Die Röntgenbeugungsdatensätze wurden an der Strahllinie 7A des Pohang Accelerator Laboratory (Korea) gesammelt. Diese Studie wurde unterstützt durch die Basic Science Research-Programm durch die National Research Foundation von Korea (NRF), finanziert durch das Ministerium für Wissenschaft, ICT &amp; Future Planning (2015R1A1A01057574 bis MH) verwaltet.

1. Rekombinante Proteinherstellung und -reinigung von rBC1531 <ol><li> Herstellung eines rekombinanten BC1531-Proteins (rBC1531) -expressionsplasmids <ol><li> Genomische DNA von B. cereus 10 vorbereiten . </li><li> Amplifizieren des bc1531- Gens aus einer Matrize von B. cereus genomischen DNA durch Polymerasekettenreaktion (PCR) unter Verwendung von Vorwärts- und Rückwärtsprimern (siehe Materialliste) zur Bildung von BamHI- und SalI- Restriktionsenzymstellen bzw. 10 . </li><li> Das PCR-Produkt und einen modifizierten pET49b-Vektor (pET49bm) unter Verwendung von BamHI und Sal I, wie beschrieben, verdauen. </li><li> Mischen Sie das verdaute PCR-Produkt und den Vektor (3: 1-Verhältnis) aus Schritt 1.1.3 unter Verwendung von T4-DNA-Ligase in einer 10 &amp; mgr; l-Reaktion, wie beschrieben 11 . Inkubieren bei 18 ° C für 30 min. </li><li> 3 μl der Ligationsreaktion in 50 μl Chemica pipettierenLly kompetente E. coli DH5α Zellen in einem Röhrchen. Mischen Sie sanft durch Pipettieren auf und ab und legen Sie auf Eis für 30 min. Hitzeschock für 45 s bei 42 ° C. Füge 1 ml Luria-Bertani (LB) Medium hinzu und wachse die Zellen bei kräftigem Schütteln (250 U / min, 37 ° C, 45 min). </li><li> Nehmen Sie 100 μl der transformierten Zellen aus Schritt 1.1.6 und verbreiten Sie sie mit 100 μg / ml Kanamycin (Kan) auf die LB-Agarplatten. Inkubieren für ~ 18 h bei 37 ° C. </li><li> Pick-Kolonien unter Verwendung einer sterilen Spitze und wachsen die Zellen in 3 ml LB-Medium mit 100 &amp; mgr; g / ml Kan; Kräftig schütteln (250 U / min, 37 ° C, 18 h). </li><li> Vorbereiten von Plasmid-DNA unter Verwendung eines alkalischen SDS-Lyse-Verfahrens, wie beschrieben 10 . </li><li> Bestätigen Sie die Nukleotidsequenz des rBC1531-Expressionskonstrukts unter Verwendung der DNA-Sequenzierung 12 . </li></ol></li><li> Überexpression des rBC1531-Proteins <ol><li> Re-transformieren Sie den E. coli BL21 (DE3) Stamm mit rBC1531-expWie in den Schritten 1.1.5-1.1.6 beschrieben, für die Überexpression. </li><li> Wählen Sie eine Kolonie und wachsen Sie sie in 10 ml LB-Medium mit 50 μg / ml Kan (LB + Kan); Kräftig für 18 h bei 37 ° C schütteln. </li><li> Inkulieren Sie 10 ml über Nacht Kultur in 1 l LB + Kan-Medium und wachsen bei 37 ° C, bis die OD 600 (optische Dichte bei 600 nm) ~ 0,7 erreicht. </li><li> Die Kultur in eiskaltem Wasser für ca. 15 min eintauchen, um die Temperatur auf 18 ° C abkühlen zu lassen und Isopropyl-β-D-1-thiogalactopyranosid (IPTG) der Kultur bei einer Endkonzentration von 1 mM zur rekombinanten Proteinexpression zuzusetzen. Wachsen die Kultur bei 18 ° C für weitere ~ 16-18 h. </li></ol></li><li> Reinigung von rBC1531 <ol><li> Die Zellen durch Zentrifugation (5.000 xg, 4 ° C, 30 min) ernten. Verwerfe den Überstand sorgfältig, um die Zellen nicht zu stören. Die Zellen in 50 ml Phosphat-gepufferter Kochsalzlösung (PBS), die 10 mM Imidazol enthält, erneut suspendieren. </li><li> Lyse die Zellen zweimal durch Beschallung auf Eis, um die Überhitzung der Zelllysate zu verhindern (Zeit: 2 min 30 s, Zyklus auf: 5 s, Zyklus aus: 10 s, Amplitude: 38%). </li><li> Löschen Sie das Zelllysat durch Zentrifugation (~ 25.000 xg, 4 ° C, 30 min). </li><li> Mischen Sie 3 ml Nickelperlen und 60 ml PBS, enthaltend 10 mM Imidazol und den Schwerkraftfluss, den zusätzlichen Puffer, um die äquilibrierten Nickelperlen in einer 2,5 x 10 cm großen Glaschromatographiesäule zu fixieren. </li><li> Pipettieren Sie den Überstand von Schritt 1.3.3 auf die Säule mit voräquilibrierten Nickelperlen und inkubieren bei 4 ° C für 2 h auf einem Spinnrad bei niedriger Geschwindigkeit (~ 20 U / min). </li><li> Den Überstand durch Schwerkraft abtropfen lassen und die Nickelperlen in der Säule dreimal mit 100 ml PBS, enthaltend 10 mM Imidazol, waschen. </li><li> Eluiertes rBC1531-Protein durch Aufbringen von 4 x 5 ml PBS, enthaltend 250 mM Imidazol. </li><li> Nehmen Sie 15 μl der Elution aus Schritt 1.3.7 und führen Sie es auf 15% SDS-PAGE. Visualisierung der Proteinbänder aufDas Gel mit Coomassie-Blau-Färbung 10 . </li></ol></li><li> Entfernung der Affinitäts-Tags des rBC1531-Proteins durch Thrombin-Proteolyse <ol><li> Die Fraktionen in das Dialyse-Röhrchen pipettieren (Molekulargewichts-Cutoff: 3 kDa) und das Röhrchen in ein Becherglas geben, das 4 l Thrombinspalt-kompatiblen Puffer (20 mM HEPES, pH 7,4, 150 mM NaCl und 1,5 mM β-Mercaptoethanol) Bei 4 ° C über Nacht. </li><li> Die Fraktionen pipettieren und auf ein konisches Röhrchen übertragen. </li><li> Messen Sie die Extinktion bei 280 nm und schätzen Sie die rBC1531-Proteinkonzentration, wie beschrieben 13 . </li><li> Nehmen Sie 50 μg rBC1531 in ein 0,5 ml-Röhrchen und fügen Sie verschiedene Mengen an Thrombin ( dh 2, 1, 0,6 und 0,3 Einheiten) hinzu. Inkubieren Sie die rBC1531- und Thrombinreaktionen bei 20 ° C für ~ 3 h, um die geringste Menge an Thrombin zu bestimmen, die erforderlich ist, um das N-terminale Affinitäts-Tag zu spalten. </li><li> Führen Sie die rBC1531 und Thrombin Reaktionen auf eine 15%SDS-PAGE und bestimmen die niedrigste Menge an Thrombin ( z. B. 0,3 Einheiten Thrombin pro 50 μg rBC1531), die das N-terminale Affinitäts-Tag vollständig verdaut und ein tag-freies