This research was funded by the National Natural Science Foundation of China (31870637, 31200487) and jointly funded by the Zhejiang Key Research Plan (2019C02024, LGN22C160004).

The study was approved by the council for animal experimentation of Zhejiang Agricultural &#38; Forestry University. The B. xylophilus isolate NXY61 was originally extracted from a diseased Pinus massoniana in the Ningbo area of Zhejiang province, China11.
1. Gene cloning
NOTE: See the Table of Materials for details about the primers used in this protocol.
<ol>
	<li>Collect nematodes.
	<ol>
		<li>Culture the B. xylophilus strain on the mycelia of Botrytis cinerea on Potato Dextrose Agar (PDA) plates at 25 &#176;C for 3-5 days.</li>
		<li>Collect the nematodes using the Bellman funnel method14.
		<ol>
			<li>Place a clamped rubber tube below a funnel and place two layers of filter paper in the mouth of the funnel. Transfer the fungal cultures to the funnel and add water to immerse the fungal mat. Wait for 2 h, then collect the nematodes.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Extract the total RNA from the nematodes using a total RNA extraction reagent (see the Table of Materials)11 according to the following steps.
	<ol>
		<li>Add 500 &#181;L of extraction reagent and 100 &#181;L of magnetic beads to a 2 mL centrifuge tube. Aspirate 20 &#181;L of the nematodes and transfer the sample to a grinder for grinding at 9,000 &#215; g for 30 s. Incubate for 5 min and then centrifuge for 10 min at 12,000 &#215; g and 4 &#176;C.</li>
		<li>Transfer the supernatant to a new centrifuge tube. Add 100 &#181;L of chloroform, cap the tube, and mix by inverting the tube several times. Incubate for 3 min and then centrifuge for 10 min at 12,000 &#215; g at 4 &#176;C.</li>
		<li>Transfer the supernatant to a new centrifuge tube. Add 250 &#181;L of isopropyl alcohol and vortex vigorously. Centrifuge at 12,000 &#215; g for 10 min.&#160;</li>
		<li>Discard the supernatant. Add 500 &#181;L of 75% ethanol to wash the RNA and then vortex the sample. Centrifuge it for 5 min at 12,000 &#215; g and 4 &#176;C.</li>
		<li>Air-dry the RNA pellet for 5 min.</li>
		<li>Resuspend the pellet in 30 &#181;L of RNase-free water.</li>
		<li>Calculate the RNA concentration using the formula: A260 &#215; dilution &#215; 40 = &#181;g RNA/mL. Calculate the A260/A280 ratio. 
		&#8203;NOTE: A ratio of ~2 is considered pure.</li>
	</ol>
	</li>
	<li>Perform reverse transcription of good quality RNA to obtain the cDNA template.
	<ol>
		<li>Design and use a pair of specific primers, ppm-1-F/R (see the Table of Materials), to amplify the partial coding sequence of the Bx-ppm-1 gene in B. xylophilus (GenBank accession number QTZ96795).</li>
		<li>Clone the ppm-1 gene sequences into the pGEM-Teasy vector containing the T7 promoter following a standard cloning protocol11.
		<ol>
			<li>Set up the PCR reactions as follows: 2 &#181;L of cDNA, 25 &#181;L of 2x Ex Taq Polymerase Premix, 2 &#181;L of each primer (10 pmol/l), and sterile distilled water to a final volume of 50 &#181;L.</li>
			<li>Perform the amplification procedure as follows: 5 min at 94 &#176;C; followed by 35 cycles of 30 s at 94 &#176;C, 30 s at 55 &#176;C, and 1 min at 72 &#176;C; and a final extension step at 72 &#176;C for 5 min.</li>
			<li>Clone the amplified products into a pGEM-T Easy vector for sequencing.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
2. Synthesis of dsRNA
<ol>
	<li>Prepare the DNA template for dsRNA synthesis using PCR with primers designed to add T7 promoter sites at both ends. Add the T7 promoter sequence to the 5&#39; end of the primers.</li>
	<li>Use the plasmid containing the ppm-1 gene fragment (894 bp) as the template for PCR and recover the fragment containing the T7 promoter11. Use the PCR procedure and system described above.</li>
	<li>Use an in vitro transcription kit to synthesize dsRNA11.
	<ol>
		<li>Thaw the frozen reagents on ice.</li>
		<li>Add 2 &#181;L of 10x reaction buffer, 2 &#181;L of enzyme mix, and 1 &#181;g of DNA to a centrifuge tube. Add nuclease-free water to produce a standard 4 &#181;L reaction. Then, mix equal volumes of the four ribonucleotide solutions (ATP, CTP, GTP, and UTP) together and add 8 &#181;L of the mixture to the tube. Mix thoroughly and incubate at 37 &#176;C for 4 h.</li>
		<li>Add 1 &#181;L of DNase, mix well, and incubate for 15 min at 37 &#176;C.</li>
		<li>Stop the reaction and add 30 &#181;L of nuclease-free water and 30 &#181;L of LiCl precipitation solution to precipitate the RNA. Mix thoroughly. Incubate at -20 &#176;C overnight.</li>
		<li>Centrifuge for 15 min at 12,000 &#215; g and 4 &#176;C. Discard the supernatant.</li>
		<li>Add 1 mL of 75% ethanol to wash the RNA. Vortex the sample and centrifuge it for 10 min at 12,000 &#215; g and 4 &#176;C.</li>
		<li>Air-dry the RNA pellet for 3 min.</li>
		<li>Resuspend the pellet in 30 &#181;L of RNase-free water.</li>
		<li>Analyze the quality of the dsRNA using a spectrophotometer. Pipette 1 &#181;L of the dsRNA sample onto the measurement pedestal and set the wavelength to 340 nm. Visualize the products on a 1.0% agarose gel.</li>
	</ol>
	</li>
</ol>
3. RNAi by soaking
<ol>
	<li>Mix 4 &#181;L of 5x soaking buffer (0.05% gelatin, 5.5 mM KH2PO4, 2.1 mM NaCl, 4.7 mM NH4Cl, 3 mM spermidine) with the dsRNA and ddH2O to produce a total volume of 20 &#181;L and a final RNA concentration of 0.8 &#181;g/mL.</li>
	<li>Acquire J2 larvae.
	<ol>
		<li>Collect the nematodes from the fungal cultures and transfer them to a glass Petri dish 6 cm in diameter. Add 10 mL of water to the dish to ensure that the nematodes can swim freely. Keep the nematodes in the dish for 30 min and wait for the eggs to adhere to the bottom.</li>
		<li>Remove the water and nematodes carefully, making sure not to disturb the eggs. Repeat the steps until all the larvae and adults are removed, leaving only the eggs in the dish.</li>
		<li>Hatch the collected eggs for 24 h in the dark at 25 &#176;C to obtain J2 larvae. Collect the J2 larvae, place them in a tube, and wash them three times with ddH2O for the RNAi experiment15.</li>
		<li>Transfer the J2 larvae to the 2 mL tube containing the dsRNA solution and add resorcinol solution (wrapped in tinfoil and dissolved in water) to produce a final concentration of 1.0%. Incubate the larvae with centrifugation at 15&#160;&#215;&#160;g on a shaking table for 24 h at 25 &#176;C to ensure that the larvae effectively absorb the dsRNA.</li>
		<li>Soak the same quantity of nematodes in the soaking buffer without the dsRNA probe or with a GFP dsRNA probe as a control. Use the GFP gene (gfp, M62653.1) as a nonendogenous control and synthesize the dsRNA of gfp using gene-specific primers T7-GFP-F/R.</li>
	</ol>
	</li>
</ol>
4. qPCR detection
<ol>
	<li>Clean the J2 larvae with ddH2O, including those with target gene interference, GFP gene interference, and the undisturbed control group. Extract the total RNAs from each group using the method described above.</li>
	<li>Start the qPCR.
	<ol>
		<li>Design the q-ppm-1-F/R primers using the desired software (see the Table of Materials).</li>
		<li>Set up the qPCR reaction in 12 &#181;L containing 1 &#181;L of cDNA, 6 &#181;L of fluorescent premix, 0.4 &#181;L of each primer (10 pmol/l), and sterile distilled water.</li>
		<li>Perform qPCR as follows: 2 min at 95 &#176;C; followed by 40 cycles of 10 s at 95 &#176;C, 30 s at 55 &#176;C, and 1 min at 72 &#176;C.</li>
		<li>Use the actb gene (GenBank accession number EU100952) and tbb-2 gene (GenBank accession number MT769316),&#160;or other genes, as internal reference genes to evaluate the changes in gene expression level after RNAi15.</li>
	</ol>
	</li>
	<li>According to the cycle threshold (Ct) value and the dissolution curve, use the 2-&#916;&#916;Ct method to estimate the relative expression level of the target gene and verify the interference efficiency.
	<ol>
		<li>Subtract the Ct value of the internal reference gene of each sample from the Ct value of the target gene to obtain the &#916;Ct value. Then, subtract the &#916;Ct value of the interference group from the &#916;Ct value of the control group to obtain the &#916;&#916;Ct value. 
		&#8203;NOTE: A &#916;&#916;Ct value greater than 0 indicates that the interference is effective.</li>
	</ol>
	</li>
</ol>
5. Evaluate the body length of nematode adults following RNAi
<ol>
	<li>After RNAi, culture the J2 larvae until adulthood on B. cinerea lawns in PDA plates for 60 h at 25 &#176;C15.</li>
	<li>Collect the adults using the Bellman funnel method (see step 1.1.2.1)14.</li>
	<li>Acquire images of the adult nematodes under a microscope and use ImageJ software (or other measurement software) to measure the body lengths.
	<ol>
		<li>Measure the length using ImageJ by selecting Analyze | Set Scale. If the distance is known, enter the length value of the drawn straight line. Enter the unit of length.</li>
		<li>Check the Global check box (use this standard for all pictures), and click OK to select the length to be measured with a straight line on the image to be measured.</li>
		<li>Use the command Ctrl+M (measurement) to display the results and record them in the results window.</li>
	</ol>
	</li>
	<li>Take measurements of 50 male and 50 female nematodes for statistical analysis12.</li>
	<li>Analyze the data by calculating the mean and standard deviation for each sample. Compare the means of the samples from the different groups using the Student&#39;s t-test.</li>
</ol>

