L.Y.T.C acknowledges generous support from the New Frontiers in Research Fund-Exploration (NFRF-E), the Natural Sciences and Engineering Research Council of Canada (NSERC) Discovery Grant, and the University of Toronto&#39;s Medicine by Design Initiative, which receives funding from the Canada First Research Excellence Fund (CFREF).

<ol>
	<li>Cherry, K. M., Qian, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Scaling+up+molecular+pattern+recognition+with+DNA-based+winner-take-all+neural+networks.">Scaling up molecular pattern recognition with DNA-based winner-take-all neural networks.</a> Nature. 559 (7714), 370-376 (2018).</li><li>Qian, L., Winfree, E., Bruck, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neural+network+computation+with+DNA+strand+displacement+cascades.">Neural network computation with DNA strand displacement cascades.</a> Nature. 475 (7356), 368-372 (2011).</li><li>Chen, Y. -. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programmable+chemical+controllers+made+from+DNA.">Programmable chemical controllers made from DNA.</a> Nature Nanotechnology. 8 (10), 755-762 (2013).</li><li>di Bernardo, D., Marucci, L., Menolascina, F., Siciliano, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predicting+synthetic+gene+networks.">Predicting synthetic gene networks.</a> Synthetic Gene Networks: Methods and Protocols. 813, 57-81 (2012).</li><li>Xiang, Y., Dalchau, N., Wang, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Scaling+up+genetic+circuit+design+for+cellular+computing:+advances+and+prospects.">Scaling up genetic circuit design for cellular computing: advances and prospects.</a> Natural Computing. 17 (4), 833-853 (2018).</li><li>Gould, N., Hendy, O., Papamichail, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+tools+and+algorithms+for+designing+customized+synthetic+genes.">Computational tools and algorithms for designing customized synthetic genes.</a> Frontiers in Bioengineering and Biotechnology. 2, (2014).</li><li>MacDonald, J. T., Siciliano, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+sequence+design+with+R2oDNA+Designer.">Computational sequence design with R2oDNA Designer.</a> Mammalian Synthetic Promoters. 1651, 249-262 (2017).</li><li>Cervantes-Salido, V. M., Jaime, O., Brizuela, C. A., Mart&#237;nez-P&#233;rez, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+the+design+of+sequences+for+DNA+computing:+A+multiobjective+evolutionary+approach.">Improving the design of sequences for DNA computing: A multiobjective evolutionary approach.</a> Applied Soft Computing. 13 (12), 4594-4607 (2013).</li><li>Zadeh, J. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NUPACK:+Analysis+and+design+of+nucleic+acid+systems.">NUPACK: Analysis and design of nucleic acid systems.</a> Journal of Computational Chemistry. 32 (1), 170-173 (2011).</li><li>Fornace, M. E., Porubsky, N. J., Pierce, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+unified+dynamic+programming+framework+for+the+analysis+of+interacting+nucleic+acid+strands:+enhanced+models,+scalability,+and+speed.">A unified dynamic programming framework for the analysis of interacting nucleic acid strands: enhanced models, scalability, and speed.</a> ACS Synthetic Biology. 9 (10), 2665-2678 (2020).</li><li>Wetterstrand, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+costs:+Data.">DNA sequencing costs: Data.</a> Genome.gov. , (2020).</li><li>Lopez, R., Wang, R., Seelig, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+molecular+multi-gene+classifier+for+disease+diagnostics.">A molecular multi-gene classifier for disease diagnostics.</a> Nature Chemistry. 10 (7), 746-754 (2018).</li><li>Pardee, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=low-cost+detection+of+Zika+virus+using+programmable+biomolecular+components.">low-cost detection of Zika virus using programmable biomolecular components.</a> Cell. 165 (5), 1255-1266 (2016).</li><li>Yurke, B., Turberfield, A. J., Mills, A. P., Simmel, F. C., Neumann, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+DNA-fuelled+molecular+machine+made+of+DNA.">A DNA-fuelled molecular machine made of DNA.</a> Nature. 406 (6796), 605-608 (2000).</li><li>Lin, K. N., Volkel, K., Tuck, J. M., Keung, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+and+scalable+DNA-based+information+storage.">Dynamic and scalable DNA-based information storage.</a> Nature Communications. 11 (1), 2981 (2020).</li><li>Yurke, B., Mills, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+DNA+to+power+nanostructures.">Using DNA to power nanostructures.</a> Genetic Programming and Evolvable Machines. 4 (2), 111-122 (2003).</li><li>Zhang, D. Y., Turberfield, A. J., Yurke, B., Winfree, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+entropy-driven+reactions+and+networks+catalyzed+by+DNA.">Engineering entropy-driven reactions and networks catalyzed by DNA.</a> Science. 318 (5853), 1121-1125 (2007).</li><li>Wang, B., Thachuk, C., Ellington, A. D., Winfree, E., Soloveichik, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effective+design+principles+for+leakless+strand+displacement+systems.">Effective design principles for leakless strand displacement systems.