rBC1531 erzeugt. </li><li> Füge 10 mg rBC1531-Protein und 60 Einheiten Thrombin zu einem 15-ml-Röhrchen hinzu und inkubiere bei 20 ° C für ~ 3 h für die Thrombin-Proteolyse-Reaktion. </li><li> Wenden Sie Gel-Filtrationsstandards auf eine Größen-Ausschluss-Chromatographie (SEC) -Spalte an, um eine Standardkurve von Molekulargewichten und Elutionsvolumina herzustellen, wie beschrieben 13 . </li><li> Das Thrombin-verdaute rBC1531-Protein aus Schritt 1.4.6 in einem Zentrifugal-Filterröhrchen (Molekulargewichts-Cutoff: 3 kDa) platzieren und bei 3.000 g bei 4 ° C zentrifugieren, um auf ein Volumen von weniger als 5 ml zu reduzieren. </li><li> Das konzentrierte rBC1531-Protein in die SEC-Säule geben und 60 eluierte Fraktionen in 0,5 ml pro Röhrchen 13 sammeln. </li><li> Nehmen Sie 15 μl pro Fraktion, führen Sie sie auf einer 15% SDS-PAGE und staiN das Gel unter Verwendung der Coomassie-Färbelösung (0,15% (w / v) Coomassie-Brillantblau, 40% (v / v) Methanol und 10% (v / v) Eisessig) wie beschrieben 10 . </li><li> Pipettieren Sie die Fraktionen, die rBC1531 enthalten und sammeln sie in einem Tube. </li></ol></li></ol> 2. Kristallisations-Screening und Optimierung von rBC1531 <ol><li> Screening-Bedingungen für die rBC1531-Proteinkristallisation <ol><li> Konzentrieren Sie den rBC1531 von Schritt 1.4.11 bis zu ~ 18.5 mg / ml mit einem Zentrifugalfilterrohr, wie in Schritt 1.4.8 beschrieben. </li><li> Füge 50 μl jeder Kristallisations-Screening-Lösung (siehe Abschnitt 2.2) 14 zu den Vertiefungen von 96-Well-Sitzen-Tropfen-Kristallisationsplatten hinzu. Platzieren Sie 0,5 μl der 18,5 mg / ml rBC1531 Proteinlösung auf einem Sitzbett. Mischen Sie die Proteinlösung mit 0,5 μl der Bohrlochlösung und wiederholen Sie das Verfahren für die gesamte Platte. </li><li> Die Platte mit klarem Klebefilm bedecken.Die Platten mit 96 Vertiefungen auf 18 ° C stellen und Dampfdiffusion zulassen. </li><li> Scannen Sie die Tropfen bei 20-40facher Vergrößerung mit einem Lichtmikroskop, um die Kristallbildung täglich für 2-3 Wochen zu überwachen. </li><li> Sammeln Sie Röntgenbeugungsdaten 12 unter Verwendung der erhaltenen rBC1531-Proteinkristalle. </li></ol></li><li> Optimierung der rBC1531-Kristallisationsbedingungen <ol><li> Bereiten Sie 500 &amp; mgr; l der ausgewählten Anfangskristallisationsbedingungen-Lösung ( z. B. 0,1 M Natriumcacodylat, pH 6,5 und 1,0 M Natriumcitrat) vor und füllen Sie eine 24-Well-Kristallisationsplatte für den Sitztropfen. </li><li> Füge 0,5 μl der 18,5 mg / mL rBC1531-Proteinlösung zu einem Sitzbett hinzu, mischen mit 0,5 μl der Vertiefungslösung und decke die Platte sofort mit klarem Klebstofffilm ab. Legen Sie die Platte auf 18 ° C. </li><li> Beobachten Sie das Kristallwachstum unter einem Lichtmikroskop für eine Woche. </li><li> Optimieren Sie verschiedene Kristallisationsbedingungen durch Variieren des pH-Werts ( dh, PH 5,5-6,8) von 0,1 M Kacodylat und durch Veränderung der Salzkonzentration ( dh 0,9-1,2 M) Natriumcitrat , um Singularkristalle zu erhalten. Überwachen Sie das Kristallwachstum für 1 Woche und sammeln Sie Röntgenbeugungsdaten 12 . </li></ol></li></ol> 3. Charakterisierung der Nucleosid Triphosphatase (NTPase) Aktivität von rBC1531 <ol><li> Validierung der anorganischen Phosphat-abhängigen kolorimetrischen Studie <ol><li> Bereiten Sie einen Vorrat an Pyrophosphat (100 mM) vor und verdünnen Sie es auf Endkonzentrationen von 0,1, 0,25, 0,5, 1,0, 5,0, 10, 50, 100 und 250 &amp; mgr; M in 200 &amp; mgr; l Reaktionspuffer (20 mM HEPES, pH 7,4; MM NaCl und 2 mM MgCl &amp; sub2 ; ) in doppelten 96-Well-Platten. Benutze die erste Platte als Kontrolle (dies enthält keine Pyrophosphatase). Stellen Sie sicher, dass die zweite Platte Pyrophosphatase als Arbeitsplatte enthält, wie in Schritt 3.1.2 beschrieben. </li><li> Add 0.01 Einheit von Saccharomyces cerevisiae anorganischen pYrophosphatase (1 &amp; mgr; l) zu den Vertiefungen der Arbeitsplatte gegeben und bei 20 ° C für 30-60 min inkubiert. </li><li> Vorbereitung der Molybdatsäurelösung durch Mischen von Ammoniummolybdat (0,86% v / v) und Ascorbinsäure (14% v / v) Lösungen im Verhältnis 7: 3. Füge 16 μl Molybddsäurelösung sowohl den Arbeits- als auch den Kontrollvertiefungen zu und warte 15 min. </li><li> Lesen Sie die optische Dichte bei 690 nm (OD 690nm ). </li></ol></li><li> Farbmetrischer NTPase-Assay <ol><li> Vorbereiten eines Materials von 100 mM Nukleosidtriphosphat (NTP) -Substrat und Verdünnen auf die gewünschte Konzentration ( z. B. 0, 0,2, 4,4, 11, 22, 44, 88 oder 132 &amp; mgr; M) in 180 &amp; mgr; l Assaypuffer (20 mM HEPES, PH 7,4, 150 mM NaCl und 2 mM MgCl 2 ). </li><li> Fügen Sie 20 μg rBC1531 (1,5 mM) und die NTP-Substrate aus Schritt 3.2.1 bis zu 200 μL pro Reaktion in einer 96-Well-Platte hinzu und pipettieren Sie nach oben und unten, um gut zu mischen. Decken Sie die Platte mit dem Deckel ab und legen Sie sie in einen 37 ° C Inkubator für 30 minUm die Substrathydrolysereaktion durchzuführen. </li><li> Übertragen Sie die Platte auf ein 70 ° C Wasserbad und lassen Sie für 15 min stehen, um rBC1531-vermittelte katalytische Reaktionen zu stoppen. </li><li> Füge 0,01 Einheiten von S. cerevisiae anorganische Pyrophosphatase (1 μL) zu jeder Vertiefung der Reaktionsplatte (aus Schritt 3.2.3) hinzu und inkubiere bei 20 ° C für 30 min. Füge 16 μl Molybddsäurelösung zur Reaktionsplatte hinzu, um die Farbe zu entwickeln (~ 15 min). Lesen Sie bei OD 690nm . </li><li> Analysieren mit der Michaelis-Menten-Gleichung, wie beschrieben 12 . </li></ol></li></ol>

