Die Autoren danken Kristen Bullard-Feibelman, Milena Veselinovic und Claudia Rückert für ihre Unterstützung bei der Charakterisierung des vom Klon abgeleiteten Virus. Diese Arbeit wurde teilweise durch Zuschüsse des Nationalen Instituts für Allergie und Infektionskrankheiten, NIH unter den Stipendien AI114675 (BJG) und AI067380 (GDE) unterstützt.

1. Transformation und Wiederherstellung von infektiösen Klonplasmiden <ol><li> Transformieren Sie beide Plasmide (getrennt) unter Verwendung eines kommerziellen Transformationsprotokolls ( z. B. NEB 5 Minute Transformation Protocol) mit einigen Modifikationen. Beide Plasmide enthalten ein für die Ampicillinresistenz kodierendes Gen, daher verwenden sie Ampicillin oder Carbenicillin zur Selektion. Carbenicillin wird bevorzugt, da es stabiler ist. <ol><li> Entfernen Sie die Zellen (siehe Materialtabelle) von -80 ° C Gefrierschrank und tauen Sie auf Eis für 5-10 min. Prewarm Lysogeny Brühe (LB) (mit 10 g / l NaCl und 25 μg / ml Carbenicillin, genannt LB-Carb) Platten und die Brühe mit Catabolit Repression (SOC (ohne Antibiotika) - kommen mit den Zellen) bei 37 ° C. </li><li> Füge zwischen 100 pg-10 ng in 1 μl Plasmid-DNA zu einem Röhrchen hinzu, das 50 μl kompetente Zellen enthält; Mischen Sie vorsichtig, indem Sie die Tube schlagen. </li><li> Röhrchen auf Eis für 5 min inkubieren. </li><li> Hitzeschockrohre bei 42 ° C für 30 sIn einem wasserbad Rückkehr zum Eis für 2 min unmittelbar nach Hitzeschock. </li><li> 950 μl Raumtemperatur SOC in jedes Röhrchen pipettieren und durch Pipettieren mischen. 100 μl des Bakteriengemisches auf eine LB-Carb-Platte auftragen und über Nacht bei 37 ° C inkubieren (ca. 12-14 h). </li></ol></li><li> Entfernen von Platten aus 37 ° C Inkubator nach 12-14 h Inkubation. Legen Sie die Platten in eine dunkle Schublade bei Raumtemperatur, damit Kolonien weiter wachsen (ca. 8-9 h). </li><li> Unter Verwendung von 5 ml Terrific Brühe (TB, enthaltend 25 &amp; mgr; g / ml Carbenicillin, genannt TB-Carb), wachsen 5-10 kleine Kolonien für jedes Plasmid über Nacht bei 30 ° C in einem Bakterienschüttler (etwa 14-16 h). HINWEIS: Kleine Kolonien sind ein Indikator dafür, dass das Plasmid intakt ist; Kolonien mit Plasmiden, die Deletionen, Umlagerungen oder Mutationen enthalten (hierin Instabilitätsereignisse genannt), werden schneller wachsen und sind daher größer. Deshalb sollte man versuchen, die kleinsten Kolonien auf dem Teller zu holen, namentlichT Auswahl der größten Kolonien vorhanden. Einige mittelgroße Kolonien können auch für Vollständigkeit ausgewählt werden. Die niedrigere Temperatur reduziert die Wahrscheinlichkeit, dass die Zellen überwachsen (OD 600 von größer als 0,6-0,8). Da die meisten Forscher über Nacht Wachstum durchführen, ermöglicht es mehr Kontrolle und reduzierte Chance der Überwucherung. </li><li> Prüfen Sie flüssige Kulturen auf Trübungen (ca. OD 600 von 0,6-0,8). Legen Sie alle trüben Rohre auf 4 ° C und lassen Sie andere Röhrchen trüben, indem Sie länger wachsen. HINWEIS: Bakterien nicht auf OD 600- Werte wachsen, die größer als empfohlen sind, da Plasmid-Instabilitätsereignisse auftreten können. </li><li> Extrahieren Sie Plasmid-DNA aus Bakterien mit einem handelsüblichen Plasmid-Miniprep-Kit (siehe Materialtabelle). Eluieren in 15 &amp; mgr; l vorgewärmtem (bis 70 ° C in einem Heizblock) Elutionspuffer. Lassen Sie den Elutionspuffer 5 Minuten lang vor der Zentrifugation auf die Säule inkubieren. HINWEIS: Bewahren Sie mindestens 1 ml dieser Starterkultur bei 4 ° C fürWeiter im nächsten Schritt. </li><li> Digg 10 &amp; mgr; l der gewonnenen Plasmide, um zu beurteilen, ob Plasmid-Instabilitätsereignisse während der Kultur auftraten. HINWEIS: Digit p1 mit SalI / NheI und p2 mit BamHI / HindIII bei 37 ° C für 1 h. Bestätigen Sie die Anwesenheit der korrekten Banden nach der Verdauung (Abbildung 2a ) durch Gelelektrophorese und fahren Sie mit Schritt 2 fort. Wenn Sie Plasmid-DNA durch Walzkreisverstärkung (RCA) vorbereiten, reservieren Sie ein Teil des Miniprep-Eluats, um als Vorlage zu dienen. </li></ol> 2. Herstellung von ausreichend Plasmid-DNA zur Ligation HINWEIS: Die Ligation und die anschließende Elektroporation erfordert eine ausreichende Menge an Plasmid-DNA, die entweder über Maxiprep oder RCA erzeugt werden muss. Während maxiprep der traditionell verwendete Ansatz ist, bietet RCA den Vorteil, dass keine Bakterien erforderlich sind, wodurch das Potential für die Plasmid-induzierte Toxizität in Bakterien, die zu Instabilitätsereignissen führen können, entfernt wird. <ol><li><stRong&gt; Führen Sie das folgende maxiprep-Verfahren durch. <ol><li> Für jedes Plasmid, das im vorigen Abschnitt das korrekte Restriktionsenzym-Verdauungsmuster nachgewiesen hat, fügen Sie 500 &amp; mgr; l Starterkultur zu 1 l TB-Carb (25 &amp; mgr; g / ml Carbenicillin) -brühe hinzu und schütteln über Nacht bei 30 ° C (ungefähr 14-16 h , Etwa OD 600 von 0,6-0,8). HINWEIS: Lassen Sie die Kultur nicht über diesen OD 600- Wert wachsen. Dies führt möglicherweise zu Instabilitätsereignissen innerhalb der Plasmide. </li><li> Ernten Sie die Bakterien und führen Sie maxipreps pro Hersteller-Protokoll (siehe Material-Tabelle). </li></ol></li><li> Verwenden Sie die gespeicherten Miniprep ab Schritt 1.6, führen Sie die folgenden für die RCA-Prozedur durch. <ol><li> Übertragen Sie 1 &amp; mgr; l Plasmid-DNA in ein Röhrchen, das 50 &amp; mgr; l Probenpuffer enthält. </li><li> Die Probe bei 95 ° C für 3 min erhitzen und dann bei 4 ° C inkubieren, bis sie gebrauchsfertig sind. </li><li> Bereitet die kommerzielle Verstärkung vorVormischung (siehe Werkstofftabelle ). Kombinieren Sie 50 μl Reaktionspuffer mit 2 μl Enzymmischung in einem auf Eis eingesetzten Röhrchen. HINWEIS: Die Amplifikationsvormischung sollte bis zum Gebrauch auf Eis gehalten werden. Es ist