Diese Arbeit wurde durch Zuschüsse aus dem Shanghai Ausschuss für Wissenschaft und Technologie (15411951800, 15410723200) unterstützt. Die Autoren danken Prof. YuMei Wen und Prof. Chao Zhao der pathogenen Mikroorganismus Abteilung der Fudan-Universität für ihre technische Unterstützung.

Diese Methode wurde in Übereinstimmung mit den genehmigten Richtlinien und Vorschriften der Forschung Ethik Komitee von Huashan Krankenhaus, Fudan University durchgeführt. Entsprechende standard-Sicherheits-Maßnahmen wurden in den einzelnen Schritten gefolgt. Eine schematische Darstellung finden Sie in Abbildung 1.
(1) Zell-Kultur und Plasmid-Konstrukt
<ol><li>Routinemäßig pflegen die menschliche nabelader Endothelzellen (HUVECS) in Dulbecco modifizierten Adlers Medium (DMEM) ergänzt mit 10 % fetalen bovine Serum (FBS), 100-Einheit/mL Penicillin und 100 µg/mL von Streptomycin in einer befeuchteten 5 % CO2 Inkubator bei 37 ° C.</li>
	<li>PLKO.1 Plasmid ApaI mit EcoRI für die Synthese von ShRNA Fragment zu verdauen. Sicherstellen Sie, dass die Oligonukleotid-Sequenz von VHL ShRNA Vektor CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14.</li>
	<li>Dann mischen Sie 20 µΜ System mit vorwärts 5 µL 5 µL reverse Oligo Oligo, 5 µL 10 x NEB Puffer und 35 µL DdH2O zusammen (das Gesamtvolumen beträgt 50 µL). Erhitzen Sie die Mischung bei 98 ° C für 4 min, und langsam auf Raumtemperatur abkühlen, in ein paar Stunden.</li>
	<li>Verbinden Sie die geglühten Oligos und PLKO.1 Plasmid zusammen mit T4-Ligase bei 4 ° C für eine Nacht. 16 h später hinzufügen 5 µL Ligatur-Mix in 25 µL kompetente DH5α Zellen. Dann Bildschirm erfolgreich aufgespaltenen Plasmiden, und überprüfen Sie die eingefügte Fragment durch Sequenzierung.</li>
</ol>(2) Lentivirus Paket und Infektion
<ol><li>Insgesamt mischen Sie 10 µg des PLKO.1-ShVHL oder PLKO.1-ShScramble Vektors, 7,5 µg Plasmid psPAX2 zu verpacken und 2,5 µg Umschlag Plasmid pMD2.G in 500 µL der DMEM Medien ohne fetalen bovine Serum (FBS) für 25 min.</li>
	<li>Fügen Sie 7 mLDMEM ohne FBS der Projektmappe bereit oben hinzu.</li>
	<li>Kulturzellen Sie 293 FT in DMEM ohne FBS in einem Durchmesser von 10 cm Gewebekultur Gerichte. Stellen Sie sicher, dass die Anzahl der Zellen 293FT 1 x 107 Zelle Zähler.</li>
	<li>Fügen Sie 1 mL der Lösung bereit, über das Medium der 293FT Zellen zur Transfektion. Hinweis: Die Zell-Linie 293FT 293F Zelllinie abgeleitet ist und stabil express das SV40 große T-Antigen. Daher ist es ein geeigneter Gastgeber für Lentivirale Produktion.</li>
	<li>Ersetzen Sie das Kulturmedium mit der DMEM mit 10 % FBS nach 6 h.</li>
	<li>Sammeln Sie die Medien mit einer Pipette in 48 h nach Transfektion. Hinweis: Das Virus existiert in der DMEM mit 10 % FBS. Die abgestorbenen Zellen Schwimmen auf dem Medium. Verwenden Sie sterile Membran 0,45 µm, um abgestorbenen Zellen und Unreinheiten zu filtern. Im Allgemeinen gibt es keine Notwendigkeit, die Multiplizität der Infektion (MOI) zu überprüfen. Dies soll eine stabile Zellen-Linie zu schaffen. Im letzten Schritt werden alle lebenden Zellen ohne erfolgreiche Infektion durch Puromycin sterben. Die ShScramble Gruppe und HUVECS Zellen sind der Kontrollgruppe. Stellen Sie sicher, dass die HUVECS Zellen mit der verwendeten Puromycin Konzentration von 72 h sterben. Jeder Brunnen hat die gleiche Anzahl von Zellen.</li>