<ol>
	<li>Nicol, J. M., Jones, J., Gheysen, G., Fenoll, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+nematode+threats+to+world+agriculture.">Current nematode threats to world agriculture.</a> Genomics and Molecular Genetics of Plant-Nematode Interactions. , 21-43 (2011).</li><li>Jones, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Top+10+plant-parasitic+nematodes+in+molecular+plant+pathology.">Top 10 plant-parasitic nematodes in molecular plant pathology.</a> Molecular Plant Pathology. 14 (9), 946-961 (2013).</li><li>Kikuchi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+insights+into+the+origin+of+parasitism+in+the+emerging+plant+pathogen+Bursaphelenchus+xylophilus.">Genomic insights into the origin of parasitism in the emerging plant pathogen Bursaphelenchus xylophilus.</a> PLoS Pathogens. 7 (9), 1002219 (2011).</li><li>Megen, H. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+phylogenetic+tree+of+nematodes+based+on+about+1200+full-length+small+subunit+ribosomal+DNA+sequences.">A phylogenetic tree of nematodes based on about 1200 full-length small subunit ribosomal DNA sequences.</a> Nematology. 11 (6), 927-950 (2009).</li><li>Niu, J. H., Jian, H., Xu, J. M., Guo, Y. D., Liu, Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+technology+extends+its+reach:+Engineering+plant+resistance+against+harmful+eukaryotes.">RNAi technology extends its reach: Engineering plant resistance against harmful eukaryotes.</a> African Journal of Biotechnology. 9 (45), 7573-7582 (2010).</li><li>Fire, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 91 (6669), 806-811 (1998).</li><li>Shahid, M., Imran, A., Mazhar, H., Yusuf, Z., Rob, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+novel+traits+in+plants+through+RNA+interference.">Engineering novel traits in plants through RNA interference.</a> Trends in Plant Science. 11 (11), 559-565 (2006).</li><li>Marmonier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+acquisition+of+specific+small+interfering+RNAs+inhibits+the+expression+of+some+target+genes+in+the+plant+ectoparasite+Xiphinema+index.">In vitro acquisition of specific small interfering RNAs inhibits the expression of some target genes in the plant ectoparasite Xiphinema index.</a> International Journal of Molecular Sciences. 20 (13), 3266 (2019).</li><li>Iqbal, S., Fosu-Nyarko, J., Jones, M. G. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Attempt+to+silence+genes+of+the+RNAi+pathways+of+the+root-knot+nematode,+Meloidogyne+incognita+results+in+diverse+responses+including+increase+and+no+change+in+expression+of+some+genes.">Attempt to silence genes of the RNAi pathways of the root-knot nematode, Meloidogyne incognita results in diverse responses including increase and no change in expression of some genes.</a> Frontiers in Plant Science. 11, 328 (2020).</li><li>Zhou, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+and+functional+analysis+of+akt-1+in+pinewood+nematode,+Bursaphelenchus+xylophilus.">Molecular characterization and functional analysis of akt-1 in pinewood nematode, Bursaphelenchus xylophilus.</a> Forest Pathology. 51 (1), 12647 (2021).</li><li>Zhou, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+mab-3+in+spermatogenesis+and+ontogenesis+of+pinewood+nematode,+Bursaphelenchus+xylophilus.">The role of mab-3 in spermatogenesis and ontogenesis of pinewood nematode, Bursaphelenchus xylophilus.</a> Pest Management Science. 77 (1), 138-147 (2021).</li><li>Tang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bxy-fuca+encoding+&#945;-L-fucosidase+plays+crucial+roles+in+development+and+reproduction+of+the+pathogenic+pinewood+nematode,+Bursaphelenchus+xylophilus.">Bxy-fuca encoding &#945;-L-fucosidase plays crucial roles in development and reproduction of the pathogenic pinewood nematode, Bursaphelenchus xylophilus.</a> Pest Management Science. 76 (1), 205-214 (2020).</li><li>Wang, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+and+functional+analysis+of+daf-8+in+the+pinewood+nematode,+Bursaphelenchus+xylophilus.">Molecular characterization and functional analysis of daf-8 in the pinewood nematode, Bursaphelenchus xylophilus.</a> Journal of Forestry Research. , (2021).</li><li>Viglierchio, D. R., Schmitt, R. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+methodology+of+nematode+extraction+from+field+samples:+Baermann+funnel+modifications.">On the methodology of nematode extraction from field samples: Baermann funnel modifications.</a> Journal of Nematology. 15 (3), 438-444 (1983).</li><li>Zhu, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Observation+and+quantification+of+mating+behavior+in+the+pinewood+nematode,+Bursaphelenchus+xylophilus.">Observation and quantification of mating behavior in the pinewood nematode, Bursaphelenchus xylophilus.</a> Journal of Visualized Experiments: JoVE. (118), e54842 (2016).</li><li>Zhou, L. F., Chen, F. M., Ye, J. R., Pan, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+reliable+reference+genes+for+RT-qPCR+analysis+of+Bursaphelenchus+mucronatus+gene+expression+from+different+habitats+and+developmental+stages.">Selection of reliable reference genes for RT-qPCR analysis of Bursaphelenchus mucronatus gene expression from different habitats and developmental stages.</a> Frontiers in Genetics. 9, 269-279 (2018).