zweckmäßig, eine Mastermischung durch Kombination von ausreichenden Reagenzien für die erforderliche Anzahl von Amplifikationsreaktionen herzustellen. Eine nicht genutzte Vormischung muss verworfen werden. </li><li> Übertragen Sie 50 &amp; mgr; l der vorbereiteten Amplifikationsvormischung auf die denaturierte Probe. </li><li> Inkubieren Sie die Reaktionsröhrchen bei 30 ° C für 18 h. </li><li> Inkubieren Sie die Röhrchen bei 65 ° C für 10 min, um die ø29-DNA-Polymerase zu inaktivieren. </li><li> Die Reaktionsrohre bei 4 ° C oder -20 ° C bis zum Gebrauch aufbewahren. HINWEIS: Zu diesem Zeitpunkt sollte die Plasmid-DNA, die über beide Methoden hergestellt wurde, quantifiziert werden (unter Verwendung von Absorption bei 260 nm), und das ZIKV-Genom sollte Sanger sequenziert werden, um zu bestätigen, dass keine Instabilitätsereignisse (Deletionen und Umlagerungen) während der Präparation auftraten. </li></ol></li></ol><table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Primer Name </td><td> Sequenz (5 &#39;- 3&#39;) </td></tr><tr><td> ZIKV PRVABC59 1Für. </td><td> AGTTGTTGATCTGTGTGAATCAGAC </td></tr><tr><td> ZIKV konserviert 632Für. </td><td> GCCCTATGCTGGATGAGG </td></tr><tr><td> ZIKV konserviert 692Rev. </td><td> GGTTCCGTACACAACCCAAGTTG </td></tr><tr><td> ZIKV konserviert 1313Rev. </td><td> CTCCCTTTGCCAAAAAGTCCACA </td></tr><tr><td> ZIKV konserviert 1201Für. </td><td> CCAACACAAGGTGAAGCCTAC </td></tr><tr><td> ZIKV konserviert 1663Für. </td><td> GCAGACACCGGAACTCCACACT </td></tr><tr><td> ZIKV konserviert 2008Für. </td><td> CAGATGGCGGTGGACATGC </td></tr><tr><td> ZIKV konserviert 2350Rev. </td><td> GTGAGAACCAGGACATTCCTCC </td></tr><tr><td> ZIKV konserviert 2605Für. </td><td> TACAAGTACCATCCTGACTCCC </td></tr><tr><td> ZIKV konserviert 3499Rev. </td><td>GCCTTATCTCCATTCCATACCA </td></tr><tr><td> ZIKV Konserviert 3961Rev. </td><td> TTGCCAACCAGGCCAAAG </td></tr><tr><td> ZIKV konserviert 4132Für. </td><td> CATTTGTCATGGCCCTGG </td></tr><tr><td> ZIKV konserviert 4561Rev. </td><td> CTATTGGGTTCATGCCACAGAT </td></tr><tr><td> ZIKV konserviert 4665Für. </td><td> GACCACAGATGGAGTGTACAGAGT </td></tr><tr><td> ZIKV konserviert 5189Rev. </td><td> AAGACAGTTAGCTGCTTCTTCTTCAG </td></tr><tr><td> ZIKV konserviert 5219Für. </td><td> GAGAGTTCTTCCTGAAATAGTCCGTGA </td></tr><tr><td> ZIKV konserviert 6086Rev. </td><td> CTTGCTTCAAGCCAGTGTGC </td></tr><tr><td> ZIKV konserviert 6119Für. </td><td> GCCTCATAGCCTCGCTCTATCG </td></tr><tr><td> ZIKV konserviert 6721Rev. </td><td> CCATTCCAAAGCCCATCTTCCC </td></tr><tr><td> ZIKV konserviert 6769Für. </td><td> CCAGCCAGAATTGCATGTGTCC </td></tr><tr><td> ZIKV Konserviert 7209Rev. </td><td> ATCATTAGCAGCGGGACTCCAA </td></tr><tr><td> ZIKV Konserviert 7343Für. </td><td> GTTGTGGATGGAATAGTGGT </td></tr><tr><td> ZIKV Konserviert 8243Für. </td><td> TGCCCATACACCAGCACTATGA </td></tr><tr><td> ZIKV PRVABC59 8893Rev. </td><td> TGCATTGCTACGAACCTTGTTG </td></tr><tr><td> ZIKV konserviert 9133Für. </td><td> AGCCCTTGGATTCTTGAACGAGGA </td></tr><tr><td> ZIKV PRVABC59 9673Rev. </td><td> AACGCAATCATCTCCACTGACT </td></tr><tr><td> ZIKV konserviert 9686Für. </td><td> GATGATAGGTTTGCACATGCC </td></tr><tr><td> ZIKV Konserviert 10321Rev. </td><td> GTCCATGTACTTTTCTTCATCACCTAT </td></tr><tr><td> ZIKV konserviert 10455Für. </td><td> CAGGAGAAGCTGGGAAACC </td></tr><tr><td> ZIKV konserviert 10621Rev. </td><td> CAGATTGAAGGGTGGGGAAGGTC </td></tr></tbody></table> Tabelle 1: Primer zur Sequenzierung von cDNA-Klonen. Plasmide können vollständig mit den aufgeführten Primern sequenziert werden. Primer markiert als &quot;konserviert&quot; indiDass sie wahrscheinlich alle Genotypen von ZIKV sequenzieren / verstärken können. Primer, die als &quot;PRVABC59&quot; markiert sind, sind spezifisch für diesen Stamm, können aber auch für andere asiatische Genotypstämme und möglicherweise auch andere Genotypen funktionieren. 3. Herstellung von in vitro transkribierter RNA <ol><li> Richten Sie die Verdauungsreaktion von entweder maxiprep oder RCA vorbereitete DNA ein. <ol><li> Zur p1-Verdauung werden 10 μl 10x Reaktionspuffer, 3 μl ApaLI, 3 μl BamHI-HF, 3 μl rSAP oder CIP und 3,3 μg p1 DNA vermischt. Füge ddH 2 O zu 100 μl hinzu. </li><li> Zur p2-Verdauung 10 μl 10x Reaktionspuffer, 3 μl ApaLI, 3 μl EcoRI-HF und 13,3 μg p2 DNA mischen. Füge ddH 2 O zu 100 μl hinzu. </li><li> Inkubieren bei 37 ° C für 1-2 h. </li><li> Reinigen Sie mit einem handelsüblichen Gel- und PCR-Clean-up-Kit (siehe Materialtabelle). Eluieren in 30 &amp; mgr; l Elutionspuffer, der auf 70 ° C in einem Heizblock vorgeheizt ist (inkubieren derSpalte für 5 min vor dem Spinnen). HINWEIS: Halten Sie 1 μL auf einem Gel später. </li></ol></li><li> Ligationsreaktion vorbereiten. <ol><li> Kombinieren Sie 10 μl 10x T4-DNA-Ligationsreaktionspuffer, 3 μl T4-DNA-Ligase (400 U / μL), 29 μl gereinigtes p1 und 29 μl gereinigtes p2. Füge ddH 2 O zu 100 μl hinzu. </li><li> Inkubieren bei Raumtemperatur für 2 h oder 16 ° C über Nacht. </li><li> Reinigen Sie mit einem handelsüblichen Gel- und PCR-Clean-up-Kit (siehe Materialtabelle). Eluieren in 10 &amp; mgr; l Elutionspuffer, der auf 70 ° C in einem Heizblock vorgeheizt wurde (5 Minuten vor dem Spinnen inkubieren). HINWEIS: Halten Sie 1 μL auf einem Gel später. </li></ol></li><li> Führen Sie unverdaute Plasmide, verdaute Plasmide und Ligation auf einem Agarosegel. Das Ligationsprodukt sollte eine höhere Molekulargewichtsbande (etwa 11 kb) als nur verdautes Plasmid allein aufweisen, was anzeigt, dass die Ligation erfolgreich war ( 2b ).