<ol>
	<li>Ivanova, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+Bacillus+cereus+and+comparative+analysis+with+Bacillus+anthracis.">Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis.</a> Nature. 423, 87-91 (2003).</li><li>Spencer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacillus+anthracis.">Bacillus anthracis.</a> J Clin Pathol. 56, 182-187 (2003).</li><li>Deli, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LmbE+proteins+from+Bacillus+cereus+are+de-N-acetylases+with+broad+substrate+specificity+and+are+highly+similar+to+proteins+in+Bacillus+anthracis.">LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis.</a> FEBS J. 277, 2740-2753 (2010).</li><li>Gross, M., Marianovsky, I., Glaser, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MazG+--+a+regulator+of+programmed+cell+death+in+Escherichia+coli.">MazG -- a regulator of programmed cell death in Escherichia coli.</a> Mol Microbiol. 59, 590-601 (2006).</li><li>Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=House+cleaning,+a+part+of+good+housekeeping.">House cleaning, a part of good housekeeping.</a> Mol Microbiol. 59, 5-19 (2006).</li><li>Lee, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+Escherichia+coli+MazG,+the+regulator+of+nutritional+stress+response.">Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response.</a> J Biol Chem. 283, 15232-15240 (2008).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimeric+dUTPases,+HisE,+and+MazG+belong+to+a+new+superfamily+of+all-alpha+NTP+pyrophosphohydrolases+with+potential+&amp;#34;house-cleaning&amp;#34;+functions.">Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential &amp;#34;house-cleaning&amp;#34; functions.</a> J Mol Biol. 347, 243-255 (2005).</li><li>Robinson, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+putative+house-cleaning+enzyme+encoded+within+an+integron+array:+1.8+A+crystal+structure+defines+a+new+MazG+subtype.">A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype.</a> Mol Microbiol. 66, 610-621 (2007).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+crystal+structure+of+a+complex+of+Campylobacter+jejuni+dUTPase+with+substrate+analogue+sheds+light+on+the+mechanism+and+suggests+the+&amp;#34;basic+module&amp;#34;+for+dimeric+d(C/U)TPases.">The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the &amp;#34;basic module&amp;#34; for dimeric d(C/U)TPases.</a> J Mol Biol. 342, 1583-1597 (2004).</li><li>Green, M., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning: A laboratory Manual. 1, (2012).</li><li>Brown, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Gene cloning an introduction. , (1986).</li><li>Kim, M. I., Hong, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Bacillus-conserved+MazG+protein,+a+nucleotide+pyrophosphohydrolase.">Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase.</a> Biochem Biophys Res Commun. 472, 237-242 (2016).</li><li>Sheehan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Physical biochemistry: Principles and applications. , (2009).</li><li>Lesley, S. A., Wilson, I. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+and+crystallization+at+the+joint+center+for+structural+genomics.">Protein production and crystallization at the joint center for structural genomics.</a> J Struct Funct Genomics. 6, 71-79 (2005).</li><li>Jeon, Y. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+biochemical+characterization+of+bacterial+YpgQ+protein+reveals+a+metal-dependent+nucleotide+pyrophosphohydrolase.">Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase.</a> J Struct Biol. 195, 113-122 (2016).</li></ol>

Die Autoren haben nichts zu offenbaren.