</li><li>Wang, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double-stranded+RNA-mediated+interference+of+dumpy+genes+in+Bursaphelenchus+xylophilus+by+feeding+on+filamentous+fungal+transformants.">Double-stranded RNA-mediated interference of dumpy genes in Bursaphelenchus xylophilus by feeding on filamentous fungal transformants.</a> International Journal for Parasitology. 46 (5-6), 351-360 (2016).</li><li>Ma, H. B., Lu, Q., Liang, J., Zhang, X. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+analysis+of+the+cellulose+gene+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus,+using+RNA+interference.">Functional analysis of the cellulose gene of the pine wood nematode, Bursaphelenchus xylophilus, using RNA interference.</a> Genetics and Molecular Research: GMR. 10 (3), 1931-1941 (2011).</li><li>Cheng, X. Y., Dai, S. M., Xiao, L., Xie, B. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+cellulase+gene+knock+down+by+dsRNA+interference+on+the+development+and+reproduction+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Influence of cellulase gene knock down by dsRNA interference on the development and reproduction of the pine wood nematode, Bursaphelenchus xylophilus.</a> Nematology. 12 (12), 225-233 (2010).</li><li>Xue, Q., Wu, X. Q., Zhang, W. J., Deng, L. N., Wu, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cathepsin+L-like+cysteine+proteinase+genes+are+associated+with+the+development+and+pathogenicity+of+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Cathepsin L-like cysteine proteinase genes are associated with the development and pathogenicity of pine wood nematode, Bursaphelenchus xylophilus.</a> International Journal of Molecular Sciences. 20 (1), 215 (2019).</li><li>Tabara, H., Grishok, A., Mello, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+in+C.+elegans:+Soaking+in+the+genome+sequence.">RNAi in C. elegans: Soaking in the genome sequence.</a> Science. 282 (5388), 430-431 (1998).</li><li>Urwin, P. E., Lilley, C. J., Atkinson, H. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ingestion+of+double-stranded+RNA+by+pre+parasitic+juvenile+cyst+nematodes+leads+to+RNA+interference.">Ingestion of double-stranded RNA by pre parasitic juvenile cyst nematodes leads to RNA interference.</a> Molecular Plant-Microbe Interactions: MPMI. 15 (8), 747-752 (2002).</li><li>Bakhetia, M., Charlton, W., Atkinson, H. J., McPherson, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference+of+dual+oxidase+in+the+plant+nematode+Meloidogyne+incognita.">RNA interference of dual oxidase in the plant nematode Meloidogyne incognita.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (10), 1099-1106 (2005).</li><li>Rosso, M. N., Dubrana, M. P., Cimbolini, N., Jaubert, S., Abad, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+RNA+interference+to+root-knot+nematode+genes+encoding+esophageal+gland+proteins.">Application of RNA interference to root-knot nematode genes encoding esophageal gland proteins.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (7), 615-620 (2005).</li><li>Chen, Q., Rehman, S., Smant, G., Jones, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+analysis+of+pathogenicity+proteins+of+the+potato+cyst+nematode+Globodera+rostochiensis+using+RNAi.">Functional analysis of pathogenicity proteins of the potato cyst nematode Globodera rostochiensis using RNAi.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (7), 621-625 (2005).</li><li>Wang, D. D., Li, Y., Li, J., Xie, B. Y., Chen, G. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+clone+and+its+RNAi+interference+effect+analysis+of+mapk+gene+in+Bursaphelenchus+xylophilus+(+in+Chinese).">Molecular clone and its RNAi interference effect analysis of mapk gene in Bursaphelenchus xylophilus ( in Chinese).</a> Acta Phytopathologica Sinica. 46 (5), 662-669 (2016).</li><li>Qiu, X., Wu, X., Huang, L., Ye, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+Bxpel1+gene+silencing+by+dsRNA+interference+on+the+development+and+pathogenicity+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Influence of Bxpel1 gene silencing by dsRNA interference on the development and pathogenicity of the pine wood nematode, Bursaphelenchus xylophilus.</a> International Journal of Molecular Sciences. 17 (1), 125 (2016).</li><li>Dulovic, A., Streit, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi-mediated+knockdown+of+daf-12+in+the+model+parasitic+nematode+Strongyloides+ratti.">RNAi-mediated knockdown of daf-12 in the model parasitic nematode Strongyloides ratti.</a> PLoS Pathogens. 15 (3), 1007705 (2019).</li><li>Li, L., Zhao, H., Cui, Y., Wei, H., Li, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Research+progress+of+gene+editing+technology.">Research progress of gene editing technology.</a> Life Science Research. 21 (3), 268-274 (2017).</li><li>Bindhya, C. Y., Karuppannan, V., Kuppuswamy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host-generated+double+stranded+RNA+induces+RNAi+in+plant-parasitic+nematodes+and+protects+the+host+from+infection.">Host-generated double stranded RNA induces RNAi in plant-parasitic nematodes and protects the host from infection.</a> Molecular and Biochemical Parasitology. 148 (2), 219-222 (2006).</li><li>Jiang, Z., Sher, A. K., David, G. H., Ralph, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+insect-resistant+plants:+RNAi-mediated+crop+protection.">Next-generation insect-resistant plants: RNAi-mediated crop protection.</a> Trends in Biotechnology. 35 (9), 871-882 (2017).</li></ol>

