Name: a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)
Uploaded: 2018-04-11T14:00:00.000+00:00
Duration: 7 min 58 s
Description: Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

Wir danken Alessandro Cellerino, Tyrone Genade, Anne Brunet, Sabrina Sharp, Mickie Powell, Simone Keil, Yumi Kim, Patrick Smith, Kai Mathar und allen Mitgliedern des Valenzano Labor am Max-Planck-Institut für Biologie des Alterns für Ihren Beitrag zu verschiedenen Aspekten des derzeitigen Killifische Tierhaltung Protokolls im Laufe der Jahre.

<ol>
	<li>Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-canonical+aging+model+systems+and+why+we+need+them.">Non-canonical aging model systems and why we need them.</a> EMBO J. 36 (8), 959-963 (2017).</li><li>Harel, I., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish:+A+Model+for+Exploring+Vertebrate+Aging+and+Diseases+in+the+Fast+Lane.">The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane.</a> Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).</li><li>Smith, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+life+span+by+the+gut+microbiota+in+the+short-lived+African+turquoise+killifish.">Regulation of life span by the gut microbiota in the short-lived African turquoise killifish.</a> Elife. 6, (2017).</li><li>Cellerino, A., Valenzano, D. R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+the+bush+to+the+bench:+the+annual+Nothobranchius+fishes+as+a+new+model+system+in+biology.">From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology.</a> Biol Rev Camb Philos Soc. 91 (2), 511-533 (2016).</li><li>Kim, Y., Nam, H. G., Valenzano, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+short-lived+African+turquoise+killifish:+an+emerging+experimental+model+for+ageing.">The short-lived African turquoise killifish: an emerging experimental model for ageing.</a> Dis Model Mech. 9 (2), 115-129 (2016).</li><li>Blazek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repeated+intraspecific+divergence+in+life+span+and+aging+of+African+annual+fishes+along+an+aridity+gradient.">Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient.</a> Evolution. 71 (2), 386-402 (2017).</li><li>Terzibasi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large+differences+in+aging+phenotype+between+strains+of+the+short-lived+annual+fish+Nothobranchius+furzeri.">Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri.</a> PLoS One. 3 (12), e3866 (2008).</li><li>Kirschner, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+quantitative+trait+loci+controlling+lifespan+in+the+short-lived+fish+Nothobranchius+furzeri--a+new+vertebrate+model+for+age+research.">Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research.</a> Aging Cell. 11 (2), 252-261 (2012).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+loci+associated+with+tail+color+and+sex+determination+in+the+short-lived+fish+Nothobranchius+furzeri.">Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri.</a> Genetics. 183 (4), 1385-1395 (2009).</li><li>Reichwald, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+Sex+Chromosome+Evolution+and+Aging+from+the+Genome+of+a+Short-Lived+Fish.">Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish.</a> Cell. 163 (6), 1527-1538 (2015).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish+Genome+Provides+Insights+into+Evolution+and+Genetic+Architecture+of+Lifespan.">The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan.</a> Cell. 163 (6), 1539-1554 (2015).</li><li>Harel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+platform+for+rapid+exploration+of+aging+and+diseases+in+a+naturally+short-lived+vertebrate.">A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate.</a> Cell. 160 (5), 1013-1026 (2015).</li><li>Valenzano, D. R., Sharp, S., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon-Mediated+Transgenesis+in+the+Short-Lived+African+Killifish+Nothobranchius+furzeri,+a+Vertebrate+Model+for+Aging.">Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging.</a> G3. 1 (7), 531-538 (2011).</li><li>Harel, I., Valenzano, D. R., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genome+engineering+approaches+for+the+short-lived+African+turquoise+killifish.">Efficient genome engineering approaches for the short-lived African turquoise killifish.</a> Nat Protoc. 11 (10), 2010-2028 (2016).</li><li>Polacik, M., Blazek, R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laboratory+breeding+of+the+short-lived+annual+killifish+Nothobranchius+furzeri.">Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri.</a> Nat Protoc. 11 (8), 1396-1413 (2016).</li><li>Avdesh, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regular+care+and+maintenance+of+a+zebrafish+(Danio+rerio)+laboratory:+an+introduction.">Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction.</a> J Vis Exp. (69), e4196 (2012).</li></ol>

Die Autoren erklären keine finanzielle und nicht finanzielle Interessenkonflikte.