	<li>Kultur der HUVECS Zellen in den Lentivirale Medien für 72 h. Fügen Sie Puromycin zu den Medien der HUVECS Zellen in einer Konzentration von 2 µg/mL für 24 Std. Einsatz HUVECS Zellen ohne Behandlung als die Kontrollgruppe. Stellen Sie sicher, dass alle Zellen sterben bis zu diesem Zeitpunkt zu kontrollieren. Hinweis: Die lebenden Zellen repräsentieren eine stabile Zelllinie von VHL Knockdown Zellen und ShSramble Zellen. Die Beschichtung ist 5.000/Brunnen in 96-Well Platten.</li>
</ol>3. Generation von Endothelzellen Sphäroide
<ol><li>Trypsinize die Mediumwechsel Zellen und Aufschwemmen mittelfristig DMEM mit 10 % FBS. Hinzugeben Sie mit einer moderaten Anzahl von Zellen in der Kulturschale von 10 cm 1 mL Typsin-EDTA.</li>
	<li>Samen der Zellen in einem 3D Rundboden 96-Well-Platte in einer Zelle Dichte von 1 × 103 Zellen/gut. Verwenden Sie einen Brunnen, der ein Sphäroid von 0,50 µL aussetzen der Sphäroid unterbringen kann. Anzahl Zellen mit einem Zellsystem Zähler nach den Anweisungen des Herstellers.</li>
	<li>Inkubieren Sie die Zellen bei 37 ° C und 5 % CO2 kontinuierlich für 72 h. Sicherzustellen Sie unter diesen Bedingungen, dass die suspendierten Zellen die Zelle Sphäroide automatisch bilden. Ersetzen Sie die Hälfte des Kulturmediums nach 36 h.</li>
</ol>4. in-vitro- Angiogenese-Assay
<ol><li>Tauen Sie die Gel-Lösung bei 4 ° C auf und verdünnen Sie es mit dem reduzierten Serum Medium bei einem Verdünnungsverhältnis von 1:5.</li>
	<li>Saugen Sie die Sphäroide aus dem Kulturmedium DMEM mit einer Mikropipette. Nach dem Waschen aussetzen die Sphäroide mit 5 mL des Mediums reduzierte Serum der Sphäroide sanft und vorsichtig in das verwässerte Gel. Stellen Sie sicher, dass keine Luftblasen vorhanden sind.</li>
	<li>300 µL der gemischten Flüssigkeit in ein 15-Well-Platte einbetten. Fügen Sie nach der Inkubation bei 37 ° C und 5 % CO2 für 1 h 400 µL reduzierte Serum-Medium in jede Vertiefung hinzu. Füllen Sie steriles Wasser um die Brunnen zu erzeugen eine feuchte Umgebung um Verdunstung zu verhindern.</li>
	<li>Danach die Platte bei 37 ° C in 5 % CO2 bei 100 % Luftfeuchtigkeit für 1 h Kultur.</li>
	<li>Vorsichtig Aspirieren Sie das alte Medium und ersetzen Sie es durch 600 µL reduzierte Serum-Medium mit 1 % Endothelzellen Ergänzungen in jede Vertiefung.</li>
	<li>Nach 12 h oder 24 h, nehmen Bilder unter einem invertierten Lichtmikroskop (40 *).</li>
</ol>(5) Datenanalyse
<ol><li>Laden Sie die Bilder, um eine Online-Bild-Analyse-Plattform sprießen Längendaten (Table of Materials) zu erhalten.</li>
	<li>Erstellen Sie ein Konto auf der Webseite per e-Mail.</li>
	<li>Dann laden Sie die Bilder durch Klicken auf die Schaltfläche "hochladen".</li>
	<li>Herunterladen Sie das Ergebnis durch Klicken auf die Schaltfläche "Download". Hinweis: Die Software generiert das bearbeitete Bild und die Daten. Die Daten enthalten fünf Teile: kumulative sprießen, mittlere sprießen Länge, die Standardabweichung der Länge sprießen, Keimen und Sphäroid Bereich. In das bearbeitete Bild jeden Parameter sind zusammengefasst in einer anderen Farbe, Identifikation in das bearbeitete Bild erleichtern: Rot steht für Sprossen Skelett, Gelb die Anzahl der Sprossen, blau sprießen Struktur, weißen sprießen Ende und orange Sphäroid.</li>
</ol>