No conflicts of interest were declared.

Although the life history and parasitic environment of B. xylophilus are different from those of other nematodes, there has been limited research on the molecular pathogenesis of this plant pathogen. Despite great progress made in the application of CRISPR/Cas9 genome editing technology in C. elegans and other nematodes, only RNAi technology applied to B. xylophilus has been published to date17. RNAi is one of the most powerful tools available to study the gene function ...

Plant-parasitic nematodes (PPNs) are a continuing threat to food security and forest ecosystems. They cause an estimated 100 billion USD in economic losses each year1, the most problematic of which are primarily root-knot nematodes, cyst nematodes, and pinewood nematodes. The pinewood nematode, Bursaphelenchus xylophilus, is a migratory, endoparasitic nematode, which is the causal pathogen of pine wilt disease2. It has caused great harm to pine forests worldwide3. Using the terminology of Van Megen et al.4, B. xylophilus is a member of the Parasitaphelenchidae and belongs to clade 10, whereas most other major plant parasites belong to clade 12.
As an independent and recently evolved plant parasite, B. xylophilus is an attractive model for comparative studies. To date, there has been substantial research on root-knot nematodes and cyst nematodes belonging to clade 12, which are obligate, sedentary endoparasites and are some of the most intensely studied nematodes. However, conducting further research in this important area comes with a major challenge: the function of parasitism genes is a research bottleneck. Functional studies generally include ectopic expression and knockdown/out experiments but rely on effective genetic transformation protocols for the nematode. As a result, reverse genetics in PPNs almost exclusively relies on gene silencing by RNAi.
RNAi, a mechanism widely present in eukaryotic cells, silences gene expression by introducing double-stranded RNA (dsRNA)5. To date, the posttranscriptional gene-silencing mechanism induced by dsRNA has been found in all studied eukaryotes, and RNAi technology, as a tool of functional genomics research and other applications, has developed rapidly in many organisms. Since the discovery of the RNAi machinery in Caenorhabditis elegans in 19986, RNAi techniques have become effective methods for identifying the gene function of nematodes and are proposed as a new way to effectively control pathogenic nematodes7.
RNAi is technically facile-soaking the juveniles in dsRNA can suffice; however, the efficacy and reproducibility of this approach vary widely with the nematode species and the target gene8. The silencing of 20 genes involved in the RNAi pathways of the root-knot nematode, Meloidogyne incognita, was investigated using long dsRNAs as triggers, resulting in diverse responses, including an increase and no change in the expression of some genes9. These results show that target genes may respond to RNAi knockdown differently, necessitating an exhaustive assessment of their suitability as targets for nematode control via RNAi. However, there is currently a paucity of research on the developmental and reproductive biology of B. xylophilus.
As a continuation of previous work10,11,12,13, we describe here a protocol for applying RNAi to study the function of&#160;the ppm-1 gene of B. xylophilus, including the synthesis of dsRNA, synthetic neurostimulant soaking, and quantitative polymerase chain reaction (qPCR) detection. The knowledge gained from this experimental approach will likely contribute markedly to understanding basic biological systems and preventing pine wilt disease.