</li><li> Richten Sie T7 in vitro Transkriptionsreaktion ein. <ol><li> Kombinieren Sie 10 &amp; mgr; l 2 × ARCA / NTP-Mischung, 2 &amp; mgr; l T7-RNA-Polymerase-Mischung und 8 &amp; mgr; l gereinigte Ligationsreaktion für ein Endvolumen von 20 &amp; mgr; l. HINWEIS: Die im Mix enthaltene ARCA ist ein Cap-Analog, das exklusiv in die richtige Orientierung integriert ist. Standard-Cap-Analoga können nur ~ 50% der Transkripte mit einer Kappe in der richtigen Orientierung führen. </li><li> 5 h bei 37 ° C inkubieren. </li><li> Messung der RNA-Konzentration über ein UV-Spektrophotometer. Gegebenenfalls ein denaturierendes Agarosegel ausführen, um die Länge des RNA-Transkripts zu bestätigen. </li></ol></li></ol> 4. Rettung des Infektionsvirus durch Elektroporation <ol><li> Tage vor der Elektroporation, 1 T182-Kolben von Vero-Zellen herstellen (zwischen T150 und T182 ist akzeptabel, in DMEM + 10% fötalem Rinderserum (FBS) gezüchtet) pro zu ersetzendes Konstrukt. Füge 1 T182 als Mock-Transfektionskontrolle ein. CeSollte bei 70-80% Konfluenz verwendet werden. </li><li> Wenn die Zellen fertig sind, legen Sie 12 ml / Reaktion von DMEM + 15% FBS + 10 mM HEPES in ein auf 37 ° C erwärmtes Wasserbad. </li><li> Lösen Sie Zellen durch Trypsinisierung mit einem Standardprotokoll und gewinnen Sie Zellen in Medien mit 10% FBS, um Trypsin zu inaktivieren; Zentrifugen von Zellen bei 150 xg für 5 min bei 4 ° C. </li><li> Waschen von Zellen in 1x phosphatgepufferter Kochsalzlösung (PBS), Pelletieren von Zellen bei 150 xg für 5 min bei 4 ° C. Wiederholen Sie diesen Schritt zweimal für insgesamt drei Wäschen. </li><li> Resuspendieren von Zellen in 200 &amp; mgr; l RPMI 1640 + 10 mM HEPES (steril) pro Anzahl der Proben. 200 μl Zellsuspension in ein steriles Röhrchen überführen. Zellen sollten ~ 0,5 x 10 7 Zellen / ml sein. </li><li> Füge 20 μl Wasser (Mock Neg. Kontrolle) oder 20 μl RNA (vorzugsweise 5-10 μg) in Schritt 3.4 zu jedem Satz von Zellen zu. Mischen Sie vorsichtig, indem Sie das Röhrchen schlagen und den Inhalt des Röhrchens in eine 2 mm Spalt-Elektroporationsküvette übertragen. </li><li> Elektrisch einstellenOporator auf 170 V LV, Omega (Widerstand) bei 0 und 950 μF (ca. 625 V / cm und 20 ms Zeitkonstante für andere Maschinen). Stellen Sie den Widerstand auf die niedrigste verfügbare Einstellung ein, entweder 0 oder ∞ falls vorhanden. </li><li> Pulse einmal und fügt sofort 600 μl DMEM +15% FBS +10 mM HEPES hinzu, das in Schritt 4.2 erwärmt wurde. Innerhalb der Küvette gründlich ausspülen, um alle Zellen zu entfernen. Füge Zellen zu einem T75-Gewebekulturkolben hinzu, der 10 ml vorgewärmtes Medium enthält. Entfernen Sie zusätzliche Medien aus der Küvette, indem Sie die mit der Küvette enthaltene Tropfmaschine verwenden. Sei vorsichtig, um die Sterilität aufrechtzuerhalten. </li><li> Wirbelkolben zum Mischen von Medien und Zellen und Platzieren in 37 ° C Inkubator. </li><li> Überprüfen Sie den nächsten Tag auf die Lebensfähigkeit der Zellen und tun Sie es jeden Tag bis 50-75% Zelltod beobachtet wird. Der Zelltod wird durch Vergleich mit der mockelektroporierten Kontrolle beobachtet. HINWEIS: Der ZIKV-Zytopathie-Effekt (CPE) ist in Vero-Zellen sehr ausgeprägt, was zu aufgerundeten Zellen führt, die sich im Kulturmedium ablösen und schwimmen. Wir habenBeobachtete eine Reichweite von 8-10 Tagen als ideal für die Ernte. </li><li> Ernteüberstand in einem konischen Rohr und zentrifugieren, um Zellschutt bei&gt; 3.000 xg für 10 min bei 4 ° C zu entfernen. </li><li> Den geklärten Überstand auf ein neues Röhrchen auftragen und mit einer Endkonzentration von 20% FBS (ab 100% Lager) ergänzen. Zusätzlich fügen Sie sterile HEPES in einer Endkonzentration von 10 mM als Puffermittel hinzu, um die Virusinfektiosität zu bewahren, während sie gefroren sind (aus einem 1 M sterilen Bestand). </li><li> Mischen Sie das Virus durch Vortexen und Aliquot in Schraubverschluss-Durchstechflaschen. Bei -80 ° C für zukünftige Verwendung lagern. </li></ol> 5. Titration des wiederhergestellten Virus <ol><li> Saat die passende Anzahl von 6- oder 12-Well-Platten von Vero-Zellen am Tag vor der Titration. </li><li> Virus aus dem Gefrierschrank entfernen und serielle 10-fache Verdünnungen in DMEM + 2% FBS in Röhrchen oder 96-Well-Platten herstellen. HINWEIS: Der erwartete Titer aus wiederhergestellten Klonen liegt zwischen 1 x 10 6 und 5 x 10 7 PFU / mL. </li><li> Hinzufügen 200 oR 400 &amp; mgr; l jeder Verdünnung in Duplikat zu einer Vertiefung einer 12- bzw. 6-Well-Platte. </li><li> Legen Sie Platten in 37 ° C Inkubator und Felsen alle 15 min, für insgesamt 1-1,5 h Adsorption Zeitraum. </li><li> Entfernen Sie das Virus-Inokulum und fügen Sie 1 ml (12-Well) oder 2 ml (6-Well) DMEM-Tragacanth-Overlay zu jeder Vertiefung hinzu. HINWEIS: Hierbei können Agarose, Agar, Methylcellulose oder andere Überlagerungsmedien verwendet werden. </li><li> Inkubieren von Zellen in 37 ° C Inkubator für 5 Tage. Die Zeit für die richtige Plaque-Bildung hängt von der verwendeten Überlagerung ab. </li><li> Um die Zellen zu fixieren, entfernen Sie die Platten aus dem Inkubator und dekantieren Sie die Überlagerung sanft in das Desinfektionsmittel. </li><li> Füge ausreichend 20% Ethanol / 0,1% Kristallviolett (CV) zu jeder Vertiefung hinzu, um zu bedecken und zu mischen zu mischen. HINWEIS: Viele andere Fixiermittel existieren und können hier verwendet werden. Zusätzlich kann bei Verwendung eines Agarose- oder Agar-Overlays eine zweite Overlay in Verbindung mit neutralem Rot verwendet werden, um Plaques ohne Fixierung zu visualisieren. 20% Ethanol hat sich gezeigtWirksam bei der Inaktivierung von umhüllten Viren in früheren Studien; Verwenden Sie diesen Betrag nicht für nicht umhüllte Viren, da sie nicht inaktiviert werden. 19 . </li><li> Inkubieren von Platten für 30-60 min bei Raumtemperatur (in einem Klasse II Biosicherheitsschrank); CV (nach örtlichen Vorschriften) verwerfen und Platten mit Leitungswasser waschen. </li><li> Lassen Sie die Platten trocknen und legen Sie Plaques manuell ein. HINWEIS: Referenz 20 kann als zusätzliche Referenz für die Durchführung von Plaque-Assays verwendet werden. </li></ol>