<ol>
	<li>Lonser, R. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=von+Hippel-Lindau+disease.">von Hippel-Lindau disease.</a> Lancet. 361 (9374), 2059-2067 (2003).</li><li>Hussein, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+nervous+system+capillary+haemangioblastoma:+the+pathologist's+viewpoint.">Central nervous system capillary haemangioblastoma: the pathologist's viewpoint.</a> Int J Exp Pathol. 88 (5), 311-324 (2007).</li><li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemangioblastomas+might+derive+from+neoplastic+transformation+of+neural+stem+cells/progenitors+in+the+specific+niche.">Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche.</a> Carcinogenesis. 32 (1), 102-109 (2011).</li><li>Zhuang, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+derived+vasculogenesis+in+von+Hippel-Lindau+disease-associated+tumors.">Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors.</a> Sci Rep. 4, 4102 (2014).</li><li>Glasker, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VHL-deficient+vasculogenesis+in+hemangioblastoma.">VHL-deficient vasculogenesis in hemangioblastoma.</a> Exp Mol Pathol. 96 (2), 162-167 (2014).</li><li>Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Up-regulation+of+vascular+endothelial+growth+factor+and+its+receptors+in+von+Hippel-Lindau+disease-associated+and+sporadic+hemangioblastomas.">Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas.</a> Cancer Res. 55 (6), 1358-1364 (1995).</li><li>Cancilla, P. A., Zimmerman, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+fine+structure+of+a+cerebellar+hemangioblastoma.">The fine structure of a cerebellar hemangioblastoma.</a> J Neuropathol Exp Neurol. 24 (4), 621-628 (1965).</li><li>Kawamura, J., Garcia, J. H., Kamijyo, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cerebellar+hemangioblastoma:+histogenesis+of+stroma+cells.">Cerebellar hemangioblastoma: histogenesis of stroma cells.</a> Cancer. 31 (6), 1528-1540 (1973).</li><li>Jurco, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemangioblastomas:+histogenesis+of+the+stromal+cell+studied+by+immunocytochemistry.">Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry.</a> Hum Pathol. 13 (1), 13-18 (1982).</li><li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+tumorigenic+cells+and+implication+of+their+aberrant+differentiation+in+human+hemangioblastomas.">Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas.</a> Cancer Biol Ther. 12 (8), 727-736 (2011).</li><li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD41+and+CD45+expression+marks+the+angioformative+initiation+of+neovascularisation+in+human+haemangioblastoma.">CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma.</a> Tumour Biol. 37 (3), 3765-3774 (2016).</li><li>Sharifpanah, F., Sauer, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stem+Cell+Spheroid-Based+Sprout+Assay+in+Three-Dimensional+Fibrin+Scaffold:+A+Novel+In+Vitro+Model+for+the+Study+of+Angiogenesis.">Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis.</a> Methods Mol Biol. 1430, 179-189 (2016).</li><li>Cai, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+taurine+upregulated+1+enhances+tumor-induced+angiogenesis+through+inhibiting+microRNA-299+in+human+glioblastoma.">Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma.</a> Oncogene. 36 (3), 318-331 (2017).</li><li>Xu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Conveniently+Screening+pLKO.1-TRC+Vector+Tagged+with+TurboGFP.">Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP.</a> Appl Biochem Biotechnol. 181 (2), 699-709 (2017).</li><li>Laib, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spheroid-based+human+endothelial+cell+microvessel+formation+in+vivo.">Spheroid-based human endothelial cell microvessel formation in vivo.</a> Nat Protoc. 4 (8), 1202-1215 (2009).</li><li>D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Angiogenesis+and+Vasculogenesis+in+Health+and+Disease.">Angiogenesis and Vasculogenesis in Health and Disease.</a> Biomed Res Int. 2015, 126582 (2015).</li><li>Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impaired+in+vivo+vasculogenic+potential+of+endothelial+progenitor+cells+in+comparison+to+human+umbilical+vein+endothelial+cells+in+a+spheroid-based+implantation+model.">Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model.</a> Cell Prolif. 42 (4), 498-505 (2009).</li><li>Morin, K. T., Tranquillo, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+models+of+angiogenesis+and+vasculogenesis+in+fibrin+gel.">In vitro models of angiogenesis and vasculogenesis in fibrin gel.</a> Exp Cell Res. 319 (16), 2409-2417 (2013).</li><li>Blacher, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+invasion+in+the+spheroid+sprouting+assay:+a+spatial+organisation+analysis+adaptable+to+cell+behaviour.">Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour.</a> PLoS One. 9 (5), 97019 (2014).</li><li>Straume, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+heat+shock+protein+27+induces+long-term+dormancy+in+human+breast+cancer.">Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer.</a> Proc Natl Acad Sci U S A. 109 (22), 8699-8704 (2012).</li><li>Naumov, G. N., Akslen, L. A., Folkman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+angiogenesis+in+human+tumor+dormancy:+animal+models+of+the+angiogenic+switch.">Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch.</a> Cell Cycle. 5 (16), 1779-1787 (2006).</li><li>Naumov, G. N., Folkman, J., Straume, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+dormancy+due+to+failure+of+angiogenesis:+role+of+the+microenvironment.">Tumor dormancy due to failure of angiogenesis: role of the microenvironment.</a> Clin Exp Metastasis. 26 (1), 51-60 (2009).</li><li>Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroprotective+effects+respond+to+cerebral+ischemia+without+susceptibility+to+HB-tumorigenesis+in+VHL+heterozygous+knockout+mice.">Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice.</a> Mol Carcinog. 56 (10), 2342-2351 (2017).</li><li>Stratmann, R., Krieg, M., Haas, R., Plate, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Putative+control+of+angiogenesis+in+hemangioblastomas+by+the+von+Hippel-Lindau+tumor+suppressor+gene.">Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene.</a> J Neuropathol Exp Neurol. 56 (11), 1242-1252 (1997).</li><li>Correa de Sampaio, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+heterogeneous+in+vitro+three+dimensional+model+of+tumour-stroma+interactions+regulating+sprouting+angiogenesis.">A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis.</a> PLoS One. 7 (2), 30753 (2012).</li></ol>