<table><tbody><tr><td>Baermann funnel</td><td>n/a</td><td>n/a</td><td>to isolate nematodes</td></tr><tr><td>Beacon Designer 7.9</td><td>Shanghai kangyusheng information technology co.</td><td>n/a</td><td>to design qPCR primers</td></tr><tr><td>Botrytis cinerea</td><td>n/a</td><td>n/a</td><td>as food for nematodes</td></tr><tr><td>&lt;em&gt;Bursaphelenchus xylophilus&lt;/em&gt;</td><td>n/a</td><td>n/a</td><td>its number was NXY61 and was it was originally extracted from diseased&lt;br/&gt; Pinus massoniana in Ningbo, Zhejiang province, China.</td></tr><tr><td>constant temperature incubator</td><td>Shanghai Jing Hong Laboratory Instrument Co.</td><td>H1703544</td><td>to cultur nematodes</td></tr><tr><td>Electrophoresis apparatus</td><td>Bio-Rad Laboratories</td><td>1704466</td><td>to achieve electrophoretic analysis</td></tr><tr><td>Ethanol, 75%</td><td>Sinopharm Chemical Reagent Co.</td><td>80176961</td><td>to extract RNA</td></tr><tr><td>Ex Taq Polymerase Premix</td><td>Takara Bio Inc.</td><td>RR030A</td><td>for PCR</td></tr><tr><td>Ex Taq Polymerase Premix</td><td>Takara Bio Inc.</td><td>RR390A</td><td>for PCR</td></tr><tr><td>Gel imager</td><td>LongGene Scientific Instruments Co.</td><td>LG2020</td><td>to make nucleic acid bands visible</td></tr><tr><td>GraphPad Prism 8</td><td>GraphPad Prism</td><td>n/a</td><td>to analyze the data and make figurs</td></tr><tr><td>High Speed Centrifuge</td><td>Hangzhou Allsheng Instruments Co.</td><td>AS0813000</td><td>centrifug</td></tr><tr><td>High-flux tissue grinder</td><td>Bertin</td><td></td><td>to extract RNA</td></tr><tr><td>ImageJ software</td><td>National Institutes of Health</td><td>n/a</td><td>to measure the body lengths</td></tr><tr><td>isopropyl alcohol</td><td>Shanghai Aladdin Biochemical Technology Co.</td><td>L1909022</td><td>to extract RNA</td></tr><tr><td>Leica DM4B microscope</td><td>Leica Microsystems Inc.</td><td></td><td>to observe nematodes</td></tr><tr><td>magnetic beads</td><td>Aoran science technology co.</td><td>150010C</td><td>to extract RNA</td></tr><tr><td>MEGAscript T7 High Yield Transcription Kit</td><td>Thermo Fisher Scientific Inc.</td><td>AM1333</td><td>to synthesize dsRNA in vitro</td></tr><tr><td>NanoDrop ND-2000 spectrophotometer</td><td>Thermo Fisher Scientific Inc.</td><td>NanoDrop 2000/2000C</td><td>to analyze the quality of the dsRNA</td></tr><tr><td>PCR Amplifier</td><td>Bio-Rad Life Medical Products Co.</td><td>1851148</td><td>to amplify nucleic acid sequence</td></tr><tr><td>Petri dishes</td><td>n/a</td><td>n/a</td><td>to cultur nematodes</td></tr><tr><td>pGEM-T Easy vector</td><td>Promega Corporation</td><td>A1360</td><td>for cloning</td></tr><tr><td>Potato Dextrose Agar (Medium)</td><td>n/a</td><td>n/a</td><td>to cultur &lt;em&gt;Botrytis cinerea&lt;/em&gt;</td></tr><tr><td>Prime Script RT reagent Kit with gDNA Eraser</td><td>Takara Bio Inc.</td><td>RR047B</td><td>to synthetic cDNA</td></tr><tr><td>Primer Premier 5.0</td><td>PREMIER Biosoft</td><td>n/a</td><td>to design PCR primers</td></tr><tr><td>primers:ppm-1-F/R</td><td>Tsingke Biotechnology Co.</td><td>n/a</td><td>F: 5&#039;-GATGCGAAGTTGCCAATCATTCT -3&#039;; R: 5&#039;- CCAGATCCAGTCCACCATACACC -3</td></tr><tr><td>q-ppm-1-F/R</td><td>Tsingke Biotechnology Co.</td><td>n/a</td><td>F: 5&#039;-CATCCGAATGGCAATACAG-3&#039;; R: 5&#039;-ACTATCCTCAGCGTTAGC-3&#039;</td></tr><tr><td>Real-time thermal cycler&amp;nbsp;qTOWER 2.2</td><td>Analytique Jena Instruments (Beijing) Co.</td><td></td><td>for qPCR</td></tr><tr><td>shaking table</td><td>Shanghai Zhicheng analytical instrument manufacturing co.</td><td></td><td>to soak nematodes</td></tr><tr><td>stereoscopic microscope</td><td>Chongqing Optec Instrument Co.</td><td>1814120</td><td>to observe nematodes</td></tr><tr><td>T7-GFP-F/R</td><td>Tsingke Biotechnology Co.</td><td>n/a</td><td>F: 5&#039;-TAATACGACTCACTATAGGGAAA&lt;br/&gt; GGAGAAGAACTTTTCAC-3&#039;; R: 5&#039;-TAATACGACTCACTATAGGGCTG&lt;br/&gt; TTACAAACTCAAGAAGG-3&#039;</td></tr><tr><td>&amp;nbsp;T7 promoter</td><td>Tsingke Biotechnology Co.</td><td>n/a</td><td>TAATACGACTCACTATAGGG</td></tr><tr><td>Takara MiniBEST Agarose Gel DNA Extraction Kit</td><td>Takara Bio Inc.</td><td>9762</td><td>to recover DNA</td></tr><tr><td>TaKaRa TB Green Premix Ex Taq (Tli RNaseH Plus)</td><td>Takara Bio Inc.</td><td>RR820A</td><td>for qPCR</td></tr><tr><td>trichloroethane</td><td>Shanghai LingFeng Chemical Reagent Co.</td><td></td><td>to extract RNA</td></tr><tr><td>TRIzol Reagent</td><td>Thermo Fisher Scientific Inc.</td><td>15596026</td><td>total RNA extraction reagent,to extract RNA</td></tr></tbody></table>

application of rna interference in the pinewood nematode, bursaphelenchus xylophilus

The pinewood nematode, Bursaphelenchus xylophilus, is one of the most destructive invasive species worldwide, causing the wilting and eventual death of pine trees. Despite the recognition of their economic and environmental significance, it has thus far been impossible to study the detailed gene functions of plant-parasitic nematodes (PPNs) using conventional forward genetics and transgenic methods. However, as a reverse genetics technology, RNA interference (RNAi) facilitates the study of the functional genes of nematodes, including B. xylophilus. 
This paper outlines a new protocol for RNAi of the ppm-1 gene in B. xylophilus, which has been reported to play crucial roles in the development and reproduction of other pathogenic nematodes. For RNAi, the T7 promoter was linked to the 5&#8242;-terminal of the target fragment by polymerase chain reaction (PCR), and double-stranded RNA (dsRNA) was synthesized by in vitro transcription. Subsequently, dsRNA delivery was accomplished by soaking the nematodes in a dsRNA solution mixed with synthetic neurostimulants. Synchronized juveniles of B. xylophilus (approximately 20,000 individuals) were washed and soaked in dsRNA (0.8 &#181;g/mL) in the soaking buffer for 24 h in the dark at 25 &#176;C.
The same quantity of nematodes was placed in a soaking buffer without dsRNA as a control. Meanwhile, another identical quantity of nematodes was placed in a soaking buffer with green fluorescent protein (gfp) gene dsRNA as a control. After soaking, the expression level of the target transcripts was determined using real-time quantitative PCR. The effects of RNAi were then confirmed using microscopic observation of the phenotypes and a comparison of the body size of the adults among the groups. The current protocol can help advance research to better understand the functions of the genes of B. xylophilus and other parasitic nematodes toward developing control strategies through genetic engineering.

Analysis of ppm-1 expression of B. xylophilus after RNAi 
The relative expression level of the ppm-1 gene of B. xylophilus soaked with GFP dsRNA and that soaked with target gene dsRNA was 0.92 and 0.52, respectively (the ppm-1 gene expression level of the ddH2O-treated control group was set to 1) (Figure 1). Thus, exogenous dsRNA has no effect on t...

Watch this Scientific Journal Video about Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus at JoVE.com

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

Here, we introduce a detailed soaking method of RNA interference in Bursaphelenchus xylophilus to facilitate the study of gene functions.