Studies of true pathogens are limited due to safety restrictions and regulations. Alternatively, pathogens can be studied using evolutionarily related non-pathogens or less pathogenic species. The ba1554 gene is considered a critical gene in B. anthracis. Fortunately, an identical gene is present in nonclinical B. cereus. Thus, without serious safety concerns, recombinant BC1531 protein can be used for biophysical and enzymatic characterization. Here, we described detailed procedures, moving fr...

Rekombinante Proteinexpression ist weit verbreitet, um Probleme zu lösen, die mit natürlichen Proteinquellen verbunden sind, wie z. B. begrenzte Proteinmengen und schädliche Kontamination. Darüber hinaus kann bei Studien von pathogenen Genen und Proteinen eine alternative Laborstämme, die keine zusätzlichen Sicherheitsvorkehrungen erfordern, genutzt werden. Zum Beispiel ist Bacillus cereus ein nützliches Modell für das Studium der Bacillus anthracis aufgrund ihrer engen evolutionären Beziehung 1 . B. anthracis ist ein obligativer Erreger, der bei Menschen und Vieh tödlichen inhalativen Milzbrand verursacht und potentiell als Biowaffen verwendet werden kann 2 . So werden Laboruntersuchungen an B. anthracis streng von den US-Zentren für die Krankheitsbekämpfung geregelt, die Biosicherheitsstufe 3 (BSL-3) Praktiken erfordern, die behaupten, dass der Laborbereich mit negativem Raumdruck getrennt wird. Im Gegensatz zu B. anthracis </eM&gt;, B. cereus wird als BSL-1-Agent kategorisiert und hat daher minimale Sicherheitsbedenken. B. cereus ist ein opportunistischer Erreger, der bei der Infektion eine Lebensmittelvergiftung verursacht, die ohne medizinische Hilfe behandelt werden kann. Da aber B. cereus viele kritische Gene mit B. anthracis teilt , können die Funktionen von B. anthracis-Proteinen mit den entsprechenden Homologen von B. cereus 1 untersucht werden. Der ba1554 - ba1558 - Gencluster von B. anthracis ist mit dem bc1531 - bc1535 - Cluster hoch konserviert Von B. cereus , sowie mit dem bt1364-bt1368- Cluster von Bacillus thuringiensis , in Bezug auf Genorganisation und Sequenz. Weiterhin sind die ersten Gene ( ba1554 , bc1531 und bt1364 ) der jeweiligen Cluster absolut konserviert ( dh 100% Nukleotidsequenzidentität), implyiEine kritische Rolle des Genprodukts in der Bacillus- Spezies. Aufgrund seiner Lage in diesen Genclustern wurde ba1554 als mutmaßlicher Transkriptionsregulator 3 identifiziert. Die Aminosäuresequenzanalyse des ba1554- Produkts zeigt jedoch an, dass es zur MazG-Familie gehört, die eine Nukleotid-Pyrophosphohydrolase-Aktivität aufweist und nicht mit der Transkriptionsfaktor-Aktivität 4 , 5 assoziiert ist. Obwohl Proteine, die zur MazG-Familie gehören, in Bezug auf die Gesamtsequenz und -länge verschieden sind, teilen sie eine gemeinsame MazG-Domäne von 100 Resten, die durch ein EXXE 12-28 EXXD-Motiv charakterisiert ist (&quot;X&quot; steht für jeden Aminosäurerest und die Zahl Gibt die Anzahl der X-Reste an). Die MazG-Domäne berücksichtigt nicht immer eine bestimmte katalytische Aktivität. Ein MazG-Mitglied aus Escherichia coli (EcMazG) besitzt zwei MazG-Domänen, aber aufDie C-terminale MazG-Domäne ist enzymatisch aktiv 6 . Darüber hinaus variiert die Substratspezifität von MazG-Enzymen von unspezifischen Nukleosidtriphosphaten (für EcMazG) bis zu spezifischem dCTP / dATP (für Integrin-assoziiertes MazG) und dUTP (für dUTPasen) 6 , 7 , 8 , 9 . Daher sind biophysikochemische Analysen des BA1554-Proteins notwendig, um seine NTPase-Aktivität zu bestätigen und seine Substratspezifität zu entschlüsseln. Hier stellen wir ein Schritt-für-Schritt-Protokoll zur Verfügung, dass die meisten Laboratorien ohne BSL-3-Anlage folgen können, um das Proteinprodukt des B. cereus bc1531- Gens zu charakterisieren , das ein Orthologe von B. anthracis ba1554 auf molekularer Ebene ist. Kurz gesagt wurde rekombinantes BC1531 (rBC1531) in E. coli exprimiert und unter Verwendung eines Affinitätsmarkens gereinigt. Für kristallographische Röntgenuntersuchungen wurden die kristallinenZationsbedingungen des rBC1531-Proteins wurden gesiebt und optimiert. Um die enzymatische Aktivität von rBC1531 zu beurteilen, wurde die NTPase-Aktivität kolorimetrisch überwacht, um radioaktiv markierte Nukleotide zu vermeiden, die herkömmlicherweise verwendet wurden. Schließlich ermöglichten die Analysen der erhaltenen biophysikalisch-chemischen Daten, den Oligomerisierungszustand und die katalytischen Parameter von rBC1531 zu bestimmen sowie Röntgenbeugungsdaten aus dem rBC1531-Kristall zu erhalten.