</a> Proceedings of the National Academy of Sciences. 115 (52), 12182-12191 (2018).</li><li>Machinek, R. R. F., Ouldridge, T. E., Haley, N. E. C., Bath, J., Turberfield, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programmable+energy+landscapes+for+kinetic+control+of+DNA+strand+displacement.">Programmable energy landscapes for kinetic control of DNA strand displacement.</a> Nature Communications. 5 (1), 5324 (2014).</li><li>Cabello-Garcia, J., Bae, W., Stan, G. -. B. V., Ouldridge, T. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Handhold-mediated+strand+displacement:+a+nucleic+acid-based+mechanism+for+generating+far-from-equilibrium+assemblies+through+templated+reactions.">Handhold-mediated strand displacement: a nucleic acid-based mechanism for generating far-from-equilibrium assemblies through templated reactions.</a> bioRxiv. , (2020).</li><li>Brophy, J. A. N., Voigt, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Principles+of+genetic+circuit+design.">Principles of genetic circuit design.</a> Nature Methods. 11 (5), 508-520 (2014).</li><li>Khalil, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+biology+framework+for+programming+eukaryotic+transcription+functions.">A synthetic biology framework for programming eukaryotic transcription functions.</a> Cell. 150 (3), 647-658 (2012).</li><li>Swank, Z., Laohakunakorn, N., Maerkl, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-free+gene-regulatory+network+engineering+with+synthetic+transcription+factors.">Cell-free gene-regulatory network engineering with synthetic transcription factors.</a> Proceedings of the National Academy of Sciences. 116 (13), 5892-5901 (2019).</li><li>Howland, S. W., Tsuji, T., Gnjatic, S., Ritter, G., Old, L. J., Wittrup, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducing+efficient+cross-priming+using+antigen-coated+yeast+particles.">Inducing efficient cross-priming using antigen-coated yeast particles.</a> Journal of immunotherapy. 31 (7), 607 (2008).</li><li>Abil, Z., Ellefson, J. W., Gollihar, J. D., Watkins, E., Ellington, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Compartmentalized+partnered+replication+for+the+directed+evolution+of+genetic+parts+and+circuits.">Compartmentalized partnered replication for the directed evolution of genetic parts and circuits.</a> Nature Protocols. 12 (12), 2493-2512 (2017).</li><li>Baugh, C., Grate, D., Wilson, C., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=2.8+&#197;+crystal+structure+of+the+malachite+green+aptamer11.">2.8 &#197; crystal structure of the malachite green aptamer11.</a> Journal of Molecular Biology. 301 (1), 117-128 (2000).</li><li>Chou, L. Y. T., Shih, W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+transcriptional+regulation+via+nucleic+acid-based+transcription+factors.">In vitro transcriptional regulation via nucleic acid-based transcription factors.</a> ACS Synthetic Biology. 8 (11), 2558-2565 (2019).</li><li>Lykke-Andersen, J., Christiansen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+C-terminal+carboxy+group+of+T7+RNA+polymerase+ensures+efficient+magnesium+ion-dependent+catalysis.">The C-terminal carboxy group of T7 RNA polymerase ensures efficient magnesium ion-dependent catalysis.</a> Nucleic Acids Research. 26 (24), 5630-5635 (1998).</li><li>Pu, J., Disare, M., Dickinson, B. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolution+of+C-terminal+modification+tolerance+in+full-length+and+split+T7+RNA+Polymerase+biosensors.">Evolution of C-terminal modification tolerance in full-length and split T7 RNA Polymerase biosensors.</a> Chembiochem. 20 (12), 1547-1553 (2019).</li><li>Gardner, L. P., Mookhtiar, K. A., Coleman, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Initiation,+elongation,+and+processivity+of+carboxyl-terminal+mutants+of+T7+RNA+polymerase.">Initiation, elongation, and processivity of carboxyl-terminal mutants of T7 RNA polymerase.</a> Biochemistry. 36 (10), 2908-2918 (1997).</li><li>Yin, J., Lin, A. J., Golan, D. E., Walsh, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-specific+protein+labeling+by+Sfp+phosphopantetheinyl+transferase.">Site-specific protein labeling by Sfp phosphopantetheinyl transferase.</a> Nature Protocols. 1 (1), 280-285 (2006).</li><li>Warden-Rothman, R., Caturegli, I., Popik, V., Tsourkas, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sortase-tag+expressed+protein+ligation:+combining+protein+purification+and+site-specific+bioconjugation+into+a+single+step.">Sortase-tag expressed protein ligation: combining protein purification and site-specific bioconjugation into a single step.</a> Analytical Chemistry. 85 (22), 11090-11097 (2013).</li><li>Zhang, W. -. B., Sun, F., Tirrell, D. A., Arnold, F. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Controlling+macromolecular+topology+with+genetically+encoded+SpyTag-SpyCatcher+chemistry.">Controlling macromolecular topology with genetically encoded SpyTag-SpyCatcher chemistry.</a> Journal of the American Chemical Society. 135 (37), 13988-13997 (2013).</li></ol>

There are no competing financial interests to declare by any of the authors.