Wir beschreiben ein Protokoll für das Labor züchten von Türkis Killifische, einschließlich Embryo Sammlung sowie Inkubation und ausgewachsenen Fischen Gehäuse, Zucht und Fütterung. Unser Protokoll richtet sich speziell an Labore, die forschen konzentrierten sich auf Erwachsene Fische, insbesondere für experimentelle Studien über das Altern und Lebensdauer. Türkis Killifische kann auf standard Zebrafisch-Anlage angehoben werden; wichtige Aspekte der Tierhaltung Killifische unterscheiden sich jedoch von standard Zebrafisch Pflege16. Diese Anpassungen umfassen frühen Übergang von Artemia nur Diät zu einer Ernährung mit Protein-reiche Blut Wurm als auch spezifische Schritte im Embryo Inkubation, bestehend aus einer flüssigen und trockenen Inkubation Bühne ergänzt.
Wichtige Schritte im Rahmen des Protokolls beinhalten Versand Embryonen im 8-30 ° C Temperaturbereich. Fruchtbarkeit hängt bei Zucht, Fütterung, Frequenz und Qualität des Essens; Wir empfehlen daher, mindestens zwei Fütterungen pro Tag pro Zucht Tank um Embryonen Ertrag (siehe Abschnitt 5.6) zu erhöhen. Während der Embryo zu bleichen, verlängern Sie Embryo Inkubation im Bleichbad nicht. Dies kann Schäden am Ei Chorion und erhöhte Embryo Sterblichkeit führen. Wenn Embryonen mit Methylenblau Inkubation, nicht verlängern Sie, Inkubation von bereit-zu-Luke Embryonen länger als 2 Wochen, da ihre Überlebensfähigkeit drastisch verringert wird. Für Schraffur Türkis Killifische, niedriger Temperatur von Huminsäure saure Lösung verbessert die Schraffur und vollständiges Eintauchen des Embryos in der Lösung ermöglicht synchronisierten Schlupf. Nicht ausreichende Belüftung während der Inkubation resultiert hohe Raten von Fry nicht in der Lage, die Gas-Blase zu füllen ("Bauch-Schieber" Phänotyp, siehe Hinweise in Abschnitt 5.1).
Einschränkung des Protokolls für die Zucht umfasst den Einsatz von Sand Substrat welche Herausforderungen auf zentrale Filteranlagen und sollte in Zukunft durch alternative Methoden ersetzt werden. Mögliche Alternativen könnte die Verwendung von Zebrafisch Zucht Panzer. Embryo bleichen könnte wichtige physikalisch-chemische Veränderungen in der Ei-Chorion, die veränderten Chorion Physiologie und Schraffur Erfolg führen könnte. Ständiger Exposition von Embryonen zu Methylenblau kann langfristige Veränderungen der Erwachsenen Fische Physiologie induzieren. Erhöhung der Erwachsenen Fische in einzelnen Tanks für Überleben Kohortenstudien könnten Fisch Verhalten und Gesundheit beeinträchtigen. Gruppenhaltung für Überleben Kohortenstudien fügt jedoch erhebliche Störfaktoren durch die Etablierung der sozialen Dominanz und männlicher Gebiete führt zu strengen sozialen Hierarchien. Daher beurteilen wir, dass Isolation von männlichen Fischen für Überleben Studien ein vernünftiger Kompromiss ist. Fütterung Labor Killifische Kolonien mit Lebendfutter aus UN-kontrollierten Quellen fügen Sie ein Risiko für externe Verunreinigungen von Parasiten und potenziell pathogenen mikrobieller Gemeinschaften. In Zukunft sollte eine ad-hoc-sterile Fischfutter entwickelt werden.
Zukünftige Verbesserungen dieses Protokolls konzentriert sich auf eine kontrollierte, nicht-live Diät führt nach wie vor Abschluss der Geschlechtsreife innerhalb von 3-4 Wochen. Zusammenfassend bietet unser Protokoll Zugänglichkeit zum türkisblauen Killifische Labor Kultivierung einer breiten Fachöffentlichkeit.

Aufgrund ihrer kurzen Lebensdauer und schnelle Lebenszyklus, sind türkis Killifische als vielversprechende neue Modellorganismus in der Biologie1,2,3rasant. Diese Art zeichnet sich durch einen einzigartigen Lebenszyklus für eine teleost, bestehend aus embryonalen Diapause, schnelle sexuelle Reifung und eine verlängerte post-reproductive Lebensdauer Stufe4,5. Den letzten Arbeit hat dazu beigetragen, Aufklärung die Biologie dieser Arten in Gefangenschaft und im wilden6,7. Türkis Killifische Leben in saisonalen frischen Gewässer dieser Form während der Regenzeit in der afrikanischen Savanne in Simbabwe und Mosambik. Während der Trockenzeit überleben Embryonen im trockenen Schlamm in Abwesenheit von Wasser durch eine Stress-resistente Lebensstadium Diapause genannt.
Genetische Karten für diese Spezies wurden generierten8,9, und vor kurzem wurde ihr Genom sequenziert und montierten10,11. Mehreren Inzucht laborbelastungen Fisch entwickelt worden und Transgenese und Genom Bearbeitung via CRISPR/Cas9 sind verfügbar in dieser Spezies, de-facto- Förderung Türkis Killifische als wettbewerbsfähige Labor vertebrate Modellorganismus geworden 12,13,14.
Obwohl ein Laborprotokoll für diese Arten15bereits veröffentlicht worden, in diesem Protokoll entwickeln wir eine umfassende Liste von experimentellen Labor-Richtlinien, die speziell auf Studien, die untersuchen, Alterung und überleben. Dieses Protokoll ermöglicht Forschern bereits vertraut mit Zebrafisch und Medaka Tierhaltung in Türkis Killifische Zucht bewandert werden durch die Annahme einer Mindestanzahl von wesentliche Anpassungen. Zur gleichen Zeit bietet dieses Protokoll Forschern ohne Vorkenntnisse in Fisch Zucht mit wichtigen Tools um eine blühende Kolonie Türkis Killifische zu erhöhen.