<ol>
	<li>Kindhauser, M. K., Allen, T., Frank, V., Santhana, R. S., Dye, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika:+the+origin+and+spread+of+a+mosquito-borne+virus.">Zika: the origin and spread of a mosquito-borne virus.</a> Bull World Health Organ. 94 (9), 675C-686C (2016).</li><li>Oehler, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+virus+infection+complicated+by+Guillain-Barre+syndrome--case+report,+French+Polynesia,+December+2013.">Zika virus infection complicated by Guillain-Barre syndrome--case report, French Polynesia, December 2013.</a> Euro Surveill. 19 (9), (2014).</li><li>Li, D., Aaskov, J., Lott, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+cryptic+prokaryotic+promoter+within+the+cDNA+encoding+the+5'+end+of+dengue+virus+RNA+genome.">Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.</a> PLoS One. 6 (3), e18197 (2011).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+approach+to+propagate+flavivirus+infectious+cDNA+clones+in+bacteria+by+introducing+tandem+repeat+sequences+upstream+of+virus+genome.">A novel approach to propagate flavivirus infectious cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome.</a> J Gen Virol. 95 (Pt 7), 1493-1503 (2014).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Successful+propagation+of+flavivirus+infectious+cDNAs+by+a+novel+method+to+reduce+the+cryptic+bacterial+promoter+activity+of+virus+genomes.">Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes.</a> J Virol. 85 (6), 2927-2941 (2011).</li><li>Rice, C. M., Grakoui, A., Galler, R., Chambers, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+of+infectious+yellow+fever+RNA+from+full-length+cDNA+templates+produced+by+in+vitro+ligation.">Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation.</a> New Biol. 1 (3), 285-296 (1989).</li><li>Yun, S. I., Kim, S. Y., Rice, C. M., Lee, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+application+of+a+reverse+genetics+system+for+Japanese+encephalitis+virus.">Development and application of a reverse genetics system for Japanese encephalitis virus.</a> J Virol. 77 (11), 6450-6465 (2003).</li><li>Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., Davidson, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+major+determinant+of+mouse+neurovirulence+of+dengue+virus+type+2+using+stably+cloned+genomic-length+cDNA.">Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA.</a> J Gen Virol. 79 (Pt 3), 437-446 (1998).</li><li>Johansen, I. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intron+insertion+facilitates+amplification+of+cloned+virus+cDNA+in+Escherichia+coli+while+biological+activity+is+reestablished+after+transcription+in+vivo.">Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo.</a> Proc Natl Acad Sci U S A. 93 (22), 12400-12405 (1996).</li><li>Shan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Infectious+cDNA+Clone+of+Zika+Virus+to+Study+Viral+Virulence,+Mosquito+Transmission,+and+Antiviral+Inhibitors.">An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors.</a> Cell Host Microbe. 19 (6), 891-900 (2016).</li><li>Schwarz, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rescue+of+the+1947+Zika+Virus+Prototype+Strain+with+a+Cytomegalovirus+Promoter-Driven+cDNA+Clone.">Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone.</a> mSphere. 1 (5), (2016).</li><li>Tsetsarkin, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Full-Length+Infectious+cDNA+Clone+of+Zika+Virus+from+the+2015+Epidemic+in+Brazil+as+a+Genetic+Platform+for+Studies+of+Virus-Host+Interactions+and+Vaccine+Development.">A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development.</a> MBio. 7 (4), (2016).</li><li>Gadea, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+method+for+the+rapid+generation+of+recombinant+Zika+virus+expressing+the+GFP+reporter+gene.">A robust method for the rapid generation of recombinant Zika virus expressing the GFP reporter gene.</a> Virology. 497, 157-162 (2016).</li><li>Kapoor, M., Zhang, L., Mohan, P. M., Padmanabhan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+and+characterization+of+an+infectious+dengue+virus+type-2+RNA+genome+(New+Guinea+C+strain).">Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain).</a> Gene. 162 (2), 175-180 (1995).</li><li>Messer, W. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+characterization+of+a+reverse+genetic+system+for+studying+dengue+virus+serotype+3+strain+variation+and+neutralization.">Development and characterization of a reverse genetic system for studying dengue virus serotype 3 strain variation and neutralization.</a> PLoS Negl Trop Dis. 6 (2), e1486 (2012).</li><li>Kinney, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avian+virulence+and+thermostable+replication+of+the+North+American+strain+of+West+Nile+virus.">Avian virulence and thermostable replication of the North American strain of West Nile virus.</a> J Gen Virol. 87 (Pt 12), 3611-3622 (2006).</li><li>Chang, A. C., Cohen, S. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+amplifiable+multicopy+DNA+cloning+vehicles+derived+from+the+P15A+cryptic+miniplasmid.">Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid.</a> J Bacteriol. 134 (3), 1141-1156 (1978).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. 91 (1), (2017).</li><li>Roberts, P. L., Lloyd, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus+inactivation+by+protein+denaturants+used+in+affinity+chromatography.">Virus inactivation by protein denaturants used in affinity chromatography.</a> Biologicals. 35 (4), 343-347 (2007).</li><li>Baer, A., Kehn-Hall, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+concentration+determination+through+plaque+assays:+using+traditional+and+novel+overlay+systems.">Viral concentration determination through plaque assays: using traditional and novel overlay systems.</a> J Vis Exp. (93), e52065 (2014).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. , (2016).</li><li>Grubaugh, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Drift+during+Systemic+Arbovirus+Infection+of+Mosquito+Vectors+Leads+to+Decreased+Relative+Fitness+during+Host+Switching.">Genetic Drift during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during Host Switching.</a> Cell Host Microbe. 19 (4), 481-492 (2016).</li></ol>