This study demonstrates a DNA nanotechnology-inspired approach to control the activity of T7 RNA polymerase by covalently coupling an N-terminally SNAP-tagged recombinant T7 RNAP with a BG-functionalized oligonucleotide, which was subsequently used to program TMDSD reactions. By design, the SNAP-tag was positioned at the N-terminus of the polymerase, as the C-terminus of wild-type T7 RNAP is buried within the protein structure core and makes important contacts with the DNA template28. Prior attemp...

DNA computing uses a set of designed oligonucleotides as the medium for computation. These oligonucleotides are programmed with sequences to dynamically assemble according to user-specified logic and respond to specific nucleic-acid inputs. In proof-of-concept studies, the output of the computation typically consists of a set of fluorescently labelled oligonucleotides that can be detected via gel electrophoresis or fluorescence plate readers. Over the past 30 years, increasingly complex DNA computational circuitries have been demonstrated, such as various digital logic cascades, chemical reaction networks, and neural networks1,2,3. To assist with the preparation of these DNA circuits, mathematical models have been used to predict the functionality of synthetic gene circuits4,5, and computational tools have been developed for orthogonal DNA sequence design6,7,8,9,10. Compared to silicon-based computers, the advantages of DNA computers include their ability to interface directly with biomolecules, operate in solution in the absence of a power supply, as well as their overall compactness and stability. With the advent of next-generation sequencing, the cost of synthesizing DNA computers has been decreasing for the past two decades at a rate faster than Moore&#39;s Law11. Applications of such DNA-based computers are now beginning to emerge, such as for disease diagnosis12,13, for powering molecular biophysics14, and as data storage platforms15.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/62073/62073fig01.jpg" /> 
Figure 1: Mechanism of toehold-mediated DNA strand displacement. The toehold, &#948;, is a free, unbound sequence on a partial duplex. When a complementary domain (&#948;*) is introduced on a second strand, the free &#948; domain serves as a toehold for hybridization, allowing for the rest of the strand (&#593;*) to slowly displace its competitor through a zipping/unzipping reversible reaction known as strand migration. As the length of &#948; increases, the &#916;G for the forward reaction decreases, and displacement happens more readily. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/62073/62073fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
To-date, the majority of DNA computers utilize a well-established motif in the field of dynamic DNA nanotechnology known as toehold-mediated DNA strand displacement (TMDSD, Figure 1)16. This motif consists of a partially double-stranded DNA (dsDNA) duplex displaying short &#34;toehold&#34; overhangs (i.e., 7- to 10 nucleotides (nt)). Nucleic acid &#34;input&#34; strands can interact with the partial duplexes through the toehold. This leads to the displacement of one of the strands from the partial duplex, and this liberated strand can then serve as input for downstream partial duplexes. Thus, TMDSD enables signal cascading and information processing. In principle, orthogonal TMDSD motifs can operate independently in solution, enabling parallel information processing. There have been a number of variations on the TMDSD reaction, such as toehold-mediated DNA strand exchange (TMDSE)17, &#34;leakless&#34; toeholds with double-long domains18, sequence-mismatched toeholds19, and &#34;handhold&#34;-mediated strand displacement20. These innovative design principles allow more finely tuned TMDSD energetics and dynamics for improving DNA computing performance.
Synthetic gene circuits, such as transcriptional gene circuits, are also capable of computation21,22,23. These circuits are regulated by protein transcription factors, which activate or repress transcription of a gene by binding to specific regulatory DNA elements. Compared to DNA-based circuits, transcriptional circuits have several advantages. First, enzymatic transcription has a much higher turnover rate than existing catalytic DNA circuits, thus generating more copies of output per single copy of input and providing a more efficient means of signal amplification. In addition, transcriptional circuits can produce different functional molecules, such as aptamers or messenger RNA (mRNA) encoding for therapeutic proteins, as computation outputs, which can be exploited for different applications. However, a major limitation of current transcriptional circuits is their lack of scalability. This is because there is a very limited set of orthogonal protein-based transcription factors, and de novo&#160;design of new protein transcription factors remains technically challenging and time-consuming.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/62073/62073fig02.jpg" /> 