<table><tbody><tr><td>Probe calibration buffer solution pH=7.0</td><td>Roth</td><td>A518.1</td><td>1L buffer solution pH=7.0 to calibrate water system pH-electrode</td></tr><tr><td>Probe calibration buffer solution pH=4.0</td><td>Roth</td><td>P712.1</td><td>1L buffer solution pH=4.0 to calibrate water system pH-electrode</td></tr><tr><td>Conductivity standard</td><td>VWR</td><td>83607.260</td><td>500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode</td></tr><tr><td>Easy Strips Test 6in1</td><td>JBL</td><td>2533900</td><td>Test strips for determination chlorine values of system water</td></tr><tr><td>Ammonia Test</td><td>JBL</td><td>2536500</td><td>Test to determine ammonia content of system water</td></tr><tr><td>Red Sea Salt</td><td>Red Sea</td><td></td><td>22 kg bucket</td></tr><tr><td>Sodium hydrogen carbonate</td><td>VWR</td><td>27780.360</td><td></td></tr><tr><td>Humic acid</td><td>Sigma- Aldrich</td><td>53680-50G</td><td></td></tr><tr><td>New HUFA Artemia enrichment</td><td>ZM Systems UK</td><td></td><td>75g bottle</td></tr><tr><td>Methylene blue</td><td>Roth</td><td>AE64.1</td><td></td></tr><tr><td>Hydrogen peroxide solution</td><td>Sigma- Aldrich</td><td>31642-1L</td><td>30% (w/w)</td></tr><tr><td>Coconut fiber</td><td>Dragon</td><td>ZCS010</td><td></td></tr><tr><td>Whatman paper</td><td>GE healthcare</td><td>3030-690</td><td></td></tr><tr><td>Ethanol pure</td><td>VWR</td><td>20821.467</td><td>100%</td></tr><tr><td>Silica sand</td><td>local pet shop</td><td></td><td></td></tr><tr><td>Artemia Eggs Premium Grade</td><td>Sanders</td><td></td><td></td></tr><tr><td>Bloodworm</td><td>local distributor</td><td></td><td>Poseidon Aquakultur Germany</td></tr><tr><td>dNTPs solution mix</td><td>Biolabs</td><td>N04472</td><td>10mM</td></tr><tr><td>Taq DNA polymerase</td><td>Invitrogen</td><td>18038-042</td><td>5U/uL</td></tr><tr><td>PCR 10x Buffer</td><td>Invitrogen</td><td>18038-042</td><td></td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Invitrogen</td><td>18038-042</td><td>50mM</td></tr><tr><td>NaOH</td><td>Sigma- Aldrich</td><td>S8045-500g</td><td>50mM</td></tr><tr><td>Tris-HCl, pH=8.0 solution</td><td>Sigma- Aldrich</td><td>T2694-1L</td><td>1M</td></tr><tr><td>HCl 37%</td><td>Sigma- Aldrich</td><td>H1758-500mL</td><td></td></tr><tr><td>Fish tanks</td><td>Aquaneering</td><td></td><td>volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids</td></tr><tr><td>Orbital shaker</td><td>VWR</td><td>89032-100</td><td>model 5000</td></tr><tr><td>Microbiological incubator</td><td>Thermo Scientific, Heratherm</td><td>50125882</td><td>model IMC18; for storage embryos in the liquid phase, set to t=27-28&amp;deg;C</td></tr><tr><td>Cooling Incubator</td><td>Binder</td><td>9020-0209</td><td>model KT115; for storage embryos in the solid phase, set to t=27-28&amp;deg;C</td></tr><tr><td>Hatching incubator</td><td>Thermo Scientific, Heratherm</td><td>51028114</td><td>model OGS180; for embryos hatching, set to t=27-28&amp;deg;C</td></tr><tr><td>Stereomicroscope</td><td>Leica</td><td></td><td>model M80</td></tr><tr><td>Breeding sand/hatching boxes</td><td>Roth</td><td>1598.1</td><td>1000mL</td></tr><tr><td>Petri dish</td><td>Sarstedt</td><td>82.1473</td><td>92x16mm</td></tr><tr><td>50 mL Conical tube</td><td>Sarstedt</td><td>62.547.254</td><td></td></tr><tr><td>15 mL Conical tube</td><td>Sarstedt</td><td>62.554.002</td><td></td></tr><tr><td>Disposable Plastic Pasteur pipette</td><td>Roth</td><td>EA71.1</td><td>2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter</td></tr><tr><td>Serological pipette</td><td>Sarstedt</td><td>86.1689.001</td><td>50mL</td></tr><tr><td>Syringe</td><td>Henke Sass Wolf</td><td>4100-000V0</td><td>10mL</td></tr><tr><td>Metal strainer</td><td></td><td></td><td>fineness &amp;lt;1mm; for embryos collection</td></tr><tr><td>Tweezers</td><td>Dumont</td><td>0508-5/45-PO</td><td>type5/45; for embryos transfer</td></tr><tr><td>25 L Brine shrimp hatcher</td><td>Aquaneering</td><td>ZHBS25</td><td>main hatcher</td></tr><tr><td>500 mL Brine shrimp hatcher</td><td>JBL</td><td>6106100</td><td>model Artemio 1; backup hatcher</td></tr><tr><td>Narrow-mesh fish nets</td><td>JBL</td><td></td><td></td></tr><tr><td>Sand beaker</td><td>VWR</td><td>BURK7102-5000</td><td>5000mL</td></tr><tr><td>Brine shrimp separation beaker</td><td>VWR</td><td>BURK7102-2000</td><td>2000mL</td></tr><tr><td>Plastic zipper bag</td><td>Roth</td><td>P279.2</td><td>for dead fish storage</td></tr><tr><td>Pipetboy</td><td>Integra</td><td>155000</td><td>model Pipetboy acu2</td></tr><tr><td>Parafilm</td><td>P-Lab</td><td>P701605</td><td></td></tr><tr><td>Air tubing</td><td>www.zajac.de</td><td>AQ380</td><td>4-6 mm diameter</td></tr><tr><td>1 L Glass bottle</td><td>VWR</td><td>215-1595</td><td></td></tr><tr><td>2 L Glass bottle</td><td>VWR</td><td>215-1596</td><td></td></tr><tr><td>500 mL Squeeze bottle</td><td>Roth</td><td>K665.1</td><td>for fish feeding with brine shrimp</td></tr><tr><td>120-&amp;#956;m brine shrimp strainer</td><td>Florida Aqua Farms</td><td>BB-PC2</td><td>for brine shrimp/bloodworm collection</td></tr><tr><td>Finish filter socks</td><td>Aquaneering</td><td>MFVB025C</td><td>25-&amp;#956;m</td></tr><tr><td>Central filtration fish housing system</td><td></td><td></td><td>Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz</td></tr></tbody></table>

