potential channels (TRPCs) of the canonical TRP subfamily are nonselective cation channels that play an essential role in calcium ...

Production of Recombinant PRMT Proteins using the Baculovirus Expression Vector System

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. PRMTs can either mono- or dimethylate arginine guanidino groups symmetrically or asymmetrically. The enzymology of these proteins is a complex and intensely investigated area that requires milligram quantities of high-quality recombinant protein. The baculovirus expression vector system (BEVS) employing Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and Spodoptera frugiperda 9 (Sf9) insect cells has been used for expression screening and production of many PRMTs, including PRMT 1, 2, and 4 through 9. To simultaneously screen for the expression of multiple constructs of these proteins, including domains and truncated fragments as well as the full-length proteins, we have applied scalable methods utilizing adjustable and programmable multichannel pipettes, combined with 24- and 96-well plates and blocks. Overall, these method adjustments enabled a large-scale generation of bacmid DNA, recombinant viruses, and protein expression screening. Using culture vessels with a high-fill volume of Sf9 cell suspension helped to overcome space limitations in the production pipeline for single batch large-scale protein production. Here, we describe detailed protocols for the efficient and cost-effective expression of functional PRMTs for biochemical, biophysical, and structural studies.

The baculovirus expression vector system (BEVS) is a robust platform for expression screening and production of protein arginine methyltransferases (PRMTs) to be used for biochemical, biophysical, and structural studies. Milligram quantities of material can be produced for the majority of PRMTs and other proteins of interest requiring a eukaryotic expression platform.

Producción De Proteínas Prmt Recombinantes Utilizando El Sistema De Vectores De Expresión De Baculovirus

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. ...

Phage Phenomics: Physiological Approaches to Characterize Novel Viral Proteins

Current investigations into phage-host interactions are dependent on extrapolating knowledge from (meta)genomes. Interestingly, 60 - 95% of all phage sequences share no homology to current annotated proteins. As a result, a large proportion of phage genes are annotated as hypothetical. This reality heavily affects the annotation of both structural and auxiliary metabolic genes. Here we present phenomic methods designed to capture the physiological response(s) of a selected host during expression of one of these unknown phage genes. Multi-phenotype Assay Plates (MAPs) are used to monitor the diversity of host substrate utilization and subsequent biomass formation, while metabolomics provides bi-product analysis by monitoring metabolite abundance and diversity. Both tools are used simultaneously to provide a phenotypic profile associated with expression of a single putative phage open reading frame (ORF). Representative results for both methods are compared, highlighting the phenotypic profile differences of a host carrying either putative structural or metabolic phage genes. In addition, the visualization techniques and high throughput computational pipelines that facilitated experimental analysis are presented.

Here, we present phenomic approaches for the functional characterization of putative phage genes. Techniques include a developed assay capable of monitoring host anabolic metabolism, the Multi-phenotype Assay Plates (MAPs), in addition to the established method of metabolomics, capable of measuring effects to catabolic metabolism.

Fenómica fagos: enfoques fisiológicos para caracterizar Novela Virales Proteínas

Current investigations into phage-host interactions are dependent on extrapolating knowledge from (meta)genomes. Interestingly, 60 - 95% of all phage ...

Cristalización de proteínas de membrana transportadoras ABC en bicelas lipídicas

ABCG5/G8 Crystallization in a Lipidic Bicelle Environment for X-Ray Crystallography

ATP-binding cassette (ABC) transporters constitute lipid-embedded membrane proteins. Extracting these membrane proteins from the lipid bilayer to an aqueous environment is typically achieved by employing detergents. These detergents disintegrate the lipid bilayer and solubilize the proteins. The intrinsic habitat of membrane proteins within the lipid bilayer poses a challenge in maintaining their stability and uniformity in solution for structural characterization. Bicelles, which comprise a blend of long and short-chain phospholipids and detergents, replicate the natural lipid structure. The utilization of lipid bicelles and detergents serves as a suitable model system for obtaining high-quality diffraction crystals, specifically to determine the high-resolution structure of membrane proteins. Through these synthetic microenvironments, membrane proteins preserve their native conformation and functionality, facilitating the formation of three-dimensional crystals. In this approach, the detergent-solubilized heterodimeric ABCG5/G8 was reintegrated into DMPC/CHAPSO bicelles, supplemented with cholesterol. This setup was employed in the vapor diffusion experimental procedure for protein crystallization.

Autor destacado: Una configuración de cristalización de bicelas para proteínas de membrana transportadoras ABC para avanzar en el desarrollo de fármacos 

This protocol describes a setup for the crystallization of the sterol transporter ABCG5/G8. ABCG5/G8 is reconstituted into bicelles for hanging-drop crystallization. The protocol does not require specialized materials or substrates, making it accessible and easy to adapt in any laboratory for determining the protein structure through X-ray crystallography.

Cristalización ABCG5/G8 en un entorno de bicelas lipídicas para cristalografía de rayos X

ATP-binding cassette (ABC) transporters constitute lipid-embedded membrane proteins. Extracting these membrane proteins from the lipid bilayer to an ...

Expresión de Proteínas Recombinantes, Cristalización y Estudios Biofísicos de un

Resumen

Explorar más videos

Capítulos en este video

Producción, Cristalización y determinación de la estructura de

Microcristalografía de Protein Crystals y

Expresión y purificación de los canales iónicos de mamíferos Bestrophin

Multi-objetivo enfoque de procesamiento paralelo para Gene a la estructura de determinación de la polimerasa subunidad PB2 Influenza

Expresión y purificación de los humanos sensibles a lípido catiónico canal TRPC3 para la determinación estructural por microscopia del Cryo-electrón de solo-partícula

Producción De Proteínas Prmt Recombinantes Utilizando El Sistema De Vectores De Expresión De Baculovirus

Fenómica fagos: enfoques fisiológicos para caracterizar Novela Virales Proteínas

Cristalización ABCG5/G8 en un entorno de bicelas lipídicas para cristalografía de rayos X

Cristalización ABCG5/G8 en un entorno de bicelas lipídicas para cristalografía de rayos X

Cristalización ABCG5/G8 en un entorno de bicelas lipídicas para cristalografía de rayos X