Figure 2: Abstraction and mechanism of &#34;tether&#34; and &#34;cage&#34; polymerase complex. (A and B) An oligonucleotide tether is enzymatically labelled to a T7 polymerase through the SNAP-tag reaction. A cage consisting of a &#34;faux&#34; T7 promoter with a tether-complement overhang allows it to hybridize to the tether and block transcriptional activity. (C) When the operator (a*b*) is present, it binds to the toehold on the oligonucleotide tether (ab) and displaces the b* region of the cage, allowing transcription to occur. This figure has been modified from Chou and Shih27. Abbreviations: RNAP = RNA polymerase. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/62073/62073fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
This paper introduces a novel building block for molecular computing that combines the functionalities of transcriptional circuits with the scalability of DNA-based circuits. This building block is a T7 RNAP covalently attached with a single-stranded DNA tether (Figure 2A). To synthesize this DNA-tethered T7 RNAP, the polymerase was fused to an N-terminal SNAP-tag24 and recombinantly expressed in Escherichia coli. The SNAP-tag was then reacted with an oligonucleotide functionalized with the BG substrate. The oligonucleotide tether allows the positioning of molecular guests in close proximity to the polymerase via DNA hybridization. One such guest was a competitive transcriptional blocker referred to as a &#34;cage&#34;, which consists of a &#34;faux&#34; T7 promoter DNA duplex with no gene downstream (Figure 2B). When bound to the RNAP via its oligonucleotide tether, the cage stalls polymerase activity by outcompeting other DNA templates for RNAP binding, rendering the RNAP in an &#34;OFF&#34; state (Figure 2C).
To activate the polymerase to an &#34;ON&#34; state, T7 DNA templates with single-stranded &#34;operator&#34; domains upstream of the T7 promoter of the gene were designed. The operator domain (i.e., domain a*b*&#160;Figure 2C) can be designed to displace the cage from the RNAP via TMDSD and position the RNAP proximal to the T7 promoter of the gene, thus initiating transcription. Alternatively, DNA templates were also designed where the operator sequence was complementary to auxiliary nucleic-acid strands that are referred to as &#34;artificial transcription factors&#34; (i.e., TFA and TFB strands in Figure 3A). When both strands are introduced into the reaction, they will assemble at the operator site, creating a new pseudo-contiguous domain a*b*. This domain can then displace the cage via TMDSD to initiate transcription (Figure 3B). These strands can be supplied either exogenously or produced.
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/62073/62073fig03.jpg" /> 
Figure 3: Selective programming of polymerase activity through a three-component switch activator. (A)&#160;When the transcription factors (TFA and TFB) are present, they bind to the operator domain upstream of the promoter, forming a pseudo single-stranded sequence (a*b*) capable of displacing the cage through toehold mediated DNA displacement. (B) This a*b* domain can displace the cage via TMDSD to initiate transcription. This figure has been modified from Chou and Shih27. Abbreviations: TF = transcription factor; RNAP = RNA polymerase; TMDSD = toehold-mediated DNA strand displacement. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/62073/62073fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
The use of nucleic acid-based transcription factors for in vitro transcriptional regulation allows the scalable implementation of sophisticated circuit behaviors such as digital logic, feedback, and signal cascading. For example, one can build logic gate cascades by designing nucleic acid sequences such that the transcripts from an upstream gene activate a downstream gene. One application that exploits the cascading and multiplexing made capable by this proposed technology is the development of more sophisticated molecular computing circuitries for portable diagnostics and molecular data processing. In addition, integrating the molecular computing and de novo RNA synthesis capabilities can enable new applications. For example, a molecular circuit can be designed to detect one or a combination of user-defined RNAs as inputs and output therapeutic RNAs or mRNAs encoding functional peptides or proteins for point-of-care medical applications.