a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)

Die Entwicklung von Tierhaltungspraktiken in Labor-Modell Fisch für experimentelle Zwecke hat profitiert von der Gründung des Referenz-Fisch Modellsysteme wie Zebrafisch und Medaka. In den letzten Jahren hat eine wachsende Zahl von Forschungsgruppen in den Bereichen der Biologie des Alterns und Ökologie einer aufstrebenden Fisch – die türkisfarbenen Killifische (Nothobranchius Furzeri) – angenommen. Mit einer Gefangenschaft Lebensdauer von 4 bis 8 Monate diese Art ist die kurzlebigsten Wirbeltier in Gefangenschaft angehoben und ermöglicht die wissenschaftliche Gemeinschaft Test – in kurzer Zeit – experimentelle Interventionen, die zu Veränderungen des Alterns Rate und Lebenserwartung führen können. Angesichts die einzigartigen Biologie dieser Art, gekennzeichnet durch embryonale Diapause markiert explosive sexuelle Reifung, morphologische und Verhaltensstörungen Geschlechtsdimorphismus- und ihrer relativ kurzen Erwachsenen Lebensdauer - ad-hoc- Tierhaltung sind Praktiken in dringenden Nachfrage. Dieses Protokoll berichtet eine Reihe von wichtigen Tierhaltung Maßnahmen, mit denen optimale Türkis Killifische Labor Pflege, Aktivierung der wissenschaftlichen Gemeinschaft, diese Spezies als ein leistungsfähiges Labor Tiermodell anzunehmen.