<table><tbody><tr><td>&lt;em&gt;Bacillus cereus&lt;/em&gt; ATCC14579</td><td>Korean Collection for Tissue Culture</td><td>3624</td><td></td></tr><tr><td>Genomic DNA prep kit</td><td>GeneAll</td><td>106-101</td><td>Genomic DNA preparation</td></tr><tr><td>Forward primer</td><td>Macrogen</td><td>GAAGGATCCGGAAGCAAAAA&lt;br/&gt; CGATGAAAGATATGCA</td><td>&lt;em&gt;Bam&lt;/em&gt;HI site is underlined</td></tr><tr><td>Reverse primer</td><td>Macrogen</td><td>CTTGTCGACTTATTCTTTCTCT&lt;br/&gt; CCCTCATCAATACGTG</td><td>&lt;em&gt;Sal&lt;/em&gt;I site is underlined</td></tr><tr><td>nPfu-Forte</td><td>Enzynomics</td><td>P410</td><td>PCR polymerase</td></tr><tr><td>&lt;em&gt;Bam&lt;/em&gt;HI</td><td>Enzynomics</td><td>R003S</td><td></td></tr><tr><td>&lt;em&gt;Sal&lt;/em&gt;I</td><td>Enzynomics</td><td>R009S</td><td></td></tr><tr><td>pET49b expression vector</td><td>Novagen</td><td>71463</td><td>Expression vector was modified to add affinity tags and BamHI/SalI sites&lt;sup&gt;10&lt;/sup&gt;</td></tr><tr><td>T4 DNA ligase</td><td>Enzynomics</td><td>M001S</td><td></td></tr><tr><td>Dialysis memebrane</td><td>Thermofisher</td><td>18265017</td><td></td></tr><tr><td>Dry block heater</td><td>JSR</td><td>JSBL-02T</td><td></td></tr><tr><td>LB broth (Luria-Bertani)</td><td>LPS solution</td><td>LB-05</td><td></td></tr><tr><td>LB Agar, Miller (Luria-Bertani)</td><td>Becton, Dickinson and Company</td><td></td><td></td></tr><tr><td>Kanamycin</td><td>LPS solution</td><td>KAN025</td><td></td></tr><tr><td>Mini-prep kit</td><td>Favorgen</td><td>FAPDE300</td><td>Plasmid DNA preparation</td></tr><tr><td>BL21(DE3) Competent cell</td><td>Novagen</td><td>69450-3CN</td><td></td></tr><tr><td>Isopropyl &amp;beta;-D-1-thiogalactopyranoside (IPTG)</td><td>Fisher BioReagents</td><td>50-213-378</td><td></td></tr><tr><td>Sodium chloride</td><td>Daejung</td><td>7548-4100</td><td>PBS material</td></tr><tr><td>Potassium chloride</td><td>Daejung</td><td>6566-4405</td><td>PBS material</td></tr><tr><td>Potassium phosphate</td><td>Bio Basic Inc</td><td>PB0445</td><td>PBS material</td></tr><tr><td>Sodium phosphate</td><td>Bio Basic Inc</td><td>S0404</td><td>PBS material</td></tr><tr><td>Imidazole</td><td>Bio Basic Inc</td><td>IB0277</td><td></td></tr><tr><td>Sonicator</td><td>Sonics</td><td>VCX 130</td><td></td></tr><tr><td>Ni-NTA agaros</td><td>Qiagen</td><td>30210</td><td>Nickel bead</td></tr><tr><td>Rotator</td><td>Finepcr</td><td>AG</td><td></td></tr><tr><td>Precision Plus Protein Dual Color Standards</td><td>Bio-rad</td><td>1610374</td><td>SDS-PAGE protein standard</td></tr><tr><td>Coonmassie Brilliant Blue R-250</td><td>Fisher BioReagents</td><td>BP101-25</td><td>Coomassie staining solution</td></tr><tr><td>Methyl alcohol</td><td>Samchun chemical</td><td>M0585</td><td>Coomassie staining solution</td></tr><tr><td>Acetic acid</td><td>Daejung</td><td>1002-4105</td><td>Coomassie staining solution</td></tr><tr><td>Dialysis memebrane</td><td>Thermofisher</td><td>68035</td><td></td></tr><tr><td>2-Mercaptoethanol</td><td>Sigma-aldrich</td><td>M6250</td><td></td></tr><tr><td>Thrombin</td><td>Merckmillipore</td><td>605157-1KUCN</td><td>Prepare aliquots of 20 &amp;mu;L (1 Unit per &amp;mu;L) and store at 70 &amp;deg;C and thaw before use</td></tr><tr><td>Superdex 200 16/600</td><td>General Electric</td><td>28989335</td><td>Size exclusion chromatography</td></tr><tr><td>Gel filtration standard</td><td>Bio-rad</td><td>151-1901</td><td></td></tr><tr><td>Centrifugal filter</td><td>Amicon</td><td>UFC800396</td><td></td></tr><tr><td>Crystralization plates</td><td>Hampton research</td><td>HR3-083</td><td>96-well sitting drop plate</td></tr><tr><td>The JCSG core suite I-IV</td><td>Qiagen</td><td>130924-130927</td><td>Crystallization secreening solution</td></tr><tr><td>Microscope</td><td>Nikon</td><td>SMZ745T</td><td></td></tr><tr><td>Cryschem plates</td><td>Hampton research</td><td>HR3-158</td><td>24-well sitting drop plate</td></tr><tr><td>Inorganic pyrophosphatase</td><td>Sigma</td><td>10108987001</td><td></td></tr><tr><td>Ammonium molybdate solution</td><td>Sigma</td><td>13106-76-8</td><td></td></tr><tr><td>L-ascorbic acid</td><td>Sigma</td><td>50-81-7</td><td></td></tr><tr><td>NTP substrate</td><td>Startagene</td><td>200415-51</td><td></td></tr><tr><td>Spectrophotometer</td><td>Biotek</td><td>SynergyH1</td><td>microplate reader</td></tr><tr><td>GraphPad Prism 5</td><td>GraphPad</td><td>Prism 5 for Window</td><td></td></tr></tbody></table>

recombinant protein expression, crystallization, and biophysical studies of a bacillus-conserved nucleotide pyrophosphorylase, bcmazg