Die Autoren haben nichts zu offenbaren.

Here we describe a method for the recovery of a bipartite infectious cDNA clone system for ZIKV. Previously described clones for ZIKV suffer from either attenuation or require the addition of introns, making plasmids larger and preventing rescue in insect cells. Infectious virus can be recovered using the two-plasmid clone system in either mammalian or insect cells (data not shown). In addition, virus recovered from this system behaves similarly to wild-type virus in several cell lines, in an immunocompromised mouse mode...

Zika-Virus (ZIKV, Familie Flaviviridae : Gattung Flavivirus ) ist ein Moskito-getragenes Flavivirus, das in Brasilien in den Jahren 2013-14 angekommen ist und anschließend mit einem massiven Ausbruch der fiebrigen Krankheit verbunden war, die sich in ganz Amerika verbreitete 1 . Darüber hinaus wurde ZIKV mit schwerwiegenden Erkrankungen wie dem Guillain-Barré-Syndrom bei Erwachsenen und Mikrozephalie bei Föten und Neugeborenen verknüpft 2 . Wenig war über ZIKV vor seiner schnellen Verbreitung in der westlichen Hemisphäre bekannt. Dazu gehört ein Mangel an molekularen Werkzeugen, was die mechanistische Forschung behindert. Molekulare Werkzeuge für Viren, wie infektiöse cDNA-Klone, erleichtern die Impfung und die antivirale therapeutische Entwicklung und ermöglichen die Bewertung von viralen genetischen Faktoren, die mit der differentiellen viralen Pathogenese, der Immunantwort und der viralen Evolution zusammenhängen. Flavivirus-infektiöse Klone sind bekannt, dass sie in Bakterien aufgrund von cr stark instabil sindYptische prokaryotische Promotoren, die in ihren Genomen vorhanden sind 3 . Es wurden mehrere Ansätze verwendet, um dieses Problem zu lindern; Einschließlich der Insertion von Tandemwiederholungen stromaufwärts von viralen Sequenzen 4 , Mutation von mutmaßlichen prokaryotischen Promotorsequenzen 5 , Aufteilen des Genoms in mehrere Plasmide 6 , Vektoren mit niedriger Kopienzahl (einschließlich bakterieller künstlicher Chromosomen) 7 , 8 und Insertion von Introns im viralen Genom 9 . Ein einseitiges System ohne Modifikationen wurde für ZIKV beschrieben; Dieser Klon schien jedoch in der Zellkultur und bei den Mäusen 10 zu dämpfen. Andere Gruppen haben Introns in das ZIKV-Genom konstruiert, was eine Störung von instabilen Sequenzen in Bakterien ermöglicht, die in Säugetierzellen in vitro zur Herstellung von infektiösem Virus 11 gespleißt werden können, 12 Zusätzlich wurde ein PCR-basiertes System mit dem Titel Infectious-Subgenomic-Amplicons erfolgreich eingesetzt, um den Prototyp MR766-Stamm von ZIKV 13 zu retten. Der hier beschriebene Ansatz erfordert keine Fremdsequenzen, sondern stört das Genom im Bereich hoher Instabilität durch die Verwendung mehrerer Plasmide, die bisher erfolgreich mit Gelbfieber 6 , Dengue 14 , 15 und West-Nil-Viren 16 verwendet wurden. Darüber hinaus erleichtert die Zugabe der Hepatitis-D-Ribozym-Sequenz an den viralen genomischen Termini die Schaffung eines authentischen 3&#39;-Endes ohne die Notwendigkeit der Addition einer Linearisierungsstelle. Zusätzlich werden beide Plasmide in einem Vektor mit niedriger Kopienzahl (pACYC177, ~ 15 Kopien pro Zelle) konstruiert, um jegliche Resttoxizität 17 zu mildern. Das gewonnene Virus zeigt ein vergleichbares Wachstumsprofil anElterliches Virus in in vitro Wachstumskurven in 8 Zelllinien, die eine Vielzahl von Zelltypen umfassen, die von Säugetieren und Insekten abgeleitet sind, und hat identische pathogene Profile bei Mäusen und Infektions-, Verbreitungs- und Übertragungsraten in den Mücken 18 gezeigt . Hierin beschreiben wir ein Protokoll, in dem beschrieben wird, wie man die infektiösen Klonplasmide wächst, in vitro eine Volllängen-Virus-RNA (das virale Genom) erzeugt und in der Zellkultur ein infektiöses Virus wiederherstellt. Zuerst beschreiben wir die Ausbreitung von Plasmiden in Bakterien oder bakterienfreien Verstärkung mittels Rollkreisverstärkung (RCA). Als nächstes zeigen wir, wie die beiden Plasmide verdaut werden und dann anschließend miteinander ligiert werden, um ein Volllängenvirus zu erzeugen. Schließlich beschreiben wir die Produktion von transkribierter RNA und deren anschließende Elektroporation in Vero-Zellen, gefolgt von Titration des gewonnenen Virus (Abbildung 1 ). Der beschriebene Ansatz ist schnell, so dass foR Erholung von infektiösen Virusbeständen in 1-2 Wochen.