<table><tbody><tr><td>0.5% polysorbate 20 (TWEEN 20)</td><td>BioShop</td><td>TWN510.5</td><td></td></tr><tr><td>0.5M ethylenediaminetetraacetic acid (EDTA)</td><td>Bio Basic</td><td>SD8135</td><td></td></tr><tr><td>10 mM sodium phosphate buffer (pH 7)</td><td>Bio Basic</td><td>PD0435</td><td>Tablets used to make 10 mM buffer</td></tr><tr><td>10% ammonium persulfate (APS)</td><td>Sigma Aldrich</td><td>A3678-100G</td><td></td></tr><tr><td>100 kDa Amicon Ultra-15 Centrifugal Filter Unit</td><td>Fisher Scientific</td><td>UFC910008</td><td></td></tr><tr><td>100% acetone</td><td>Fisher Chemical</td><td>A18P4</td><td></td></tr><tr><td>100% ethanol (EtOH)</td><td>House Brand</td><td>39752-P016-EAAN</td><td></td></tr><tr><td>10x in vitro transcription (IVT) buffer</td><td>New England Biolabs</td><td>B9012</td><td></td></tr><tr><td>10x Tris-Borate-EDTA (TBE) buffer</td><td>Bio Basic</td><td>A0026</td><td></td></tr><tr><td>1M Isopropyl &amp;beta;- d-1-thiogalactopyranoside (IPTG)</td><td>Sigma Aldrich</td><td>I5502-1G</td><td></td></tr><tr><td>1M sodium bicarbonate buffer</td><td>Sigma Aldrich</td><td>S6014-500G</td><td></td></tr><tr><td>1M Tris(hydroxymethyl)aminomethane (Tris)</td><td>Sigma Aldrich</td><td>648311-1KG</td><td></td></tr><tr><td>1X Tris-EDTA (TE) buffer</td><td>ThermoFisher</td><td>12090015</td><td></td></tr><tr><td>2M imidazole</td><td>Sigma Aldrich</td><td>56750-100G</td><td></td></tr><tr><td>2-mercaptoethanol (BME)</td><td>Sigma Aldrich</td><td>M3148</td><td></td></tr><tr><td>3M sodium acetate</td><td>Bio Basic</td><td>SRB1611</td><td></td></tr><tr><td>40% acrylamide (19:1)</td><td>Bio Basic</td><td>A00062</td><td></td></tr><tr><td>4x LDS protein sample loading buffer</td><td>Fisher Scientific</td><td>NP0007</td><td></td></tr><tr><td>5M sodium chloride (NaCl)</td><td>Bio Basic</td><td>DB0483</td><td></td></tr><tr><td>5mM dithiothreitol (DTT)</td><td>Sigma Aldrich</td><td>43815-1G</td><td></td></tr><tr><td>6x gel loading dye</td><td>New England Biolabs</td><td>B7024S</td><td></td></tr><tr><td>agarose B powder</td><td>Bio Basic</td><td>AB0014</td><td></td></tr><tr><td>BG-GLA-NHS</td><td>New England Biolabs</td><td>S9151S</td><td></td></tr><tr><td>BL21 competent E. coli</td><td>Addgene</td><td>C2530H</td><td></td></tr><tr><td>BLUeye prestained protein ladder</td><td>FroggaBio</td><td>PM007-0500</td><td></td></tr><tr><td>bromophenol blue</td><td>Bio Basic</td><td>BDB0001</td><td></td></tr><tr><td>coomassie blue (SimplyBlue SafeStain)</td><td>ThermoFisher</td><td>LC6060</td><td></td></tr><tr><td>cyanine dye (SYBR Gold nucleic acid gel stain)</td><td>Fisher Scientific</td><td>S11494</td><td></td></tr><tr><td>cyanine dye (SYBR Safe nucleic acid gel stain)</td><td>Fisher Scientific</td><td>S33102</td><td></td></tr><tr><td>dry dimethyl sulfoxide (DMSO)</td><td>Fisher Scientific</td><td>D12345</td><td></td></tr><tr><td>formamide</td><td>Sigma Aldrich</td><td>F9037-100ML</td><td></td></tr><tr><td>glycerol</td><td>Bio Basic</td><td>GB0232</td><td></td></tr><tr><td>kanamycin sulfate</td><td>BioShop</td><td>KAN201.5</td><td></td></tr><tr><td>lysogeny broth</td><td>Sigma Aldrich</td><td>L2542-500ML</td><td></td></tr><tr><td>malachite green oxalate</td><td>Sigma Aldrich</td><td>2437-29-8</td><td></td></tr><tr><td>N,N,N&#039;N&#039;-Tetramethylethane-1,2-diamine (TEMED)</td><td>Sigma Aldrich</td><td>T9281-25ML</td><td></td></tr><tr><td>NuPAGE MES SDS running buffer (20x)</td><td>Fisher Scientific</td><td>LSNP0002</td><td></td></tr><tr><td>NuPAGE Novex 4-12% Bis-Tris gel 1.0 mm 12-well</td><td>Life Technologies</td><td>NP0322BOX</td><td></td></tr><tr><td>oligonucleotide (cage antisense)</td><td>IDT</td><td>N/A</td><td>TATAGTGAGTCGTATTAATTTG</td></tr><tr><td>oligonucleotide (cage sense)</td><td>IDT</td><td>N/A</td><td>TCAGTCACCTATCTGTTTCAAA&lt;br/&gt; TTAATACGACTCACTATA</td></tr><tr><td>oligonucleotide (malachite green aptamer antisense)</td><td>IDT</td><td>N/A</td><td>GGATCCATTCGTTACCTGGCT&lt;br/&gt; CTCGCCAGTCGGGATCCTATA&lt;br/&gt; GTGAGTCGTATTACAGTTCCAT&lt;br/&gt; TATCGCCGTAGTTGGTGTACT</td></tr><tr><td>oligonucleotide (malachite green aptamer sense)</td><td>IDT</td><td>N/A</td><td>TAATACGACTCACTATAGGATC&lt;br/&gt; CCGACTGGCGAGAGCCAGGT&lt;br/&gt; AACGAATGGATCC</td></tr><tr><td>oligonucleotide (Transcription Factor A)</td><td>IDT</td><td>N/A</td><td>AGTACACCAACTACGAGTGAG</td></tr><tr><td>oligonucleotide (Transcription Factor B)</td><td>IDT</td><td>N/A</td><td>TCAGTCACCTATCTGGCGATAA&lt;br/&gt; TGGAACTG</td></tr><tr><td>oligonucleotide with 3&amp;rsquo; Amine modification (tether)</td><td>IDT</td><td>N/A</td><td>GCTACTCACTCAGATAGGTGAC&lt;br/&gt; TGA/3AmMO/</td></tr><tr><td>Pierce strong ion exchange spin columns</td><td>Fisher Scientific</td><td>90008</td><td></td></tr><tr><td>plasmid encoding SNAP T7 RNAP and kanamycin resistance genes</td><td>Genscript</td><td>N/A</td><td>custom gene insert</td></tr><tr><td>protein purification column (HisPur Ni-NTA spin column)</td><td>Fisher Scientific</td><td>88226</td><td></td></tr><tr><td>rNTP mix</td><td>New England Biolabs</td><td>N0466S</td><td></td></tr><tr><td>Roche mini quick DNA spin column</td><td>Sigma Aldrich</td><td>11814419001</td><td></td></tr><tr><td>Triton X-100</td><td>Sigma Aldrich</td><td>T8787-100ML</td><td></td></tr><tr><td>Ultra Low Range DNA ladder</td><td>Fisher Scientific</td><td>10597012</td><td></td></tr><tr><td>urea</td><td>BioShop</td><td>URE001.1</td><td></td></tr></tbody></table>