Zur Überwindung von Sicherheitsbeschränkungen und -regelungen beim Studium von Genen und Proteinen aus echten Pathogenen können ihre Homologen untersucht werden. Bacillus anthracis ist ein obligativer Erreger, der tödliche inhalative Milzbrand verursacht. Bacillus cereus gilt als ein nützliches Modell für das Studium B. anthracis aufgrund seiner engen evolutionären Beziehung. Der Gencluster ba1554 - ba1558 von B. anthracis ist mit dem bc1531 - bc1535 - Cluster in B. cereus sowie mit dem bt1364 - bt1368 - Cluster in Bacillus thuringiensis hoch konserviert, was die kritische Rolle der assoziierten Gene in der Bacillus - Gattung anzeigt. Dieses Manuskript beschreibt Verfahren zur Herstellung und Charakterisierung eines Proteinprodukts des ersten Gens ( ba1554 ) aus dem Gencluster in B. anthracis unter Verwendung eines rekombinanten Proteins seines Orthologen in B. cereus , bc1531.

Die Charakterisierung des Proteins von Interesse in dieser Studie begann mit der Herstellung einer ausreichenden Menge an rekombinantem B. cereus bc1531 (rBC1531) Protein, vorzugsweise mehr als mehrere Milligramm. Das DNA-Fragment, das für das BC1531-Protein kodiert, wurde durch PCR unter Verwendung der genomischen DNA von B. cereus als Matrize hergestellt, da es orthologe Gene enthält, die mit ba1554 identisch sind . RBC1531 wurde als lösliches Protein in <...

Watch this Scientific Journal Video about Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG at JoVE.com

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Bacillus anthracis ist der obligatorische Erreger der tödlichen Inhalations-Milzbrand, so dass Studien über seine Gene und Proteine ​​streng reguliert sind. Ein alternativer Ansatz ist es, orthologe Gene zu untersuchen. Wir beschreiben biophysikochemische Studien eines B. anthracis ortholog in B. cereus , bc1531, die minimale experimentelle Ausrüstung erfordern und keine ernsthaften Sicherheitsbedenken haben.

Rekombinante Protein Expression, Kristallisation und biophysikalische Studien von a<em&gt; Bacillus</em&gt; -konservierte Nucleotid-Pyrophosphorylase, BcMazG

To overcome safety restrictions and regulations when studying genes and proteins from true pathogens, their homologues can be studied. Bacillus anthracis ...

recombinant-protein-expression-crystallization-biophysical-studies

Universidad de Cartagena UDEC

Research

JoVE Journal

Biochemistry

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

7.4K Aufrufe.  Yonsei University.  Bacillus anthracis ist der obligatorische Erreger der tödlichen Inhalations-Milzbrand, so dass Studien über seine Gene und Proteine ​​streng reguliert sind. Ein alternativer Ansatz ist es, orthologe Gene zu untersuchen. Wir beschreiben biophysikochemische Studien eines B. anthracis ortholog in B. cereus , bc1531, die minimale experimentelle Ausrüstung erfordern und keine ernsthaften Sicherheitsbedenken haben. 

Serie: Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a target for future development of inhibitors to decrease the virulence of the pathogen. To perform biophysical and structural characterization as well as inhibitor screening, large amounts of pure and active protein will be needed. We have developed a protocol for efficient production and purification of PPEP-1 by the use of E. coli as the expression host yielding sufficient amounts and purity of protein for crystallization and structure determination. Additionally, using microseeding, highly intergrown crystals of PPEP-1 can be grown to well-ordered crystals suitable for X-ray diffraction analysis. The methods could also be used to produce other recombinant proteins and to study the structures of other proteins producing intergrown crystals.

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

Proline-proline endopeptidase-1 (PPEP-1) is a secreted metalloprotease and promising drug-target from the human pathogen Clostridium difficile. Here we describe all methods necessary for the production and structure determination of this protein.

Produktion, Kristallisation und Strukturbestimmung<em&gt; C. difficile</em&gt; PPEP-1 über Microseeding und Zink-SAD

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a ...

Forschung

Biochemie

Microcrystallography of Protein Crystals and In Cellulo Diffraction

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in their largest dimension, which used to represent a challenge. We present two alternative workflows for the structure determination of protein microcrystals by X-ray crystallography with a particular focus on crystals grown in vivo. The microcrystals are either extracted from cells by sonication and purified by differential centrifugation, or analyzed in cellulo after cell sorting by flow cytometry of crystal-containing cells. Optionally, purified crystals or crystal-containing cells are soaked in heavy atom solutions for experimental phasing. These samples are then prepared for diffraction experiments in a similar way by application onto a micromesh support and flash cooling in liquid nitrogen. We briefly describe and compare serial diffraction experiments of isolated microcrystals and crystal-containing cells using a microfocus synchrotron beamline to produce datasets suitable for phasing, model building and refinement.
These workflows are exemplified with crystals of the Bombyx mori cypovirus 1 (BmCPV1) polyhedrin produced by infection of insect cells with a recombinant baculovirus. In this case study, in cellulo analysis is more efficient than analysis of purified crystals and yields a structure in ~8 days from expression to refinement.