<table><tbody><tr><td>NEB Stable CompetentE. coli</td><td>New England BioLabs</td><td>C3040H</td><td></td></tr><tr><td>Carbenicillin, Disodium Salt</td><td>various</td><td></td><td></td></tr><tr><td>Zyppy Plasmid Miniprep Kit</td><td>Zymo Research</td><td>D4036</td><td></td></tr><tr><td>ZymoPURE Plasmid Maxiprep Kit</td><td>Zymo Research</td><td>D4202</td><td></td></tr><tr><td>SalI-HF</td><td>New England BioLabs</td><td>R3138S</td><td>20,000 units/ml</td></tr><tr><td>NheI-HF</td><td>New England BioLabs</td><td>R3131S</td><td>20,000 units/ml</td></tr><tr><td>ApaLI</td><td>New England BioLabs</td><td>R0507S</td><td>10,000 units/ml</td></tr><tr><td>EcoRI-HF</td><td>New England BioLabs</td><td>R3101S</td><td>20,000 units/ml</td></tr><tr><td>BamHI-HF</td><td>New England BioLabs</td><td>R3136S</td><td>20,000 units/ml</td></tr><tr><td>HindIII-HF</td><td>New England BioLabs</td><td>R3104S</td><td>20,000 units/ml</td></tr><tr><td>illustra TempliPhi 100 Amplification Kit</td><td>GE Healthcare Life Sciences</td><td>25640010</td><td></td></tr><tr><td>NucleoSpin Gel and PCR Clean-up</td><td>Macherey-Nagel</td><td>740609.5</td><td></td></tr><tr><td>Shrimp Alkaline Phosphatase (rSAP)</td><td>New England BioLabs</td><td>M0371S</td><td>1,000 units/ml</td></tr><tr><td>Alkaline Phosphatase, Calf Intestinal (CIP)</td><td>New England BioLabs</td><td>M0290S</td><td>10,000 units/ml</td></tr><tr><td>T4 DNA Ligase</td><td>New England BioLabs</td><td>M0202S</td><td>400,000units/mL</td></tr><tr><td>HiScribe T7 ARCA mRNA Kit</td><td>New England BioLabs</td><td>E2065S</td><td></td></tr><tr><td>Vero cells</td><td>ATCC</td><td>CCL-81</td><td></td></tr><tr><td>ECM 630 High Throughput Electroporation System</td><td>BTX</td><td>45-0423</td><td>Other machines are acceptable.</td></tr><tr><td>LB Broth with agar (Miller)</td><td>Sigma</td><td>L3147</td><td>Can be homemade as well.</td></tr><tr><td>Terrific Broth</td><td>Sigma</td><td>T0918</td><td>Can be homemade as well.</td></tr><tr><td>Petri Dish</td><td>Celltreat</td><td>229693</td><td></td></tr><tr><td>Culture Tubes</td><td>VWR International</td><td>60818-576</td><td></td></tr><tr><td>T75 flasks</td><td>Celltreat</td><td>229340</td><td></td></tr><tr><td>T182 flasks</td><td>Celltreat</td><td>229350</td><td></td></tr><tr><td>1x PBS</td><td>Corning</td><td>21-040-CV</td><td></td></tr><tr><td>RPMI 1640 with L-glutamine</td><td>Corning</td><td>10-040-CV</td><td></td></tr><tr><td>DMEM with L-glutamine and 4.5 g/L glucose</td><td>Corning</td><td>10-017-CV</td><td></td></tr><tr><td>Fetal Bovine Serum (FBS)</td><td>Atlas Biologicals</td><td>FP-0500-A</td><td></td></tr><tr><td>Tragacanth Powder</td><td>MP Bio</td><td>MP 104792</td><td></td></tr><tr><td>Crystal Violet</td><td>Amresco</td><td>0528-1006</td><td></td></tr><tr><td>Ethanol Denatured</td><td>VWR International</td><td>BDH1156-1LP</td><td></td></tr><tr><td>6 well plate</td><td>Celltreat</td><td>229106</td><td></td></tr><tr><td>12 well plate</td><td>Celltreat</td><td>229111</td><td></td></tr><tr><td>Sequencing Oligos</td><td>IDT</td><td>see table 1</td><td></td></tr><tr><td>Qubit 3.0</td><td>ThermoFisher</td><td>Qubit 3.0</td><td>other methods are acceptable.</td></tr><tr><td>Qubit dsDNA BR Assay Kit</td><td>ThermoFisher</td><td>Q32850</td><td>other methods are acceptable.</td></tr><tr><td>Qubit RNA HS Assay Kit</td><td>ThermoFisher</td><td>Q32852</td><td>other methods are acceptable.</td></tr><tr><td>Class II Biosafety Cabinet</td><td>Varies</td><td>N/A</td><td>This is necessary for live-virus work.</td></tr></tbody></table>

rescue and characterization of recombinant virus from a new world zika virus infectious clone

Infektiöse cDNA-Klone erlauben die genetische Manipulation eines Virus und erleichtern so die Arbeit an Impfstoffen, Pathogenese, Replikation, Übertragung und Virusentwicklung. Hier beschreiben wir den Aufbau eines infektiösen Klons für Zika Virus (ZIKV), der derzeit einen explosiven Ausbruch in Nord- und Südamerika verursacht. Um Toxizität gegenüber Bakterien zu verhindern, die häufig mit Flavivirus-abgeleiteten Plasmiden beobachtet wird, erzeugten wir ein Zwei-Plasmid-System, das das Genom am NS1-Gen trennt und stabiler ist als Volllängen-Konstrukte, die ohne Mutationen nicht erfolgreich gewonnen werden konnten. Nach der Verdauung und Ligation, um die beiden Fragmente zu verbinden, kann eine Volllängen-Virus-RNA durch in vitro- Transkription mit T7-RNA-Polymerase erzeugt werden. Nach der Elektroporation von transkribierter RNA in Zellen wurde das Virus gewonnen, das ähnliche In-vitro- Wachstumskinetiken und In-vivo- Virulenz- und Infektions-Phänotypen in Mäusen und Mücken zeigte.

Das hier beschriebene Protokoll ermöglicht die Wiederherstellung von infektiösem Klon-abgeleiteten Zika-Virus. Das Manipulieren des Zwei-Plasmid-Infektios-Klonsystems ist einfach, wenn es mit Sorgfalt durchgeführt wird, im Vergleich zu Volllängen-Versionen, die sehr instabil sind (Daten nicht gezeigt). Nach der Verdauung und Ligation der beiden verschiedenen Stücke wird eine Capped-RNA unter Verwendung einer in vitro- Transkription mit T7-Polymerase hergestellt, die dann in...

Watch this Scientific Journal Video about Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone at JoVE.com

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Dieses Protokoll beschreibt die Wiederherstellung des infektiösen Zika-Virus aus einem zwei-Plasmid-infektiösen cDNA-Klon.

Rettung und Charakterisierung des rekombinanten Virus aus einer neuen Welt Zika Virus Infectious Clone

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

rescue-characterization-recombinant-virus-from-new-world-zika-virus

Universidad de Cartagena UDEC

Research

JoVE Journal

Immunology and Infection

9.6K Aufrufe.  Colorado State University.  Dieses Protokoll beschreibt die Wiederherstellung des infektiösen Zika-Virus aus einem zwei-Plasmid-infektiösen cDNA-Klon. 

Serie: Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Generation of Recombinant Influenza Virus from Plasmid DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally established in 1999 1,2 plasmid-based reverse genetic techniques to generate recombinant viruses have revolutionized the influenza research field because specific questions have been answered by genetically engineered, infectious, recombinant influenza viruses. Such studies include virus replication, function of viral proteins, the contribution of specific mutations in viral proteins in viral replication and/or pathogenesis and, also, viral vectors using recombinant influenza viruses expressing foreign proteins 3.