dna-tethered rna polymerase for programmable in vitro transcription and molecular computation

DNA nanotechnology enables programmable self-assembly of nucleic acids into user-prescribed shapes and dynamics for diverse applications. This work demonstrates that concepts from DNA nanotechnology can be used to program the enzymatic activity of the phage-derived T7 RNA polymerase (RNAP) and build scalable synthetic gene regulatory networks. First, an oligonucleotide-tethered T7 RNAP is engineered via expression of an N-terminally SNAP-tagged RNAP and subsequent chemical coupling of the SNAP-tag with a benzylguanine (BG)-modified oligonucleotide. Next, nucleic-acid strand displacement is used to program polymerase transcription on-demand. In addition, auxiliary nucleic acid assemblies can be used as &#34;artificial transcription factors&#34; to regulate the interactions between the DNA-programmed T7 RNAP with its DNA templates. This in vitro transcription regulatory mechanism can implement a variety of circuit behaviors such as digital logic, feedback, cascading, and multiplexing. The composability of this gene regulatory architecture facilitates design abstraction, standardization, and scaling. These features will enable the rapid prototyping of in vitro&#160;genetic devices for applications such as bio-sensing, disease detection, and data storage.

<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/62073/62073fig05.jpg" /> 
Figure 5: SDS-PAGE analysis of SNAP T7 RNAP expression and in vitro transcription assay. (A) SNAP T7 RNAP protein purification analysis, SNAP T7 RNAP molecular weight: 119.4kDa. FT = flow-through from the column, W1 = elution fractions of wash buffer containing impurities, E1-3 = elution fractions containing purified product, and DE = 10...

Watch this Scientific Journal Video about DNA-Tethered RNA Polymerase for Programmable In vitro Transcription and Molecular Computation at JoVE.com

DNA-Tethered RNA Polymerase for Programmable In vitro Transcription and Molecular Computation

We describe the engineering of a novel DNA-tethered T7 RNA polymerase to regulate in vitro transcription reactions. We discuss the steps for protein synthesis and characterization, validate proof-of-concept transcriptional regulation, and discuss its applications in molecular computing, diagnostics, and molecular information processing.

DNA nanotechnology enables programmable self-assembly of nucleic acids into user-prescribed shapes and dynamics for diverse applications. This work ...

dna-tethered-rna-polymerase-for-programmable-vitro-transcription

Universidad de Cartagena UDEC

Research

JoVE Journal

Bioengineering

4.0K Views.  University of Toronto. We describe the engineering of a novel DNA-tethered T7 RNA polymerase to regulate in vitro transcription reactions. We discuss the steps for protein synthesis and characterization, validate proof-of-concept transcriptional regulation, and discuss its applications in molecular computing, diagnostics, and molecular information processing.

Video: DNA-Tethered RNA Polymerase for Programmable In vitro Transcription and Molecular Computation

In Vitro Transcription Assays and Their Application in Drug Discovery

In vitro transcription assays have been developed and widely used for many years to study the molecular mechanisms involved in transcription. This process requires multi-subunit DNA-dependent RNA polymerase (RNAP) and a series of transcription factors that act to modulate the activity of RNAP during gene expression. Sequencing gel electrophoresis of radiolabeled transcripts is used to provide detailed mechanistic information on how transcription proceeds and what parameters can affect it. In this paper we describe the protocol to study how the essential elongation factor NusA regulates transcriptional pausing, as well as a method to identify an antibacterial agent targeting transcription initiation through inhibition of RNAP holoenzyme formation. These methods can be used a as platform for the development of additional approaches to explore the mechanism of action of the transcription factors which still remain unclear, as well as new antibacterial agents targeting transcription which is an underutilized drug target in antibiotic research and development.