Microcrystallography of Protein Crystals and In Cellulo Diffraction

A protocol is presented for X-ray crystallography using protein microcrystals. Two examples analyzing in vivo-grown microcrystals after purification or in cellulo are compared.

Mikrokristallographie von Proteinkristallen und<em&gt; In Cellulo</em&gt; Beugung

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in ...

Expression and Purification of Mammalian Bestrophin Ion Channels

The human genome encodes four bestrophin paralogs, namely BEST1, BEST2, BEST3, and BEST4. BEST1, encoded by the BEST1 gene, is a Ca2+-activated Cl- channel (CaCC) predominantly expressed in retinal pigment epithelium (RPE). The physiological and pathological significance of BEST1 is highlighted by the fact that over 200 distinct mutations in the BEST1 gene have been genetically linked to a spectrum of at least five retinal degenerative disorders, such as Best vitelliform macular dystrophy (Best disease). Therefore, understanding the biophysics of bestrophin channels at the single-molecule level holds tremendous significance. However, obtaining purified mammalian ion channels is often a challenging task. Here, we report a protocol for the expression of mammalian bestrophin proteins with the BacMam baculovirus gene transfer system and their purification by affinity and size-exclusion chromatography. The purified proteins have the potential to be utilized in subsequent functional and structural analyses, such as electrophysiological recording in lipid bilayers and crystallography. Importantly, this pipeline can be adapted to study the functions and structures of other ion channels.

The purification of ion channels is often challenging, but once achieved, it can potentially allow in vitro investigations of the functions and structures of the channels. Here, we describe the stepwise procedures for the expression and purification of mammalian bestrophin proteins, a family of Ca2+-activated Cl- channels.

Ausdruck und Reinigung von Säugetieren Bestrophin Ionenkanäle

The human genome encodes four bestrophin paralogs, namely BEST1, BEST2, BEST3, and BEST4. BEST1, encoded by the BEST1 gene, is a Ca2+-activated Cl- ...

Multi-target Parallel Processing Approach for Gene-to-structure Determination of the Influenza Polymerase PB2 Subunit

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States alone, an average of 41,400 deaths and 1.86 million hospitalizations are caused by influenza virus infection each year 1. Point mutations in the polymerase basic protein 2 subunit (PB2) have been linked to the adaptation of the viral infection in humans 2. Findings from such studies have revealed the biological significance of PB2 as a virulence factor, thus highlighting its potential as an antiviral drug target.
The structural genomics program put forth by the National Institute of Allergy and Infectious Disease (NIAID) provides funding to Emerald Bio and three other Pacific Northwest institutions that together make up the Seattle Structural Genomics Center for Infectious Disease (SSGCID). The SSGCID is dedicated to providing the scientific community with three-dimensional protein structures of NIAID category A-C pathogens. Making such structural information available to the scientific community serves to accelerate structure-based drug design.
Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for new lead discovery by targeting a pathway or an entire protein family. Emerald Bio has developed a high-throughput, multi-target parallel processing pipeline (MTPP) for gene-to-structure determination to support the consortium. Here we describe the protocols used to determine the structure of the PB2 subunit from four different influenza A strains.

Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for lead discovery. The following article highlights how the Seattle Structural Genomics Center for Infectious Disease utilizes a multi-target approach for gene-to-structure determination of the PB2 influenza A subunit.

Multi-Target-Parallel Processing Ansatz zur Gene-to-Struktur Bestimmung der Influenza Polymerase PB2-Untereinheit

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States ...

Immunologie und Infektion

Expression and Purification of the Human Lipid-sensitive Cation Channel TRPC3 for Structural Determination by Single-particle Cryo-electron Microscopy

Transient receptor potential channels (TRPCs) of the canonical TRP subfamily are nonselective cation channels that play an essential role in calcium homeostasis, particularly store-operated calcium entry, which is critical to maintaining proper function of synaptic vesicle release and intracellular signaling pathways. Accordingly, TRPC channels have been implicated in a variety of human diseases including cardiovascular disorders such as cardiac hypertrophy, neurodegenerative disorders such as Parkinson&#39;s disease, and neurologic disorders such as spinocerebellar ataxia. Therefore, TRPC channels represent a potential pharmacologic target in human diseases. However, the molecular mechanisms of gating in these channels are still unclear. The difficulty in obtaining large quantities of stable, homogeneous, and purified protein has been a limiting factor in structure determination studies, particularly for mammalian membrane proteins such as the TRPC ion channels. Here, we present a protocol for the large-scale expression of mammalian ion channel membrane proteins using a modified baculovirus gene transfer system and the purification of these proteins by affinity and size-exclusion chromatography. We further present a protocol to collect single-particle cryo-electron microscopy images from purified protein and to use these images to determine the protein structure. Structure determination is a powerful method for understanding the mechanisms of gating and function in ion channels.

This protocol describes techniques used to determine ion channel structures by cryo-electron microscopy, including a baculovirus system used to efficiently express genes in mammalian cells with minimum effort and toxicity, protein extraction, purification, and quality checking, sample grid preparation and screening, as well as data collection and processing.

Ausdruck und Reinigung des menschlichen Lipid-Sensitive kation Kanal TRPC3 für die Strukturaufklärung von Single-Teilchen Kryo-Elektronenmikroskopie

Transient receptor potential channels (TRPCs) of the canonical TRP subfamily are nonselective cation channels that play an essential role in calcium ...