Rescue of influenza A viruses from plasmid DNA is a basic and essential experimental technique that allows influenza researchers to generate recombinant viruses to study multiple aspects in the biology of influenza virus, and to be used as potential vectors or vaccines.

Erzeugung von rekombinanten Influenza Virus von Plasmid-DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Forschung

Immunologie und Infektion

Generation of Recombinant Arenavirus for Vaccine Development in FDA-Approved Vero Cells

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field 4. The use of cell-based arenavirus minigenome systems together with the ability to generate recombinant infectious arenaviruses with predetermined mutations in their genomes has facilitated the investigation of the contribution of viral determinants to the different steps of the arenavirus life cycle, as well as virus-host interactions and mechanisms of arenavirus pathogenesis 1, 3, 11 . In addition, the development of trisegmented arenaviruses has permitted the use of the arenavirus genome to express additional foreign genes of interest, thus opening the possibility of arenavirus-based vaccine vector applications 5 . Likewise, the development of single-cycle infectious arenaviruses capable of expressing reporter genes provides a new experimental tool to improve the safety of research involving highly pathogenic human arenaviruses 16 . The generation of recombinant arenaviruses using plasmid-based reverse genetics techniques has so far relied on the use of rodent cell lines 7,19 , which poses some barriers for the development of Food and Drug Administration (FDA)-licensed vaccine or vaccine vectors. To overcome this obstacle, we describe here the efficient generation of recombinant arenaviruses in FDA-approved Vero cells.

Rescue of recombinant arenaviruses from cloned cDNAs, an approach referred to as reverse genetics, allows researchers to investigate the role of specific viral gene products, as well as the contribution of their different specific domains and residues, to many different aspects of the biology of arenavirus. Likewise, reverse genetics techniques in FDA-approved cell lines (Vero) for vaccine development provides novel possibilities for the generation of effective and safe vaccines to combat human pathogenic arenaviruses.

Erzeugung von rekombinanten Arenavirus für die Impfstoffentwicklung in FDA-zugelassenen Vero-Zellen

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field  4. The use of cell-based ...

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV is an RNA virus of the Flaviviridae family. ZIKV is mainly transmitted by mosquitoes, but can also be spread by maternal to fetal vertical transmission as well as sexual contact. To date, there are no reliable treatment or vaccine options available to protect those infected by the virus. The development of a reproducible, effective Zika virus infectious cell culture system is critical for studying the molecular mechanisms of ZIKV replication as well as drug and vaccine development. In this regard, a protocol describing a mammalian cell-based in vitro Zika virus culture system for viral production and growth analysis is reported here. Details on the formation of plaques by Zika virus on a cell monolayer and plaque assay for measuring viral titer are presented. Viral genome replication kinetics and double-stranded RNA genome replicatory intermediates are determined. This culture platform was utilized to screen against a library of a small set of cytokines resulting in the identification of interferon-&#945; (IFN-&#945;), IFN-&#946; and IFN-&#947; as potent inhibitors of Zika viral growth. In summary, an in vitro infectious Zika viral culture system and various virological assays are demonstrated in this study, which has the potential to greatly benefit the research community in elucidating further the mechanisms of viral pathogenesis and the evolution of viral virulence. Antiviral IFN-alpha can further be evaluated as a prophylactic, post-exposure prophylactic, and treatment option for Zika virus infections in high-risk populations, including infected pregnant women.

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV), an emerging pathogen, is linked to fetal developmental abnormalities and microcephaly. The establishment of an effective infectious cell culture system is crucial for studies of ZIKV replication as well as vaccine and drug development. In this study, various virological assays pertaining to ZIKV are illustrated and discussed.

Zika Virus Infectious Zellkultursystem und die<em&gt; In Vitro</em&gt; Prophylaktische Wirkung von Interferonen

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV ...

Evaluation of Zika Virus-specific T-cell Responses in Immunoprivileged Organs of Infected Ifnar1-/- Mice

The Zika virus (ZIKV) can induce inflammation in immunoprivileged organs (e.g., the brain and testis), leading to the Guillain-Barr&#233; syndrome and damaging the testes. During an infection with the ZIKV, immune cells have been shown to infiltrate into the tissues. However, the cellular mechanisms that define the protection and/or immunopathogenesis of these immune cells during a ZIKV infection are still largely unknown. Herein, we describe methods to evaluate the virus-specific T-cell functionality in these immunoprivileged organs of ZIKV-infected mice. These methods include a) a ZIKV infection and vaccine inoculation in Ifnar1-/- mice; b) histopathology, immunofluorescence, and immunohistochemistry assays to detect the virus infection and inflammation in the brain, testes, and spleen; c) the preparation of a tetramer of ZIKV-derived T-cell epitopes; d) the detection of ZIKV-specific T cells in the monocytes isolated from the brain, testes, and spleen. Using these approaches, it is possible to detect the antigen-specific T cells that have infiltrated into the immunoprivileged organs and to evaluate the functions of these T cells during the infection: potential immune protection via virus clearance and/or immunopathogenesis to exacerbate the inflammation. These findings may also help to clarify the contribution of T cells induced by the immunization against ZIKV.

Evaluation of Zika Virus-specific T-cell Responses in Immunoprivileged Organs of Infected Ifnar1-/- Mice

A protocol to evaluate antigen-specific T-cell responses in the immunoprivileged organs of the Ifnar1-/- murine model for the Zika virus (ZIKV) infection is described. This method is pivotal for investigating the cellular mechanisms of the protection and immunopathogenesis of ZIKV vaccines and is also valuable for their efficacy evaluation.

Bewertung der Zika-Virus-spezifischen T-Zell-Reaktionen in Organe der Immunabwehr von infizierten Ifnar1- / - Mäusen

The Zika virus (ZIKV) can induce inflammation in immunoprivileged organs (e.g., the brain and testis), leading to the Guillain-Barr&#233; syndrome and ...

Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought serious public safety concerns. Among the risk factors, antibody-dependent enhancement (ADE) poses the most significant threat, as the recent re-emergence of the Zika virus (ZIKV) is primarily in areas where the population has been exposed and is in a state of pre-immunity to other closely related flaviviruses, especially dengue virus (DENV). Here, we describe a protocol for quantifying the effect of human serum antibodies against DENV on ZIKV infection in primary human cells or cell lines.

We describe a method to evaluate the effect of pre-existing immunity against dengue virus on the Zika virus infection by using human serum, primary human cells, and infection quantification by quantitative real-time polymerase chain reaction.

Quantifizierung der Antikörper-abhängige Verstärkung der Zika-Virus in primären humanen Zellen

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought ...