Die Autoren haben nichts preisgeben.

Vor kurzem wurden mehrere Felder der vaskulären Biologie Forschung durch die Studie der angiogenen Endothel15stimuliert. In diesem Artikel, entwickelten wir eine endotheliale Sphäroid sprießen Technik als ein experimentelles Modell die Gefäß-Bildung zu studieren aus den Funktionsverlust des VHL-Gens in manipulierten Endothelzellen, neuartige Kandidaten Moleküle zu identifizieren die angiogenen Kaskade. Nach bestem Wissen und gewissen ist dies der erste Bericht der angiogenen Auswirkungen der...

Hämangioblastome (HBs) sind gutartige vaskuläre Tumore, die ausschließlich im menschlichen Zentralnervensystem (ZNS) gefunden werden. Sie entwickeln sich bei Patienten mit von Hippel-Lindau (VHL) Erkrankung oder sporadische Läsionen. VHL-HBs sind schwer zu heilen durch chirurgische Behandlung durch die häufige Wiederholung und multiple Läsionen, die sich daraus genetische ergeben Störung1. Obwohl die Inaktivierung von VHL Tumorsuppressor Gen die eigentliche Ursache der Tumorgenese von VHL-HBs angesehen wurde, bleiben die zytologische Ursprung (einschließlich Neovaskularisation) und evolutionären Prozess der HBs weitgehend umstritten2. Daher kann ein besseres Verständnis der biologischen Mechanismen der HB-neovaskulären nützliche Einblicke in die vielversprechendsten Anti-vaskulären Strategien VHL-HBs vorsehen.
Neue Forschung hat vorgeschlagen, dass HB-Neovaskularisation, die embryologische Vaskulogenese3,4,5 ähnelt. Klassische vaskulären endothelialen Wachstumsfaktor (VEGF)-vermittelten Angiogenese, entstand aus dem vaskulären Endothel und, angetrieben durch VHL Funktionsverlust, führte zu Verbreitung und neovaskulären Formation, die seit6in Frage gestellt. In 1965, Cancilla und Zimmerman gefunden, verwenden Elektronenmikroskopie, die das Endothel7HBs stammt. Später wurde festgestellt, dass Vasoformative Element8Stromazellen Zellen abgeleitet werden. 1982 fand Jurco Et Al. , dass Stromazellen Zellen von endothelialen Ursprungs-9. Daher vermutet wir, dass menschliche vaskuläre endotheliale Zellen der ursprünglichen Zellen von HB-Neovaskularisation10sind. Obwohl es besser, die Primärkulturen von HB Zellen aus VHL-Patienten Operationen zu verwenden ist, zufolge unserer bisherigen Forschung Primärkulturen von HB sind nicht stabil, und Zell-Linien könnte nicht etablierten3. Darüber hinaus könnte Primärkulturen in der 3D-Umgebung die zytologische Herkunft der HB-Neovaskularisation nicht erkennen, weil sie Vorfahren der HB-Kreislauf Zutaten10,11enthalten. Daher, als primitiv und klassische Modell von Endothelzellen, konnte menschliche vaskuläre endotheliale Zellen (HUVECS) als ein alternatives zellulären Modell für HBs dienen.
Der Sphäroid Sprießende Assay ist ein neues Modell im Tissue engineering12,13. In diesem Papier war ein 3D Kollagen-basierten Coculture System in Vitro mit den Sphäroid sprießen Assay entwickelt mit ein Gesamtziel zu beurteilen, ob klassische Tumor-Angiogenese in HBs, sowie ihre Rolle bei der HBs vorhanden ist.

<table><tbody><tr><td>human umbilical vein endothelial cell</td><td>Fudan IBS Cell Center</td><td>FDCC-HXN180</td><td></td></tr><tr><td>dulbecco&amp;rsquo;s modified eagle&amp;rsquo;s medium&amp;nbsp;</td><td>Gibco</td><td>11995040</td><td></td></tr><tr><td>fetal bovine serum</td><td>Gibco</td><td>&amp;nbsp;26400044</td><td></td></tr><tr><td>PLKO.1-puro vector</td><td>Addgene</td><td>#8453</td><td></td></tr><tr><td>packing plasmid psPAX2&amp;nbsp;</td><td>Addgene</td><td>#12260</td><td></td></tr><tr><td>envelope plasmid pMD2.G</td><td>Addgene</td><td>#12259</td><td></td></tr><tr><td>3D round-bottom 96-well plates</td><td>S-Bio</td><td>MS-9096M</td><td></td></tr><tr><td>matrigel</td><td>BD Biosciences</td><td>354234</td><td></td></tr><tr><td>Opti-MEM medium</td><td>Gibco</td><td>31985-070</td><td>reduced serum medium&amp;nbsp;</td></tr><tr><td>15-well plate</td><td>Ibidi</td><td>81501</td><td>Air bubbles in the gel can be reduced by equilibrating the &amp;mu;&amp;ndash;Slide angiogenesis before usage inside the incubator overnight</td></tr><tr><td>endothelial cell growth supplements</td><td>Sciencell</td><td>#1052</td><td></td></tr><tr><td>10-cm culture dish</td><td>Corning</td><td>Scipu000813</td><td></td></tr><tr><td>Puromycin</td><td>Gibco</td><td>A1113802</td><td></td></tr><tr><td>typsin-EDTA</td><td>Gibco</td><td>25200056</td><td></td></tr><tr><td>Automated Cell Counter System &amp;nbsp;</td><td>BioTech</td><td></td><td></td></tr><tr><td>Image Analysis software&amp;nbsp;</td><td>Winmasis</td><td></td><td>http://mywim.wimasis.com&amp;nbsp;</td></tr></tbody></table>

a comprehensive procedure to evaluate the in vitro performance of the putative hemangioblastoma neovascularization using the spheroid sprouting assay