Production of Recombinant PRMT Proteins using the Baculovirus Expression Vector System

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. PRMTs can either mono- or dimethylate arginine guanidino groups symmetrically or asymmetrically. The enzymology of these proteins is a complex and intensely investigated area that requires milligram quantities of high-quality recombinant protein. The baculovirus expression vector system (BEVS) employing Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and Spodoptera frugiperda 9 (Sf9) insect cells has been used for expression screening and production of many PRMTs, including PRMT 1, 2, and 4 through 9. To simultaneously screen for the expression of multiple constructs of these proteins, including domains and truncated fragments as well as the full-length proteins, we have applied scalable methods utilizing adjustable and programmable multichannel pipettes, combined with 24- and 96-well plates and blocks. Overall, these method adjustments enabled a large-scale generation of bacmid DNA, recombinant viruses, and protein expression screening. Using culture vessels with a high-fill volume of Sf9 cell suspension helped to overcome space limitations in the production pipeline for single batch large-scale protein production. Here, we describe detailed protocols for the efficient and cost-effective expression of functional PRMTs for biochemical, biophysical, and structural studies.

The baculovirus expression vector system (BEVS) is a robust platform for expression screening and production of protein arginine methyltransferases (PRMTs) to be used for biochemical, biophysical, and structural studies. Milligram quantities of material can be produced for the majority of PRMTs and other proteins of interest requiring a eukaryotic expression platform.

Herstellung rekombinanter PRMT-Proteine unter Verwendung des Baculovirus Expression Vector System

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. ...

Phage Phenomics: Physiological Approaches to Characterize Novel Viral Proteins

Current investigations into phage-host interactions are dependent on extrapolating knowledge from (meta)genomes. Interestingly, 60 - 95% of all phage sequences share no homology to current annotated proteins. As a result, a large proportion of phage genes are annotated as hypothetical. This reality heavily affects the annotation of both structural and auxiliary metabolic genes. Here we present phenomic methods designed to capture the physiological response(s) of a selected host during expression of one of these unknown phage genes. Multi-phenotype Assay Plates (MAPs) are used to monitor the diversity of host substrate utilization and subsequent biomass formation, while metabolomics provides bi-product analysis by monitoring metabolite abundance and diversity. Both tools are used simultaneously to provide a phenotypic profile associated with expression of a single putative phage open reading frame (ORF). Representative results for both methods are compared, highlighting the phenotypic profile differences of a host carrying either putative structural or metabolic phage genes. In addition, the visualization techniques and high throughput computational pipelines that facilitated experimental analysis are presented.

Here, we present phenomic approaches for the functional characterization of putative phage genes. Techniques include a developed assay capable of monitoring host anabolic metabolism, the Multi-phenotype Assay Plates (MAPs), in addition to the established method of metabolomics, capable of measuring effects to catabolic metabolism.

Phage Phenomics: Physiologische Ansätze zur Charakterisierung Novel virale Proteine

Current investigations into phage-host interactions are dependent on extrapolating knowledge from (meta)genomes. Interestingly, 60 - 95% of all phage ...

Kristallisation von ABC-Transporter-Membranproteinen in lipidischen Bizellen

ABCG5/G8 Crystallization in a Lipidic Bicelle Environment for X-Ray Crystallography

ATP-binding cassette (ABC) transporters constitute lipid-embedded membrane proteins. Extracting these membrane proteins from the lipid bilayer to an aqueous environment is typically achieved by employing detergents. These detergents disintegrate the lipid bilayer and solubilize the proteins. The intrinsic habitat of membrane proteins within the lipid bilayer poses a challenge in maintaining their stability and uniformity in solution for structural characterization. Bicelles, which comprise a blend of long and short-chain phospholipids and detergents, replicate the natural lipid structure. The utilization of lipid bicelles and detergents serves as a suitable model system for obtaining high-quality diffraction crystals, specifically to determine the high-resolution structure of membrane proteins. Through these synthetic microenvironments, membrane proteins preserve their native conformation and functionality, facilitating the formation of three-dimensional crystals. In this approach, the detergent-solubilized heterodimeric ABCG5/G8 was reintegrated into DMPC/CHAPSO bicelles, supplemented with cholesterol. This setup was employed in the vapor diffusion experimental procedure for protein crystallization.

Autor im Rampenlicht: Ein Bicelle-Kristallisationsaufbau für ABC-Transporter-Membranproteine zur Förderung der Arzneimittelentwicklung 

This protocol describes a setup for the crystallization of the sterol transporter ABCG5/G8. ABCG5/G8 is reconstituted into bicelles for hanging-drop crystallization. The protocol does not require specialized materials or substrates, making it accessible and easy to adapt in any laboratory for determining the protein structure through X-ray crystallography.

ABCG5/G8-Kristallisation in einer lipidischen Bizellenumgebung für die Röntgenkristallographie

ATP-binding cassette (ABC) transporters constitute lipid-embedded membrane proteins. Extracting these membrane proteins from the lipid bilayer to an ...

Rekombinante Protein Expression, Kristallisation und biophysikalische Studien von a

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Produktion, Kristallisation und Strukturbestimmung

Mikrokristallographie von Proteinkristallen und

Ausdruck und Reinigung von Säugetieren Bestrophin Ionenkanäle

Multi-Target-Parallel Processing Ansatz zur Gene-to-Struktur Bestimmung der Influenza Polymerase PB2-Untereinheit

Ausdruck und Reinigung des menschlichen Lipid-Sensitive kation Kanal TRPC3 für die Strukturaufklärung von Single-Teilchen Kryo-Elektronenmikroskopie

Herstellung rekombinanter PRMT-Proteine unter Verwendung des Baculovirus Expression Vector System

Phage Phenomics: Physiologische Ansätze zur Charakterisierung Novel virale Proteine

ABCG5/G8-Kristallisation in einer lipidischen Bizellenumgebung für die Röntgenkristallographie

ABCG5/G8-Kristallisation in einer lipidischen Bizellenumgebung für die Röntgenkristallographie

ABCG5/G8-Kristallisation in einer lipidischen Bizellenumgebung für die Röntgenkristallographie