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

The pinewood nematode, Bursaphelenchus xylophilus, is one of the most destructive invasive species worldwide, causing the wilting and eventual death of ...

application-rna-interference-pinewood-nematode-bursaphelenchus

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

2.4K Views.  Zhejiang Agricultural & Forestry University. Here, we introduce a detailed soaking method of RNA interference in Bursaphelenchus xylophilus to facilitate the study of gene functions. 

Video: Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

Double-stranded RNA Oral Delivery Methods to Induce RNA Interference in Phloem and Plant-sap-feeding Hemipteran Insects

Phloem and plant sap feeding insects invade the integrity of crops and fruits to retrieve nutrients, in the process damaging food crops. Hemipteran insects account for a number of economically substantial pests of plants that cause damage to crops by feeding on phloem sap. The brown marmorated stink bug (BMSB), Halyomorpha halys (Heteroptera: Pentatomidae) and the Asian citrus psyllid (ACP), Diaphorina citri Kuwayama (Hemiptera: Liviidae) are hemipteran insect pests introduced in North America, where they are an invasive agricultural pest of high-value specialty, row, and staple crops and citrus fruits, as well as a nuisance pest when they aggregate indoors. Insecticide resistance in many species has led to the development of alternate methods of pest management strategies. Double-stranded RNA (dsRNA)-mediated RNA interference (RNAi) is a gene silencing mechanism for functional genomic studies that has potential applications as a tool for the management of insect pests. Exogenously synthesized dsRNA or small interfering RNA (siRNA) can trigger highly efficient gene silencing through the degradation of endogenous RNA, which is homologous to that presented. Effective and environmental use of RNAi as molecular biopesticides for biocontrol of hemipteran insects requires the in vivo delivery of dsRNAs through feeding. Here we demonstrate methods for delivery of dsRNA to insects: loading of dsRNA into green beans by immersion, and absorbing of gene-specific dsRNA with oral delivery through ingestion. We have also outlined non-transgenic plant delivery approaches using foliar sprays, root drench, trunk injections as well as clay granules, all of which may be essential for sustained release of dsRNA. Efficient delivery by orally ingested dsRNA was confirmed as an effective dosage to induce a significant decrease in expression of targeted genes, such as juvenile hormone acid O-methyltransferase (JHAMT) and vitellogenin (Vg). These innovative methods represent strategies for delivery of dsRNA to use in crop protection and overcome environmental challenges for pest management.

This article demonstrates novel techniques developed for oral delivery of double-stranded RNA (dsRNA) through the vascular tissues of plants for RNA interference (RNAi) in phloem sap feeding insects.

Phloem and plant sap feeding insects invade the integrity of crops and fruits to retrieve nutrients, in the process damaging food crops. Hemipteran ...

Environment

Using RNA-mediated Interference Feeding Strategy to Screen for Genes Involved in Body Size Regulation in the Nematode C. elegans

Double-strand RNA-mediated interference (RNAi) is an effective strategy to knock down target gene expression1-3. It has been applied to many model systems including plants, invertebrates and vertebrates. There are various methods to achieve RNAi in vivo4,5. For example, the target gene may be transformed into an RNAi vector, and then either permanently or transiently transformed into cell lines or primary cells to achieve gene knockdown effects; alternatively synthesized double-strand oligonucleotides from specific target genes (RNAi oligos) may be transiently transformed into cell lines or primary cells to silence target genes; or synthesized double-strand RNA molecules may be microinjected into an organism. Since the nematode C. elegans uses bacteria as a food source, feeding the animals with bacteria expressing double-strand RNA against target genes provides a viable strategy6. Here we present an RNAi feeding method to score body size phenotype. Body size in C. elegans is regulated primarily by the TGF- &beta; - like ligand DBL-1, so this assay is appropriate for identification of TGF-&beta; signaling components7. We used different strains including two RNAi hypersensitive strains to repeat the RNAi feeding experiments. Our results showed that rrf-3 strain gave us the best expected RNAi phenotype. The method is easy to perform, reproducible, and easily quantified. Furthermore, our protocol minimizes the use of specialized equipment, so it is suitable for smaller laboratories or those at predominantly undergraduate institutions.

Using RNA-mediated Interference Feeding Strategy to Screen for Genes Involved in Body Size Regulation in the Nematode C. elegans

We demonstrate how to use the RNAi feeding technique to knock down target genes and score body size phenotype in C. elegans. This method could be used for a large scale screen to identify potential genetic components of interest, such as those involved in body size regulation by DBL-1/TGF-&beta; signaling.

Double-strand RNA-mediated interference (RNAi) is an effective strategy to knock down target gene expression1-3. It has been applied to many model systems ...

Culturing and Genetically Manipulating Entomopathogenic Nematodes

Entomopathogenic nematodes in the genera Heterorhabditis and Steinernema are obligate parasites of insects that live in the soil. The main characteristic of their life cycle is the mutualistic association with the bacteria Photorhabdus and Xenorhabdus, respectively. The nematode parasites are able to locate and enter suitable insect hosts, subvert the insect immune response, and multiply efficiently to produce the next generation that will actively hunt new insect prey to infect. Due to the properties of their life cycle, entomopathogenic nematodes are popular biological control agents, which are used in combination with insecticides to control destructive agricultural insect pests. Simultaneously, these parasitic nematodes represent a research tool to analyze nematode pathogenicity and host anti-nematode responses. This research is aided by the recent development of genetic techniques and transcriptomic approaches for understanding the role of nematode secreted molecules during infection. Here, a detailed protocol on maintaining entomopathogenic nematodes and using a gene knockdown procedure is provided. These methodologies further promote the functional characterization of entomopathogenic nematode infection factors.

Entomopathogenic nematodes live in symbiosis with bacteria and together they successfully infect insects by undermining their innate immune system. To promote research on the genetic basis of nematode infection, methods for maintaining and genetically manipulating entomopathogenic nematodes are described.

Entomopathogenic nematodes in the genera Heterorhabditis and Steinernema are obligate parasites of insects that live in the soil. The main characteristic ...

Immunology and Infection

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

The red flour beetle, Tribolium&#160;castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully annotated genome sequence, transposon-based transgenesis, and effective RNA interference (RNAi). Among these advantages, RNAi-based gene knockdown techniques are at the core of Tribolium research. T. castaneum show a robust systemic RNAi response, making it possible to perform RNAi at any life stage by simply injecting double-stranded RNA (dsRNA) into the beetle&#8217;s body cavity.
In this report, we provide an overview of our larval RNAi technique in T. castaneum. The protocol includes (i) isolation of the proper stage of T. castaneum larvae for injection, (ii) preparation for the injection setting, and (iii) dsRNA injection. Larval RNAi is a simple, but powerful technique that provides us with quick access to loss-of-function phenotypes, including multiple gene knockdown phenotypes as well as a series of hypomorphic phenotypes. Since virtually all T. castaneum tissues are susceptible to extracellular dsRNA, the larval RNAi technique allows researchers to study a wide variety of tissues in diverse contexts, including the genetic basis of organismal responses to the outside environment. In addition, the simplicity of this technique stimulates more student involvement in research, making T. castaneum an ideal genetic system for use in a classroom setting.