Türkis Killifische richtige Haltung führt mediane Überlebenszeit zwischen 12-18 Wochen in der GRZ Belastung (z. B. Abbildung 4A). Variationen der mediane Überlebenszeit abhängig von Ernährung, Fütterung Frequenz und Temperatur Wohnbedingungen. Schlechte Haltung führt zu überleben Kurven präsentiert erhöht frühe Sterblichkeit und repetitive, plötzlichen Tropfen des Überlebens im Laufe der Zeit zeichnet sich durch mehrere Wendepunkte (Abbildung 4 b).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57073/57073fig1.jpg"> Abbildung 1: Repräsentative embryonalen Entwicklungsstufen mit entsprechenden Inkubation Substrat. (A) frisch gesammelten Embryonen, inkubiert in Methylenblau-Lösung im Inkubator bei 28 ° C. (B) Embryonen bereit, auf festem Medium übertragen werden entweder Papier oder Kokos Faser filtern. (C) Embryonen bereit, die schraffiert werden, typische golden IRIS anzeigen. Der Maßstab ist gleich bis 1 mm. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig1large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57073/57073fig2.jpg"> Abbildung 2: Phasen des türkisfarbenen Killifische nach dem Schlüpfen Entwicklung. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig2large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57073/57073fig3.jpg"> Abbildung 3: Repräsentative Fisch ID-Tag für Fische aus Stufe 3 ab. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig3large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57073/57073fig4.jpg"> Abbildung 4: Repräsentative überleben Kurve für 70 männlichen Türkis Killifische. (A) typische überleben Kurve für Labor-raiste Türkis Killifische. (B) Vergleich der überleben Kurven gewonnenen Fische unter optimalen Haltungsbedingungen (schwarz) angehoben und schlechte Tierhaltung (rot und blau). Die gestrichelte rote horizontale Linie gibt 50 % überleben, sich überschneidenden überleben Kurve an mittlere Lebensdauer (auf der x-Achse angegeben). <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig4large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>ID</td>
			<td colspan="2">Forward primer</td>
			<td colspan="2">Rückwärts-primer</td>
			<td>Größenbereich (bp)</td>
		</tr>
<tr>
<td>* NfuSU0007</td>
			<td colspan="2">GGCTAAGCCTTGCTGACAGA</td>
			<td colspan="2">CAGGGAGCTGAAAACCTCAG</td>
			<td>166 - 214</td>
		</tr>
<tr>
<td>* NfuSU0010</td>
			<td colspan="2">CGCAGTCTGATCAAATCGTGT</td>
			<td colspan="2">TGTTTGAAGGTTCACATTCATTATC</td>
			<td>220 - 272</td>
		</tr>
<tr>
<td>NfuSU0016</td>
			<td colspan="2">CATGGCTAAACCGTGATGAA</td>
			<td colspan="2">GAAGGACGCCAGCTATGAAG</td>
			<td>209 - 240</td>
		</tr>
<tr>
<td>NfuSU0022</td>
			<td colspan="2">AACACAGCTCTCGTAAGGAGGTA</td>
			<td colspan="2">TTCAGACTTGTCTTACTACCATGTTT</td>
			<td>198 - 238</td>
		</tr>
<tr>
<td>NfuSU0027</td>
			<td colspan="2">TCCAGCTGAATCGGTAATGA</td>
			<td colspan="2">AAACTCGAGGGTGCAATCTG</td>
			<td>164 - 226</td>
		</tr>
<tr>
<td>NfuSU0049</td>
			<td colspan="2">CTGGACAAAGTGCCAATCAC</td>
			<td colspan="2">CTCCCACAGTCCCAAAACAT</td>
			<td>196 - 197</td>
		</tr>
<tr>
<td>NfuSU0050</td>
			<td colspan="2">CCAGAATGAACAATACTCAGATCAA</td>
			<td colspan="2">GCAGCTTAGTTTAATGATATCACAATG</td>
			<td>252 - 295</td>
		</tr>
<tr>
<td>NfuSU0060</td>
			<td colspan="2">CTAGCCACTCCCCTGGTTTA</td>
			<td colspan="2">CCGTCACGATGTGCTGATAC</td>
			<td>216 - 248</td>
		</tr>
<tr>
<td>NfuFLI0030</td>
			<td colspan="2">CAGAAGCTAAAGGCCAGACG</td>
			<td colspan="2">GGGAAACAATAGGGAACCAC</td>
			<td>174 - 205</td>
		</tr>
<tr>
<td>* NfuFLI0091</td>
			<td colspan="2">ACGCTGACTCTACCCAGTC</td>
			<td colspan="2">CTGCCTGCTACTGACAATG</td>
			<td>355 - 373</td>
		</tr>
<tr>
<td colspan="6">* - sex Bestimmung Marker</td>
		</tr>
</tbody></table>Tabelle 1: Genotypisierung Zündkapseln für Stamm-Identifikation.

Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

Labor-Gehäuse von Türkis, die Killifische unterzubringen und effizient erhöhen Tausende von einzelnen Fische in eine zentralisierte Wasserfilter-System, mit der gleichen Infrastruktur für standard Zebrafisch genutzt skaliert werden kann. Hier zeigen wir eine Liste von standardisierten Verfahren, die effiziente Killifische Wartung ermöglichen.