Die Inaktivierung von der von Hippel-Lindau (VHL) Tumorsuppressor Gen spielt eine entscheidende Rolle bei der Entwicklung von Hämangioblastome (HBs) innerhalb der menschlichen Zentralnervensystem (ZNS). Jedoch die zytologische Herkunft und den evolutionären Prozess der HBs (einschließlich Neovaskularisation) bleiben umstritten und Anti-Angiogenese für VHL-HBs, basierend auf klassischen HB Angiogenese habe produziert enttäuschende Ergebnisse in klinischen Studien. Ein Haupthindernis für die erfolgreiche klinische Übersetzung des Anti-vaskuläre Behandlung ist der Mangel an ein gründliches Verständnis der Neovaskularisation in dieser vaskulären Tumor. In diesem Artikel präsentieren wir Ihnen ein umfassendes Verfahren zur in-Vitro zu bewerten, ob klassische Tumor-Angiogenese in HBs, sowie ihre Rolle bei der HBs vorhanden ist. Mit diesem Verfahren können Forscher genau verstehen die Komplexität der HB Neovaskularisation und die Funktion von dieser Form der Angiogenese in HBs erkennen. Diese Protokolle können verwendet werden, die vielversprechendste Anti-vaskuläre Therapie bei Tumoren, bewerten die translationale Potenzial für die Behandlung von Tumoren oder für die Unterstützung bei der Optimierung der Anti-angiogenen Behandlung für HBs in Zukunft Übersetzungen hat. Die Ergebnisse unterstreichen die Komplexität der HB Neovaskularisation und legen nahe, dass dieses gemeinsame Form Angiogenese nur eine ergänzende Mechanismus in HB Neovaskularisation ist.

Originalbilder werden durch umgekehrte Lichtmikroskop getroffen. Die typische Bilder von der Kontrollgruppe und der VHL-Gruppe sind in Abbildung 2dargestellten-A1 und Abbildung 2-A2. Die Sprießende Länge der Kontrollgruppe ist kürzer als die der VHL-Gruppe.
Nach dem Hochladen der Bilder, bietet die Online-Plattform direkt Analyseerge...

Watch this Scientific Journal Video about A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay at JoVE.

A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

Ein umfassendes Verfahren zur Bewertung der In-vitro- Leistung von der vermeintlichen Hämangioblastom Neovaskularisation mit den Sphäroid sprießen Assay

Dieser Beitrag stellt ein umfassendes Verfahren zur in Vitro zu bewerten, ob klassische Tumor-Angiogenese im Hämangioblastome (HBs) und ihre Rolle bei der HBs vorhanden ist. Die Ergebnisse unterstreichen die Komplexität der HB-Neovaskularisation und deuten darauf hin, dass diese Form der Angiogenese nur einen ergänzenden Mechanismus in der HB-Neovaskularisation ist.

The inactivation of the von Hippel-Lindau (VHL) tumor suppressor gene plays a crucial role in the development of hemangioblastomas (HBs) within the human ...

a-comprehensive-procedure-to-evaluate-vitro-performance-putative

Universidad de Cartagena UDEC

Research

JoVE Journal

Cancer Research

A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

7.9K Aufrufe.  Fudan University. Dieser Beitrag stellt ein umfassendes Verfahren zur in Vitro zu bewerten, ob klassische Tumor-Angiogenese im Hämangioblastome (HBs) und ihre Rolle bei der HBs vorhanden ist. Die Ergebnisse unterstreichen die Komplexität der HB-Neovaskularisation und deuten darauf hin, dass diese Form der Angiogenese nur einen ergänzenden Mechanismus in der HB-Neovaskularisation ist.

Serie: A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

A 3D Spheroid Model as a More Physiological System for Cancer-Associated Fibroblasts Differentiation and Invasion In Vitro Studies

Defining the ideal model for an in vitro study is essential, mainly if studying physiological processes such as differentiation of cells. In the tumor stroma, host fibroblasts are stimulated by cancer cells to differentiate. Thus, they acquire a phenotype that contributes to the tumor microenvironment and supports tumor progression. By using the spheroid model, we have set up such a 3D in vitro model system, in which we analyzed the role of laminin-332 and its receptor integrin &#945;3&#946;1 in this differentiation process. This spheroid model system not only reproduces the tumor microenvironment conditions in a more accurate way, but also is a very versatile model since it allows different downstream studies, such as immunofluorescent staining of both intra- and extracellular markers, as well as deposited extracellular matrix proteins. Moreover, transcriptional analyses by qPCR, flow cytometry and cellular invasion can be studied with this model. Here, we describe a protocol of a spheroid model to assess the role of CAFs&#39; integrin &#945;3&#946;1 and its ectopically deposited ligand, laminin-332, in differentiation and in supporting the invasion of pancreatic cancer cells.

The goal of this protocol is to establish a 3D in vitro model to study the differentiation of cancer-associated fibroblasts (CAFs) in a tumor bulk-like environment, which can be addressed in different analysis systems, such as immunofluorescence, transcriptional analysis and life cell imaging.

Ein 3D-Spheroid-Modell als physiologischeres System für krebsassoziierte Fibroblasten Differenzierung und Invasion In Vitro-Studien

Defining the ideal model for an in vitro study is essential, mainly if studying physiological processes such as differentiation of cells. In the tumor ...