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

RNA interference (RNAi)-based gene knockdown techniques are at the core of Tribolium research. Here, we provide an overview of our larval RNAi technique in Tribolium castaneum. Larval RNAi is a simple, but powerful technique that provides quick access to loss-of-function phenotypes, allowing researchers to study gene functions in diverse contexts.

The red flour beetle, Tribolium&#160;castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully ...

RNAi Trigger Delivery into Anopheles gambiae Pupae

RNA interference (RNAi), a naturally occurring phenomenon in eukaryotic organisms, is an extremely valuable tool that can be utilized in the laboratory for functional genomic studies. The ability to knockdown individual genes selectively via this reverse genetic technique has allowed many researchers to rapidly uncover the biological roles of numerous genes within many organisms, by evaluation of loss-of-function phenotypes. In the major human malaria vector Anopheles gambiae, the predominant method used to reduce the function of targeted genes involves injection of double-stranded (dsRNA) into the hemocoel of the adult mosquito. While this method has been successful, gene knockdown in adults excludes the functional assessment of genes that are expressed and potentially play roles during pre-adult stages, as well as genes that are expressed in limited numbers of cells in adult mosquitoes. We describe a method for the injection of Serine Protease Inhibitor 2 (SRPN2) dsRNA during the early pupal stage and validate SRPN2 protein knockdown by observing decreased target protein levels and the formation of melanotic pseudo-tumors in SRPN2 knockdown adult mosquitoes. This evident phenotype has been described previously for adult stage knockdown of SRPN2 function, and we have recapitulated this adult phenotype by SRPN2 knockdown initiated during pupal development. When used in conjunction with a dye-labeled dsRNA solution, this technique enables easy visualization by simple light microscopy of injection quality and distribution of dsRNA in the hemocoel.

RNAi Trigger Delivery into Anopheles gambiae Pupae

RNA interference (RNAi) is an extremely valuable tool for uncovering gene function. However, the ability to target genes using RNAi during pre-adult stages is limited in the major human malaria vector Anopheles gambiae. We describe an RNAi protocol to reduce gene function via direct injection during pupal development.

RNA interference (RNAi), a naturally occurring phenomenon in eukaryotic organisms, is an extremely valuable tool that can be utilized in the laboratory ...

Observation and Quantification of Mating Behavior in the Pinewood Nematode, Bursaphelenchus xylophilus

A method for observing and quantifying the mating behavior of the pinewood nematode, Bursaphelenchus xylophilus, was established under a stereomicroscope. To improve the mating efficiency of B. Xylophilus and to increase the chances of mating observation, virgin adults were cultured and used for the investigation. Eggs were obtained by keeping the nematodes in water and allowing the females to lay eggs for 10 min. The second-stage juveniles (J2) were synchronized by incubating the eggs for 24 h at 25 &#176;C in the dark, and the early J4 were obtained by culturing the J2 with grey mold, Botrytis cinerea, for another 52 h. At this time point, most J4 nematodes could be clearly distinguished as being male or female using their genital morphology. The male and female J4 were collected and cultured separately in two different Petri dishes for 24 h to get virgin adult nematodes. A virgin male and a virgin female were paired in a drop of water in the well of a concave slide. The mating behavior was filmed with a video recorder under a stereomicroscope. The whole period of the mating process was 82.8 &#177;3.91 min (mean &#177;SE) and could be divided into 4 different phases: searching, contacting, copulating, and lingering. The mean minutes of duration were 21.8 &#177; 2.0, 28.0 &#177; 1.9, 25.8 &#177; 0.7 and 7.2 &#177; 0.5, respectively. Eleven sub-behaviors were described: cruising, approaching, encountering, touching, hooping, locating, attaching, ejaculating, separating, quiescence, and roaming. Interestingly, obvious intra-sexual competition was observed when one female was grouped with 3 males or one male with 3 females. This protocol is useful and valuable, not only in investigating the mating behavior of B. xylophilus, but also in acting as a reference for ethological studies of other nematodes.

Observation and Quantification of Mating Behavior in the Pinewood Nematode, Bursaphelenchus xylophilus

A protocol for investigating the mating behavior of the pinewood nematode, Bursaphelenchus xylophilus, is presented. Behavioral features of B. xylophilus are described in the mating process.

A method for observing and quantifying the mating behavior of the pinewood nematode, Bursaphelenchus xylophilus, was established under a stereomicroscope. ...

Practical Use of RNA Interference: Oral Delivery of Double-stranded RNA in Liposome Carriers for Cockroaches

RNA interference (RNAi) has been widely applied for uncovering the biological functions of numerous genes, and has been envisaged as a pest control tool operating by disruption of essential gene expression. Although different methods, such as injection, feeding, and soaking, have been reported for successful delivery of double-stranded RNA (dsRNA), the efficiency of RNAi through oral delivery of dsRNA is highly variable among different insect groups. The German cockroach, Blattella germanica, is highly sensitive to the injection of dsRNA, as shown by many studies published previously. The present study describes a method to demonstrate that the dsRNA encapsulated with liposome carriers is sufficient to retard the degradation of dsRNA by midgut juice. Notably, the continuous feeding of dsRNA encapsulated by liposomes significantly reduces the tubulin expression in the midgut, and led to the death of cockroaches. In conclusion, the formulation and utilization of dsRNA lipoplexes, which protect dsRNA against nucleases, could be a practical use of RNAi for insect pest control in the future.

This manuscript demonstrates the depletion of gene expression in the midgut of the German cockroach through oral ingestion of double-stranded RNA encapsulated in liposomes.

RNA interference (RNAi) has been widely applied for uncovering the biological functions of numerous genes, and has been envisaged as a pest control tool ...