Ein Protokoll für Labor Housing von Türkis Killifische (Nothobranchius Furzeri)

The development of husbandry practices in non-model laboratory fish used for experimental purposes has greatly benefited from the establishment of ...

a-protocol-for-laboratory-housing-turquoise-killifish-nothobranchius

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri)

16.8K Aufrufe.  Max Planck Institute for the Biology of Ageing. Labor-Gehäuse von Türkis, die Killifische unterzubringen und effizient erhöhen Tausende von einzelnen Fische in eine zentralisierte Wasserfilter-System, mit der gleichen Infrastruktur für standard Zebrafisch genutzt skaliert werden kann. Hier zeigen wir eine Liste von standardisierten Verfahren, die effiziente Killifische Wartung ermöglichen.

Serie: A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

A Flow-through Exposure System for Evaluating Suspended Sediments Effects on Aquatic Life

This paper describes the Fish Larvae and Egg Exposure System (FLEES). The flow-through exposure system is used to investigate the effects of suspended sediment on various aquatic species and life stages in the laboratory by using pumps and automating delivery of sediment and water to simulate suspension of sediment. FLEES data are used to develop exposure-response curves between the effects on aquatic organisms and suspended sediment concentrations at the desired exposure duration. The effects data are used to evaluate management practices used to reduce the interactions between aquatic organisms and anthropogenic causes of suspended sediments. The FLEES is capable of generating total suspended solids (TSS) concentrations as low as 30 to as high as 800 mg/L, making this system an ideal choice for evaluating the effects of TSS resulting from many activities including simulating low ambient levels of TSS to evaluating sources of suspended sediments from dredging operations, vessel traffic, freshets, and storms.

A robust and flexible flow-through exposure system designed to maintain sediment in suspension is presented. The system is used to investigate the effects of suspended sediment on various aquatic species and life stages in the laboratory.

Ein Durchflussbelichtungssystem für die Bewertung Schwebstoffe Auswirkungen auf Leben im Wasser

This paper describes the Fish Larvae and Egg Exposure System (FLEES). The flow-through exposure system is used to investigate the effects of suspended ...

Forschung

Umwelt

Protocol for Acute and Chronic Ecotoxicity Testing of the Turquoise Killifish Nothobranchius furzeri

The killifish Nothobranchius furzeri is an emerging model organism in the field of ecotoxicology and its applicability in acute and chronic ecotoxicity testing has been demonstrated. Overall, the sensitivity of the species to toxic compounds is in the range with, or higher than, that of other model species.
This work describes protocols for acute, chronic, and multigenerational bioassays of single and combined stressor effects on N. furzeri. Due to its short maturation time and life-cycle, this vertebrate model allows the study of endpoints such as maturation time and fecundity within four months. Transgenerational full life-cycle exposure trials can be performed in as little as 8 months. Since this species produces eggs that are drought-resistant and remain viable for years, the on-site culture of the species is not needed but individuals can be recruited when required. The protocols are designed to measure life-history traits (mortality, growth, fecundity, weight) and critical thermal maximum.

Protocol for Acute and Chronic Ecotoxicity Testing of the Turquoise Killifish Nothobranchius furzeri

In this work, we describe an acute, chronic and multigenerational bioassay to study the effects of single and combined stressors on the Turquoise killifish Nothobranchius furzeri. This protocol is designed to study life-history traits (mortality, growth, fecundity, weight) and critical thermal maximum.

Protokoll für akute und chronische Ökotoxizität Prüfung von Türkis Killifische Nothobranchius furzeri

The killifish Nothobranchius furzeri is an emerging model organism in the field of ecotoxicology and its applicability in acute and chronic ecotoxicity ...

Raising the Mexican Tetra Astyanax mexicanus for Analysis of Post-larval Phenotypes and Whole-mount Immunohistochemistry

River and cave-adapted populations of Astyanax mexicanus show differences in morphology, physiology, and behavior. Research focused on comparing adult forms has revealed the genetic basis of some of these differences. Less is known about how the populations differ at post-larval stages (at the onset of feeding). Such studies may provide insight into how cavefish survive through adulthood in their natural environment. Methods for comparing post-larval development in the laboratory require standardized aquaculture and feeding regimes. Here we describe how to raise fish on a diet of nutrient-rich rotifers in non-recirculating water for up to two-weeks post fertilization. We demonstrate how to collect post-larval fish from this nursery system and perform whole-mount immunostaining. Immunostaining is an attractive alternative to transgene expression analysis for investigating development and gene function in A. mexicanus. The nursery method can also be used as a standard protocol for establishing density-matched populations for growth into adults.