Establishing Mouse Models for Zika Virus-induced Neurological Disorders Using Intracerebral Injection Strategies: Embryonic, Neonatal, and Adult

The Zika virus (ZIKV) is a flavivirus currently endemic in North, Central, and South America. It is now established that the ZIKV can cause microcephaly and additional brain abnormalities. However, the mechanism underlying the pathogenesis of ZIKV in the developing brain remains unclear. Intracerebral surgical methods are frequently used in neuroscience research to address questions about both normal and abnormal brain development and brain function. This protocol utilizes classical surgical techniques and describes methods that allow one to model ZIKV-associated human neurological disease in the mouse nervous system. While direct brain inoculation does not model the normal mode of virus transmission, the method allows investigators to ask targeted questions concerning the consequence after ZIKV infection of the developing brain. This protocol describes embryonic, neonatal, and adult stages of intraventricular inoculation of ZIKV. Once mastered, this method can become a straightforward and reproducible technique that only takes a few hours to perform.

Here we describe a method for establishing a model of Zika virus-induced microcephaly in mouse. This protocol includes methods for embryonic, neonatal, and adult-stage intracerebral inoculation of the Zika virus.

Mausmodelle für Zika-Virus-induzierte neurologische Erkrankungen mit intrazerebrale Injektion Strategien etablieren: embryonale, Neugeborene und Erwachsene

The Zika virus (ZIKV) is a flavivirus currently endemic in North, Central, and South America. It is now established that the ZIKV can cause microcephaly ...

Neurowissenschaften

Rescue of Recombinant Zika Virus from a Bacterial Artificial Chromosome cDNA Clone

The association of Zika virus (ZIKV) infection with neurological complications during the recent worldwide outbreak and the lack of approved vaccines and/or antivirals have underscored the urgent need to develop ZIKV reverse genetic systems to facilitate the study of ZIKV biology and the development of therapeutic and/or prophylactic approaches. However, like with other flaviviruses, the generation of ZIKV full-length infectious cDNA clones has been hampered due to the toxicity of viral sequences during its amplification in bacteria. To overcome this problem, we have developed a nontraditional approach based on the use of bacterial artificial chromosomes (BACs). Using this approach, the full-length cDNA copy of the ZIKV strain Rio Grande do Norte Natal (ZIKV-RGN) is generated from four synthetic DNA fragments and assembled into the single-copy pBeloBAC11 plasmid under the control of the human cytomegalovirus (CMV) immediate-early promoter. The assembled BAC cDNA clone is stable during propagation in bacteria, and infectious recombinant (r)ZIKV is recovered in Vero cells after transfection of the BAC cDNA clone. The protocol described here provides a powerful technique for the generation of infectious clones of flaviviruses, including ZIKV, and other positive-strand RNA viruses, particularly those with large genomes that have stability problems during bacterial&#160;propagation.

The recent epidemic of Zika virus highlights the importance of establishing reverse genetic approaches to develop vaccines and/or therapeutic strategies. Here, we describe the protocol to rescue an infectious recombinant Zika virus from a full-length cDNA clone assembled in a bacterial artificial chromosome under the control of the human cytomegalovirus immediate-early promoter.

Rettung des rekombinanten Zika-Virus aus einem bakteriellen künstlichen Chromosom cDNA-Klon

The association of Zika virus (ZIKV) infection with neurological complications during the recent worldwide outbreak and the lack of approved vaccines ...

Isolation and Quantification of Zika Virus from Multiple Organs in a Mouse

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral load. The purpose of the procedure is to quantify viral titers in peripheral and CNS areas of the mouse at different time points post infection or under different experimental conditions to identify virologic and immunological factors that regulate Zika virus infection. The organ isolation procedures demonstrated allow for both focus forming assay quantification and quantitative PCR assessment of viral titers. The rapid organ isolation techniques are designed for the preservation of virus titer. Viral titer quantification by focus forming assay allows for the rapid throughput assessment of Zika virus. The benefit of the focus forming assay is the assessment of infectious virus, the limitation of this assay is the potential for organ toxicity reducing the limit of detection. Viral titer assessment is combined with quantitative PCR, and using a recombinant RNA copy control viral genome copy number within the organ is assessed with low limit of detection. Overall these techniques provide an accurate rapid high throughput method for the analysis of Zika viral titers in the periphery and CNS of Zika virus infected animals and can be applied to the assessment of viral titers in the organs of animals infected with most pathogens, including Dengue virus.

The goal of the protocol is to demonstrate the techniques used to investigate viral disease by isolating and quantifying Zika virus, from multiple organs in a mouse following infection.

Isolierung und Quantifizierung des Zika-Virus aus mehreren Organen in einer Maus

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral ...

Vector Competence Analyses on Aedes aegypti Mosquitoes using Zika Virus

The procedures presented describe a generalized methodology to infect Aedes aegypti mosquitoes with Zika virus under laboratory conditions to determine the rate of infection, disseminated infection, and potential transmission of the virus in the mosquito population in question. These procedures are widely utilized with various modifications in vector competence evaluations globally. They are important in determining the potential role that a given mosquito (i.e., species, population, individual) may play in the transmission of a given agent.

Vector Competence Analyses on Aedes aegypti Mosquitoes using Zika Virus

The presented protocol can determine the vector competence of Aedes aegypti mosquito populations for a given virus, such as Zika, in a containment setting.

Vektorkompetenzanalysen an Aedes aegypti Mücken mit Zika-Virus

The procedures presented describe a generalized methodology to infect Aedes aegypti mosquitoes with Zika virus under laboratory conditions to determine ...

High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) formats. The flavivirus non-structural (NS) proteins are thought to co-translationally assemble on the endoplasmic reticulum (ER) membranes, forming the replication complex (RC). The NS3 and NS5 are the most studied enzymes of the RC and constitute the main targets for drug development due to their crucial roles in viral genome replication. NS3 protease domain, which requires NS2B as its cofactor, is responsible for the cleavage of the immature viral polyprotein into the mature NS proteins, whereas NS5 RdRp domain is responsible for the RNA replication. Herein, we describe in detail the protocols used in replicon-based screenings and enzymatic assays to test large compound libraries for inhibitors of the Zika virus (ZIKV) replication. Replicons are self-replicating subgenomic systems expressed in mammalian cells, in which the viral structural genes are replaced by a reporter gene. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the reporter protein activity. The replicon-based screenings were performed using a BHK-21 ZIKV replicon cell line expressing Renilla luciferase as a reporter gene. To characterize the specific targets of identified compounds, we established in-vitro fluorescence-based assays for recombinantly expressed NS3 protease and NS5 RdRp. The proteolytic activity of the viral protease was measured by using the fluorogenic peptide substrate Bz-nKRR-AMC, while the NS5 RdRp elongation activity was directly detected by the increase of the fluorescent signal of SYBR Green I during RNA elongation, using the synthetic biotinylated self-priming template 3&#8242;UTR-U30 (5&#39;-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3&#39;).

In this work, we describe the protocols used in replicon-based and viral enzyme-based assays to screen for inhibitors of Zika virus replication in a high-throughput screening format.

Antivirale Hochdurchsatz-Assays zum Screening auf Inhibitoren der Zika-Virusreplikation

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) ...

Rettung und Charakterisierung des rekombinanten Virus aus einer neuen Welt Zika Virus Infectious Clone

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video