Advancing RNAi Techniques in Trichogramma dendrolimi for Gene Function Analysis

RNA Interference in the Egg Parasitoid, Trichogramma dendrolimi Matsumura

The egg parasitoids, Trichogramma spp, are recognized as efficient biological control agents against various lepidopteran pests in agriculture and forests. The immature stages of Trichogramma offspring develop within the host egg, exhibiting remarkable diminutiveness (approximately 0.5 mm in adult length). RNA-interference (RNAi) methodology has emerged as a crucial tool for elucidating gene functions in numerous organisms. However, manipulating RNAi in certain small parasitoid species, such as Trichogramma, has generally posed significant challenges. In this study, we present an efficient RNAi method in Trichogramma denrolimi. The outlined procedure encompasses the acquisition and isolation of individual T. dendrolimi specimens from host eggs, the design and synthesis of double-stranded RNA (dsRNA), the in vitro transplantation and cultivation of T. dendrolimi pupae, the micro-injection of dsRNA, and the subsequent assessment of target gene knockdown through RT-qPCR analysis. This study furnishes a comprehensive, visually detailed procedure for conducting RNAi experiments in T. dendrolimi, thereby enabling researchers to investigate the gene regulation in this species. Furthermore, this methodology is adaptable for RNAi studies or micro-injections in other Trichogramma species with minor adjustments, rendering it a valuable reference for conducting RNAi experiments in other endoparasitic species.

Author Spotlight: Investigating Wolbachia-Induced Thelytokous Parthenogenesis and Genetic Toolkit Development Through RNA Interference

The manipulation of RNA interference (RNAi) presents a formidable challenge in many parasitoid species with diminutive size, such as Trichogramma wasps. This study delineated an efficient RNAi method in Trichogramma denrolimi. The present methodology provides a robust model for investigating gene regulation in Trichogramma wasps.

The egg parasitoids, Trichogramma spp, are recognized as efficient biological control agents against various lepidopteran pests in agriculture and ...

Optimizing Pinewood Nematode Infection in Pinus pinaster

Infection of In Vivo and In Vitro Pines with the Pinewood Nematode Bursaphelenchus xylophilus and Isolation of Induced Volatiles

The pinewood nematode (PWN) is a phytoparasite that causes pine wilt disease (PWD) in conifer species. This plant parasitic nematode has heavily contributed to pine deforestation in Asian countries, e.g., Japan, China, and Korea. Over the last two decades, in Europe, Portugal and Spain have been greatly affected. Research on the mechanisms of PWN infection and/or PWD progression in susceptible host species relies on the controlled infection of pine seedlings under greenhouse conditions. This technique is laborious and mobilizes substantial economic and human resources. Additionally, it can be prone to variability that results from the genetic diversity associated with some pine species but also from the interference of external factors. As an alternative, in vitro co-cultures of pine with PWNs offer a more advantageous system for studying biochemical changes since they a) allow controlling single environmental or nutritional variables, b) occupy less space, c) require less time to obtain, and d) are&#160;free from contamination or from host genetic variation. The following protocol details the standard in vivo PWN infection of Pinus pinaster, the maritime pine, and the establishment of the novel in vitro co-cultures of pine shoots with the PWN as an improved methodology to study this phytoparasite influence on pine volatiles. PWN-induced volatiles are extracted from in vivo and in vitro infected pines by hydrodistillation and distillation-extraction, and the emitted volatiles are captured by solid phase microextraction (SPME), using fiber or packed column techniques.

Author Spotlight: In Vitro Co-Culture System of Pine Shoots and Pinewood Nematode for Studying Host Volatile Response

The protocol describes the in vivo and in vitro pinewood nematode infection of Pinus pinaster and their volatilome analysis through Gas Chromatography (GC) and GC coupled to Mass Spectrometry (GC-MS).

The pinewood nematode (PWN) is a phytoparasite that causes pine wilt disease (PWD) in conifer species. This plant parasitic nematode has heavily ...

Nanoparticle-Mediated dsRNA Feeding for Gene Silencing in Silkworm Larvae

Larval RNA Interference in Silkworm Bombyx mori through Chitosan/dsRNA Nanoparticle Delivery

The silkworm, Bombyx mori, is an important economic insect with thousands of years of history in China. Meanwhile, the silkworm is the model insect of Lepidoptera with a good accumulation of basic research. It is also the first insect in Lepidoptera with its complete genome sequenced and assembled, which provides a solid foundation for gene functional study. Although RNA interference (RNAi) is widely used in reverse gene functional study, it is refractory in silkworms and other Lepidopteran species. Previous successful RNAi-related research to deliver double-stranded RNA (dsRNA) was performed through injection only. Delivery of dsRNA through feeding is never reported. In this article, we describe step-by-step procedures to prepare the chitosan/dsRNA nanoparticles, which are fed to the silkworm larvae by ingestion. The protocol includes (i) selection of the proper stage of silkworm larvae, (ii) synthesis of dsRNA, (iii) preparation of the chitosan/dsRNA nanoparticles, and (iv) feeding the silkworm larvae with chitosan/dsRNA nanoparticles. Representative results, including gene transcript confirmation and phenotype observation, are presented. dsRNA feeding is a simple technique for RNAi in silkworm larvae. Since silkworm larvae are easy to rear and large enough to operate, it provides a good model to demonstrate larval RNAi in insects. In addition, the simplicity of this technique stimulates more student involvement in research, making silkworm larvae an ideal genetic system for use in a classroom setting.

Author Spotlight: Advancing Gene Silencing Research in Silkworms with dsRNA Delivery Through Feeding Chitosan Nanoparticles

Presented here is a protocol for chitosan/dsRNA nanoparticle delivery in silkworm Bombyx mori larvae to induce gene silencing through ingestion.

The silkworm, Bombyx mori, is an important economic insect with thousands of years of history in China. Meanwhile, the silkworm is the model insect of ...

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

Summary

Explore More Videos

Chapters in this video

Double-stranded RNA Oral Delivery Methods to Induce RNA Interference in Phloem and Plant-sap-feeding Hemipteran Insects

Using RNA-mediated Interference Feeding Strategy to Screen for Genes Involved in Body Size Regulation in the Nematode C. elegans

Culturing and Genetically Manipulating Entomopathogenic Nematodes

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

RNAi Trigger Delivery into Anopheles gambiae Pupae

Observation and Quantification of Mating Behavior in the Pinewood Nematode, Bursaphelenchus xylophilus

Practical Use of RNA Interference: Oral Delivery of Double-stranded RNA in Liposome Carriers for Cockroaches

RNA Interference in the Egg Parasitoid, Trichogramma dendrolimi Matsumura

Infection of In Vivo and In Vitro Pines with the Pinewood Nematode Bursaphelenchus xylophilus and Isolation of Induced Volatiles

Larval RNA Interference in Silkworm Bombyx mori through Chitosan/dsRNA Nanoparticle Delivery