Raising the Mexican Tetra Astyanax mexicanus for Analysis of Post-larval Phenotypes and Whole-mount Immunohistochemistry

In this protocol, we demonstrate how to breed Astyanax mexicanus adults, raise the larvae, and perform whole-mount immunohistochemistry on post-larval fish to compare the phenotypes of surface and cave morphotypes.

Anhebung der mexikanischen Tetra Astyanax Mexicanus für Analyse der Post-larval Phänotypen und vollständig-hängen Immunohistochemistry

River and cave-adapted populations of Astyanax mexicanus show differences in morphology, physiology, and behavior. Research focused on comparing adult ...

Genetik

A Standardized Protocol for Preference Testing to Assess Fish Welfare

Animal welfare assessment techniques try to take into consideration the specific needs and wants of the animal in question. Providing enrichment (the addition of physical objects or conspecifics in the housing environment) is often a way to give captive animals the opportunity to choose who or what they interact with and how they spend their time. A fundamental component of the aquatic environment that is often overlooked in captivity, however, is the ability for the animal to choose to engage in physical exercise. For many animals, including fish, exercise is an important aspect of their life history, and is known to have many health benefits, including positive changes in the brain and behavior. Here we present a method for assessing habitat preferences in captive animals. The protocol could easily be adapted to look at a variety of environmental factors (e.g., gravel versus sand as a substrate, plastic plants versus live plants, low flow versus high flow of water) in different aquatic species, or for use with terrestrial species. Statistical assessment of preference is carried out using Jacob&#39;s preference index, which ranks the habitats from -1 (avoidance) to +1 (most preferred). With this information, it can be determined what the animal wants from a welfare perspective, including their preferred location.

A fundamental aspect of assessing the welfare of animals in captivity is to ask whether the animals have what they want. Here, we present a protocol to determine housing preference in the zebrafish (Danio rerio) with respect to the presence/absence of environmental enrichment and access to flowing of water.

Ein standardisiertes Protokoll für Präferenztests zur Bewertung des Wohlbefindens von Fischen

Animal welfare assessment techniques try to take into consideration the specific needs and wants of the animal in question. Providing enrichment (the ...

Verhalten

Examination of Host Phenotypes in Gambusia affinis Following Antibiotic Treatment

The commonality of antibiotic usage in medicine means that understanding the resulting consequences to the host is vital. Antibiotics often decrease host microbiome community diversity and alter the microbial community composition. Many diseases such as antibiotic-associated enterocolitis, inflammatory bowel disease, and metabolic disorders have been linked to a disrupted microbiota. The complex interplay between host, microbiome, and antibiotics needs a tractable model for studying host-microbiome interactions. Our freshwater vertebrate fish serves as a useful model for investigating the universal aspects of mucosal microbiome structure and function as well as analyzing consequential host effects from altering the microbial community. Methods include host challenges such as infection by a known fish pathogen, exposure to fecal or soil microbes, osmotic stress, nitrate toxicity, growth analysis, and measurement of gut motility. These techniques demonstrate a flexible and useful model system for rapid determination of host phenotypes.

Examination of Host Phenotypes in Gambusia affinis Following Antibiotic Treatment

This study involves methods to reveal effects on a model fish host following alteration of the skin and gut microbiome communities&#160;composition by an antibiotic.

Die Prüfung der Host-Phänotypen in<em&gt; Gambusia affinis</em&gt; Nach der Behandlung mit Antibiotika

The commonality of antibiotic usage in medicine means that understanding the resulting consequences to the host is vital. Antibiotics often decrease host ...

Immunologie und Infektion

Optimierung von GF Zebrafischmodellen: Erzeugung, Pflege und mikrobielle Studien

Generation, Maintenance, and Identification of Germ-Free Zebrafish Models from Larvae to Juvenile Stages

Zebrafish serve as valuable models for research on growth, immunity, and gut microbiota due to their genomic similarities with mammals, transparent embryos developed in a relatively clean chorion environment, and extremely rapid development of larvae compared to rodent models. Germ-free (GF) zebrafish (Danio rerio) are crucial for evaluating pollutant toxicity and establishing human-like disease models related to microbial functions. In comparison to conventionally raised (CR) models (fish in common husbandry), GF zebrafish allow for more accurate manipulation of the host microbiota, aiding in determining the causal relationship between microorganisms and hosts. Consequently, they play a critical role in advancing our understanding of these relationships. However, GF zebrafish models are typically generated and researched during the early life stages (from embryos to larvae) due to limitations in immune function and nutrient absorption. This study optimizes the generation, maintenance, and identification of early GF zebrafish models without feeding and with long-term feeding using GF food (such as Artemia sp., brine shrimp). Throughout the process, daily sampling and culture were performed and identified through multiple detections, including plates and 16S rRNA sequencing. The aseptic rate, survival, and developmental indexes of GF zebrafish were recorded to ensure the quality and quantity of the generated models. Importantly, this study provides details on bacterial isolation and infection techniques for GF fish, enabling the efficient creation of GF fish models from larvae to juvenile stages with GF food support. By applying these procedures in biomedical research, scientists can better understand the relationships between intestinal bacterial functions and host health.