In Vitro Transcription Assays and Their Application in Drug Discovery

In this manuscript, we describe a protocol to functionally examine transcription and the inhibitory activity of antibacterial agents targeting bacterial transcription.

In vitro transcription assays have been developed and widely used for many years to study the molecular mechanisms involved in transcription. This process ...

Genetics

Artificial RNA Polymerase II Elongation Complexes for Dissecting Co-transcriptional RNA Processing Events

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA polymerase II and co-transcriptional capping and splicing of the precursor RNA to form the mature mRNA. During mRNA synthesis, the RNA polymerase II elongation complex is a target for regulation by a large collection of transcription factors that control its catalytic activity, as well as the capping, splicing, and 3&#8217;-processing enzymes that create the mature mRNA. Because of the inherent complexity of mRNA synthesis, simpler experimental systems enabling isolation and investigation of its various co-transcriptional stages have great utility.
In this article, we describe one such simple experimental system suitable for investigating co-transcriptional RNA capping. This system relies on defined RNA polymerase II elongation complexes assembled from purified polymerase and artificial transcription bubbles. When immobilized via biotinylated DNA, these RNA polymerase II elongation complexes provide an easily manipulable tool for dissecting co-transcriptional RNA capping and mechanisms by which the elongation complex recruits and regulates capping enzyme during co-transcriptional RNA capping. We anticipate this system could be adapted for studying recruitment and/or assembly of proteins or protein complexes with roles in other stages of mRNA maturation coupled to the RNA polymerase II elongation complex.

Here, we describe the assembly of RNA polymerase II (Pol II) elongation complexes requiring only short synthetic DNA and RNA oligonucleotides and purified Pol II. These complexes are useful for studying mechanisms underlying co-transcriptional processing of transcripts associated with the Pol II elongation complex.

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA ...

RNA Interference in Aquatic Beetles as a Powerful Tool for Manipulating Gene Expression at Specific Developmental Time Points

RNA interference (RNAi) remains a powerful technique that allows for the targeted reduction of gene expression through mRNA degradation. This technique is applicable to a wide variety of organisms and is highly efficient in the species-rich order Coleoptera (beetles). Here, we summarize the necessary steps for developing this technique in a novel organism and illustrate its application to the different developmental stages of the aquatic diving beetle Thermonectus marmoratus. Target gene sequences can be obtained cost-effectively through the assembly of transcriptomes against a close relative with known genomics or de novo. Candidate gene cloning utilizes a specific cloning vector (the pCR4-TOPO plasmid), which allows the synthesis of double-stranded RNA (dsRNA) for any gene with the use of a single common primer. The synthesized dsRNA can be injected into either embryos for early developmental processes or larvae for later developmental processes. We then illustrate how RNAi can be injected into aquatic larvae using immobilization in agarose. To demonstrate the technique, we provide several examples of RNAi experiments, generating specific knockdowns with predicted phenotypes. Specifically, RNAi for the tanning gene laccase2 leads to cuticle lightening in both larvae and adults, and RNAi for the eye pigmentation gene white produces a lightening/lack of pigmentation in eye tubes. In addition, the knockdown of a key lens protein leads to larvae with optical deficiencies and a reduced ability to hunt prey. Combined, these results exemplify the power of RNAi as a tool for investigating both morphological patterning and behavioral traits in organisms with only transcriptomic databases.

RNA interference is a widely applicable, powerful technique for manipulating gene expression at specific developmental stages. Here, we describe the necessary steps for implementing this technique in the aquatic diving beetle Thermonectus marmoratus, from the acquisition of gene sequences to the knockdown of genes that affect structure or behavior.

RNA interference (RNAi) remains a powerful technique that allows for the targeted reduction of gene expression through mRNA degradation. This technique is ...

Environment

Practical Aspects of Sample Preparation and Setup of 1H R1&#961; Relaxation Dispersion Experiments of RNA

RNA is a highly flexible biomolecule, wherein changes in structures play crucial roles in the functions that RNA molecules execute as cellular messengers and modulators. While these dynamic states remain hidden to most structural methods, R1&#961; relaxation dispersion (RD) spectroscopy allows the study of conformational dynamics in the micro- to millisecond regime at atomic resolution. The use of 1H as the observed nucleus further expands the time regime covered and gives direct access to hydrogen bonds and base pairing.
The challenging steps in such a study are high-purity and high-yield sample preparation, potentially 13C- and 15N-labeled, as well as setup of experiments and fitting of data to extract population, exchange rate, and secondary structure of the previously invisible state. This protocol provides crucial hands-on steps in sample preparation to ensure the preparation of a suitable RNA sample and setup of 1H R1&#961; experiments with both isotopically labeled and unlabeled RNA samples.