Forschung

Krebsforschung

A 3D Spheroid Model for Glioblastoma

Two-dimensional (2D) cell cultures do not mimic in vivo tumor growth satisfactorily. Therefore, three-dimensional (3D) culture spheroid models were developed. These models may be particularly important in the field of neuro-oncology. Indeed, brain tumors have the tendency to invade the healthy brain environment. We describe herein an ideal 3D glioblastoma spheroid-based assay that we developed to study tumor invasion. We provide all technical details and analytical tools to successfully perform this assay.

Here, we describe an easy-to-use invasion assay for glioblastoma. This assay is suitable for glioblastoma stem-like cells. A Fiji macro for easy quantification of invasion, migration, and proliferation is also described.

Ein 3D Spheroid Modell für Glioblastom

Two-dimensional (2D) cell cultures do not mimic in vivo tumor growth satisfactorily. Therefore, three-dimensional (3D) culture spheroid models were ...

Incorporating Pericytes into an Endothelial Cell Bead Sprouting Assay

Angiogenesis is the growth of new vessels from pre-existing vasculature and is an important component of many biological processes, including embryogenesis and development, wound healing, tumor growth and metastasis, and ocular and cardiovascular diseases. Effective in vitro models that recapitulate the biology of angiogenesis are needed to appropriately study this process and identify mechanisms of regulation that can be ultimately targeted for novel therapeutic strategies. The bead angiogenesis assay has been previously demonstrated to recapitulate the multiple stages of endothelial sprouting in vitro. However, a limitation of this assay is a lack of endothelial &#8211; mural cell interactions, which are key to the molecular and phenotypic regulation of endothelial cell function in vivo. The protocol given here presents a methodology for the incorporation of mural cells into the bead angiogenesis assay and demonstrates a tight association of endothelial cells and pericytes during sprouting in vitro. The protocol also details a methodology for effective silencing of target genes using siRNA in endothelial cells for mechanistic studies. Altogether, this protocol provides an in vitro assay that more appropriately models the diverse cell types involved in sprouting angiogenesis, and provides a more physiologically-relevant platform for therapeutic assessment and novel discovery of mechanisms of angiogenesis regulation.

This protocol presents a novel in vitro bead assay that more appropriately models the process of in vivo sprouting angiogenesis by incorporating pericytes. This modification enables the bead assay to more faithfully recapitulate the heterotypic cellular interactions between endothelial cells and mural cells that are critical for angiogenesis.

Einbeziehung der Perizyten in einem Endothelzellen Korn sprießen Assay

Angiogenesis is the growth of new vessels from pre-existing vasculature and is an important component of many biological processes, including ...

Entwicklungsbiologie

Three-dimensional Angiogenesis Assay System using Co-culture Spheroids Formed by Endothelial Colony Forming Cells and Mesenchymal Stem Cells

Studies in the field of angiogenesis have been aggressively growing in the last few decades with the recognition that angiogenesis is a hallmark of more than 50 different pathological conditions, such as rheumatoid arthritis, oculopathy, cardiovascular diseases, and tumor metastasis. During angiogenesis drug development, it is crucial to use in vitro assay systems with appropriate cell types and proper conditions to reflect the physiologic angiogenesis process. To overcome limitations of current in vitro angiogenesis assay systems using mainly endothelial cells, we developed a 3-dimensional (3D) co-culture spheroid sprouting assay system. Co-culture spheroids were produced by two human vascular cell precursors, endothelial colony forming cells (ECFCs) and mesenchymal stem cells (MSCs) with a ratio of 5 to 1. ECFCs+MSCs spheroids were embedded into type I collagen matrix to mimic the in vivo extracellular environment. A real-time cell recorder was utilized to continuously observe the progression of angiogenic sprouting from spheroids for 24 h. Live cell fluorescent labeling technique was also applied to tract the localization of each cell type during sprout formation. Angiogenic potential was quantified by counting the number of sprouts and measuring the cumulative length of sprouts generated from the individual spheroids. Five randomly-selected spheroids were analyzed per experimental group. Comparison experiments demonstrated that ECFCs+MSCs spheroids showed greater sprout number and cumulative sprout length compared with ECFCs-only spheroids. Bevacizumab, an FDA-approved angiogenesis inhibitor, was tested with the newly-developed co-culture spheroid assay system to verify its potential to screen anti-angiogenic drugs. The IC50 value for ECFCs+MSCs spheroids compared to the ECFCs-only spheroids was closer to the effective plasma concentration of bevacizumab obtained from the xenograft tumor mouse model. The present study suggests that the 3D ECFCs+MSCs spheroid angiogenesis assay system is relevant to physiologic angiogenesis, and can predict an effective plasma concentration in advance of animal experiments.

Three-dimensional co-culture spheroid angiogenesis assay system is designed to mimic the physiologic angiogenesis. Co-culture spheroids are formed by two human vascular cell precursors, ECFCs and MSCs, and embedded in collagen gel. The new system is effective for evaluating angiogenic modulators, and provides more relevant information to the in vivo study.

Dreidimensionales Angiogenese-Assay-System mit Co-Culture-Spheroiden, die von endotheliaalen Koloniebildenden Zellen und mesenchymalen Stammzellen gebildet werden

Studies in the field of angiogenesis have been aggressively growing in the last few decades with the recognition that angiogenesis is a hallmark of more ...