Autor im Rampenlicht: Etablierung keimfreier Zebrafische für Mikrobiota-Wirt-Beziehungsstudien

This protocol outlines the primary steps for obtaining germ-free (GF) fish embryos and maintaining them from larvae until the juvenile stage, including sampling and detecting their sterile status. The use of GF models with infection is important for understanding the role of microbes in host health.

Generierung, Pflege und Identifizierung von keimfreien Zebrafischmodellen von der Larve bis zum Jungstadium

Zebrafish serve as valuable models for research on growth, immunity, and gut microbiota due to their genomic similarities with mammals, transparent ...

Entwicklungsbiologie

Construction of an Affordable and Easy-to-Build Zebrafish Facility

In vivo biomedical research is pivotal to translate in vitro findings into clinical advances. Small academic institutions with limited resources find it virtually impossible to build and maintain typical rodent facilities for research. Zebrafish research has been demonstrated to be a valuable alternative for in vivo research in pharmacology, physiology, development and genetic studies. This article demonstrates that a functional zebrafish facility can be built in an easy and affordable manner. We demonstrate that such a facility could be built in about one working day with minimal tools and expertise. The cost of the 27 1.8 L fish tank zebrafish facility constructed in this study was approximately $1,500. We estimate that the maintenance of an initial working 150 fish colony for 3 months is $1,000. This project involved students, who were introduced to aquaculturing of zebrafish for research proposes.

A Zebrafish facility suitable for breeding and in vivo research is built in an easy and affordable manner. Maintenance is minimal. This facility is ideal for student involvement and independent research.

Bau eines erschwinglichen und einfach zu bauen Zebrafisch Einrichtung

In vivo biomedical research is pivotal to translate in vitro findings into clinical advances. Small academic institutions with limited resources find it ...

Biologie

Gentle Isolation of Nuclei from the Brain Tissue of Adult African Turquoise Killifish, a Naturally Short-Lived Model for Aging Research

Studying brain aging at single-cell resolution in vertebrate systems remains challenging due to cost, time, and technical constraints. Here, we demonstrate a protocol to generate single-nucleus RNA sequencing (snRNA-seq) libraries from the brains of the naturally short-lived vertebrate African turquoise killifish Nothobranchius furzeri. The African turquoise killifish has a lifespan of 4-6 months and can be housed in a cost-effective manner, thus reducing cost and time barriers to study vertebrate brain aging. However, tailored protocols are needed to isolate nuclei of sufficient quality for downstream single-cell experiments from the brain of young and aged fish. Here, we demonstrate an empirically optimized protocol for the isolation of high-quality nuclei from the brain of adult African turquoise killifish, a critical step in the generation of high-quality single nuclei omic libraries. Furthermore, we show that the steps to reduce contaminating background RNA are important to clearly distinguish cell types. In summary, this protocol demonstrates the feasibility of studying brain aging in non-traditional vertebrate model organisms.

Here we present a protocol to isolate nuclei from the brains of the short-lived vertebrate model Nothobranchius furzeri for downstream applications such as single-nucleus RNA sequencing or single-nucleus assay for transposase-accessible chromatin with sequencing (ATAC-seq).

Schonende Isolierung von Kernen aus dem Hirngewebe erwachsener afrikanischer türkisfarbener Killifische, ein natürlich kurzlebiges Modell für die Alternsforschung

Ein Protokoll für Labor Housing von Türkis Killifische (Nothobranchius Furzeri)

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Ein Durchflussbelichtungssystem für die Bewertung Schwebstoffe Auswirkungen auf Leben im Wasser

Protokoll für akute und chronische Ökotoxizität Prüfung von Türkis Killifische Nothobranchius furzeri

Anhebung der mexikanischen Tetra Astyanax Mexicanus für Analyse der Post-larval Phänotypen und vollständig-hängen Immunohistochemistry

Ein standardisiertes Protokoll für Präferenztests zur Bewertung des Wohlbefindens von Fischen

Die Prüfung der Host-Phänotypen in

Generierung, Pflege und Identifizierung von keimfreien Zebrafischmodellen von der Larve bis zum Jungstadium

Generierung, Pflege und Identifizierung von keimfreien Zebrafischmodellen von der Larve bis zum Jungstadium

Generierung, Pflege und Identifizierung von keimfreien Zebrafischmodellen von der Larve bis zum Jungstadium

Bau eines erschwinglichen und einfach zu bauen Zebrafisch Einrichtung

Schonende Isolierung von Kernen aus dem Hirngewebe erwachsener afrikanischer türkisfarbener Killifische, ein natürlich kurzlebiges Modell für die Alternsforschung