Spheroid Drug Sensitivity Screening in Glioma Stem Cell Lines

In vitro drug sensitivity screens are important tools in the discovery of anti-cancer drug combination therapies. Typically, these in vitro drug screens are performed on cells grown in a monolayer. However, these two-dimensional (2D) models are considered less accurate compared to three-dimensional (3D) spheroid cell models; this is especially true for glioma stem cell lines. Cells grown in spheres activate different signaling pathways and are considered more representative of in vivo models than monolayer cell lines. This protocol describes a method for in vitro drug screening of spheroid lines; mouse and human glioma stem cell lines are used as an example. This protocol describes a 3D spheroid drug sensitivity and synergy assay that can be used to determine if a drug or drug combination induces cell death and if two drugs synergize. Glioma stem cell lines are&#160;modified to express RFP. Cells are plated in low attachment round well bottom 96 plates, and spheres are allowed to form overnight. Drugs are added, and the growth is monitored by measuring the RFP signal over time using the Incucyte live imaging system,&#160;a fluorescence microscope embedded in the tissue culture incubator. Half maximal inhibitory concentration (IC50), median lethal dose (LD50), and synergy score are subsequently calculated to evaluate sensitivities to drugs alone or in combination. The three-dimensional nature of this assay&#160;provides a more accurate reflection of tumor growth, behavior, and drug sensitivities in vivo, thus forming the basis for further preclinical investigation.

In vitro drug sensitivity screens are important tools for discovering anti-cancer drug combinations. Cells grown in spheres activate different signaling pathways and are considered more representative of in vivo models than monolayer cell lines. This protocol describes a method for in vitro drug screening for spheroid lines.

In vitro drug sensitivity screens are important tools in the discovery of anti-cancer drug combination therapies. Typically, these in vitro drug screens ...

Three-Dimensional (3D) Tumor Spheroid Invasion Assay

Invasion of surrounding normal tissues is generally considered to be a key hallmark of malignant (as opposed to benign) tumors. For some cancers in particular (e.g., brain tumors such as glioblastoma multiforme and squamous cell carcinoma of the head and neck &#8211; SCCHN) it is a cause of severe morbidity and can be life-threatening even in the absence of distant metastases. In addition, cancers which have relapsed following treatment unfortunately often present with a more aggressive phenotype. Therefore, there is an opportunity to target the process of invasion to provide novel therapies that could be complementary to standard anti-proliferative agents. Until now, this strategy has been hampered by the lack of robust, reproducible assays suitable for a detailed analysis of invasion and for drug screening. Here we provide a simple micro-plate method (based on uniform, self-assembling 3D tumor spheroids) which has great potential for such studies. We exemplify the assay platform using a human glioblastoma cell line and also an SCCHN model where the development of resistance against targeted epidermal growth factor receptor (EGFR) inhibitors is associated with enhanced matrix-invasive potential. We also provide two alternative methods of semi-automated quantification: one using an imaging cytometer and a second which simply requires standard microscopy and image capture with digital image analysis.

Three-Dimensional 3D Tumor Spheroid Invasion Assay

Invasion of surrounding normal tissues is a defining characteristic of malignant tumors. We provide here a simple, semi-automated micro-plate assay of invasion into a natural 3D biomatrix that has been exemplified with a number of models of advanced human cancers.

Dreidimensionale (3D) Tumor Spheroid Invasionsassay

Invasion of surrounding normal tissues is generally considered to be a key hallmark of malignant (as opposed to benign) tumors. For some cancers in ...

Medizin

Perfusable Vascular Network with a Tissue Model in a Microfluidic Device

A spheroid (a multicellular aggregate) is regarded as a good model of living tissues in the human body. Despite the significant advancement in the spheroid cultures, a perfusable vascular network in the spheroids remains a critical challenge for long-term culture required to maintain and develop their functions, such as protein expressions and morphogenesis. The protocol presents a novel method to integrate a perfusable vascular network within the spheroid in a microfluidic device. To induce a perfusable vascular network in the spheroid, angiogenic sprouts connected to microchannels were guided to the spheroid by utilizing angiogenic factors from human lung fibroblasts cultured in the spheroid. The angiogenic sprouts reached the spheroid, merged with the endothelial cells co-cultured in the spheroid, and formed a continuous vascular network. The vascular network could perfuse the interior of the spheroid without any leakage. The constructed vascular network may be further used as a route for supply of nutrients and removal of waste products, mimicking blood circulation in vivo. The method provides a new platform in spheroid culture toward better recapitulation of living tissues.

The protocol describes how to engineer a perfusable vascular network in a spheroid. The spheroid's surrounding microenvironment is devised to induce angiogenesis and connect the spheroid to the microchannels in a microfluidic device. The method allows the perfusion of the spheroid, which is a long-awaited technique in three-dimensional cultures.

Perfusable vaskuläre Netzwerk mit einem Gewebe-Modell in einem mikrofluidischen Gerät

A spheroid (a multicellular aggregate) is regarded as a good model of living tissues in the human body. Despite the significant advancement in the ...

Biotechnik

Standardized and Scalable Assay to Study Perfused 3D Angiogenic Sprouting of iPSC-derived Endothelial Cells In Vitro

Pre-clinical drug research of vascular diseases requires in vitro models of vasculature that are amendable to high-throughput screening. However, current in vitro screening models that have sufficient throughput only have limited physiological relevance, which hinders the translation of findings from in vitro to in vivo. On the other hand, microfluidic cell culture platforms have shown unparalleled physiological relevancy in vitro, but often lack the required throughput, scalability and standardization. We demonstrate a robust platform to study angiogenesis of endothelial cells derived from human induced pluripotent stem cells (iPSC-ECs) in a physiological relevant cellular microenvironment, including perfusion and gradients. The iPSC-ECs are cultured as 40 perfused 3D microvessels against a patterned collagen-1 scaffold. Upon the application of a gradient of angiogenic factors, important hallmarks of angiogenesis can be studied, including the differentiation into tip- and stalk cell and the formation of perfusable lumen. Perfusion with fluorescent tracer dyes enables the study of permeability during and after anastomosis of the angiogenic sprouts. In conclusion, this method shows the feasibility of iPSC-derived ECs in a standardized and scalable 3D angiogenic assay that combines physiological relevant culture conditions in a platform that has the required robustness and scalability to be integrated within the drug screening infrastructure.

This method describes the culture of iPSC-derived endothelial cells as 40 perfused 3D microvessels in a standardized microfluidic platform. This platform enables the study of gradient-driven angiogenic sprouting in 3D, including anastomosis and stabilization of the angiogenic sprouts in a scalable and high-throughput manner.

Standardisierter und skalierbarer Assay zur Untersuchung perfused 3D Angiogenic Sprouting of iPSC-derived Endothelial Cells In Vitro

Pre-clinical drug research of vascular diseases requires in vitro models of vasculature that are amendable to high-throughput screening. However, current ...

An Ex Vivo Choroid Sprouting Assay of Ocular Microvascular Angiogenesis

Pathological choroidal angiogenesis, a salient feature of age-related macular degeneration, leads to vision impairment and blindness. Endothelial cell (EC) proliferation assays using human retinal microvascular endothelial cells (HRMECs) or isolated primary retinal ECs are widely used in vitro models to study retinal angiogenesis. However, isolating pure murine retinal endothelial cells is technically challenging and retinal ECs may have different proliferation responses than choroidal endothelial cells and different cell/cell interactions. A highly reproducible ex vivo choroidal sprouting assay as a model of choroidal microvascular proliferation was developed. This model includes the interaction between choroid vasculature (EC, macrophages, pericytes) and retinal pigment epithelium (RPE). Mouse RPE/choroid/scleral explants are isolated and incubated in growth-factor-reduced basal membrane extract (BME) (day 0). Medium is changed every other day and choroid sprouting is quantified at day 6. The images of individual choroid explant are taken with an inverted phase microscope and the sprouting area is quantified using a semi-automated macro plug-in to the ImageJ software developed in this lab. This reproducible ex vivo choroidal sprouting assay can be used to assess compounds for potential treatment and for microvascular disease research to assess pathways involved in choroidal micro vessel proliferation using wild type and genetically modified mouse tissue.

This protocol presents choroid sprouting assay, an ex vivo model of microvascular proliferation. This assay can be used to assess pathways involved in proliferating choroidal micro vessels and assess drug treatments using wild type and genetically modified mouse tissue.

Ein Ex Vivo Choroid Sprouting Assay der ocular Microvascular Angiogenese

Pathological choroidal angiogenesis, a salient feature of age-related macular degeneration, leads to vision impairment and blindness. Endothelial cell ...

Biologie

Untersuchung der Angiogenese mit Hilfe von Scratch-Wund-Migration und Sphäroid-Skeim-Assays

Investigating Angiogenesis on a Functional and Molecular Level by Leveraging the Scratch Wound Migration Assay and the Spheroid Sprouting Assay

Angiogenesis plays a crucial role in both physiological and pathological processes within the body including tumor growth or neovascular eye disease. A detailed understanding of the underlying molecular mechanisms and reliable screening models are essential for targeting diseases effectively and developing new therapeutic options. Several in vitro assays have been developed to model angiogenesis, capitalizing on the opportunities a controlled environment provides to elucidate angiogenic drivers at a molecular level and screen for therapeutic targets.
This study presents workflows for investigating angiogenesis in vitro using human umbilical vein endothelial cells (HUVECs). We detail a scratch wound migration assay utilizing a live cell imaging system measuring endothelial cell migration in a 2D setting and the spheroid sprouting assay assessing endothelial cell sprouting in a 3D setting provided by a collagen matrix. Additionally, we outline strategies for sample preparation to enable further molecular analyses such as transcriptomics, particularly in the 3D setting, including RNA extraction as well as immunocytochemistry. Altogether, this framework offers scientists a reliable and versatile toolset to pursue their scientific inquiries in in vitro angiogenesis assays.

Autor im Rampenlicht: Untersuchung der Angiogenese durch Herausforderungen und Innovationen in der Assay-Entwicklung

This study presents the two-dimensional (2D) scratch wound migration assay and the three-dimensional (3D) spheroid sprouting assay, along with their respective downstream analysis methods, including RNA extraction and immunocytochemistry, as suitable assays to study angiogenesis in vitro.

Untersuchung der Angiogenese auf funktioneller und molekularer Ebene durch Nutzung des Scratch Wound Migration Assay und des Spheroid Sprouting Assay

Angiogenesis plays a crucial role in both physiological and pathological processes within the body including tumor growth or neovascular eye disease. A ...