We present a protocol to measure micro- to millisecond dynamics on 13C/15N-labeled and unlabeled RNA with 1H R1&#961; relaxation dispersion nuclear magnetic resonance (NMR) spectroscopy. The focus of this protocol lies in high-purity sample preparation and setup of NMR experiments.

RNA is a highly flexible biomolecule, wherein changes in structures play crucial roles in the functions that RNA molecules execute as cellular messengers ...

Biochemistry

Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be produced to contain any desired DNA or RNA sequence and can be prepared to include a wide variety of base and sugar modifications. Moreover, oligos can be designed to mimic specific nucleic acid alterations and thus, can serve as important tools to investigate effects of DNA damage and mechanisms of repair. We found that Thermo Scientific Dharmacon RNA-containing oligos with a length between 50 and 80 nucleotides can be particularly suitable to study, in vivo, functions and consequences of chromosomal RNA/DNA hybrids and of ribonucleotides embedded into DNA. RNA/DNA hybrids can readily form during DNA replication, repair and transcription, however, very little is known about the stability of RNA/DNA hybrids in cells and to which extent these hybrids can affect the genetic integrity of cells. RNA-containing oligos, therefore, represent a perfect vector to introduce ribonucleotides into chromosomal DNA and generate RNA/DNA hybrids of chosen length and base composition. Here we present the protocol for the incorporation of ribonucleotides into the genome of the eukaryotic model system yeast /Saccharomyces cerevisiae/. Yet, our lab has utilized Thermo Scientific Dharmacon RNA-containing oligos to generate RNA/DNA hybrids at the chromosomal level in different cell systems, from bacteria to human cells.

This work shows how to form an RNA/DNA hybrid at the chromosomal level and reveal transfer of genetic information from RNA to genomic DNA in yeast cells.

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be ...

Biology

Rapid Characterization of Genetic Parts with Cell-Free Systems

Characterizing and cataloging genetic parts are critical to the design of useful genetic circuits. Having well-characterized parts allows for the fine-tuning of genetic circuits, such that their function results in predictable outcomes. With the growth of synthetic biology as a field, there has been an explosion of genetic circuits that have been implemented in microbes to execute functions pertaining to sensing, metabolic alteration, and cellular computing. Here, we show a rapid and cost-effective method for characterizing genetic parts. Our method utilizes cell-free lysate, prepared in-house as a medium to evaluate parts via the expression of a reporter protein. Template DNA is prepared by PCR amplification using inexpensive primers to add variant parts to the reporter gene, and the template is added to the reaction as linear DNA without cloning. Parts that can be added in this way include promoters, operators, ribosome binding sites, insulators, and terminators. This approach, combined with the incorporation of an acoustic liquid handler and 384-well plates, allows the user to carry out high-throughput evaluations of genetic parts in a single day. By comparison, cell-based screening approaches require time-consuming cloning and have longer testing times due to overnight culture and culture density normalization steps. Further, working in cell-free lysate allows the user to exact tighter control over the expression conditions through the addition of exogenous components and DNA at precise concentrations. Results obtained from cell-free screening can be used directly in applications of cell-free systems or, in some cases, as a way to predict function in whole cells.

Well-characterized genetic parts are necessary for the design of novel genetic circuits. Here we describe a cost-effective, high-throughput method for rapidly characterizing genetic parts. Our method reduces cost and time by combining cell-free lysates, linear DNA to avoid cloning, and acoustic liquid handling to increase throughput and reduce reaction volumes.

Characterizing and cataloging genetic parts are critical to the design of useful genetic circuits. Having well-characterized parts allows for the ...

Substrate Generation for Endonucleases of CRISPR/Cas Systems

The interaction of viruses and their prokaryotic hosts shaped the evolution of bacterial and archaeal life. Prokaryotes developed several strategies to evade viral attacks that include restriction modification, abortive infection and CRISPR/Cas systems. These adaptive immune systems found in many Bacteria and most Archaea consist of clustered regularly interspaced short palindromic repeat (CRISPR) sequences and a number of CRISPR associated (Cas) genes (Fig. 1) 1-3. Different sets of Cas proteins and repeats define at least three major divergent types of CRISPR/Cas systems 4. The universal proteins Cas1 and Cas2 are proposed to be involved in the uptake of viral DNA that will generate a new spacer element between two repeats at the 5' terminus of an extending CRISPR cluster 5. The entire cluster is transcribed into a precursor-crRNA containing all spacer and repeat sequences and is subsequently processed by an enzyme of the diverse Cas6 family into smaller crRNAs 6-8. These crRNAs consist of the spacer sequence flanked by a 5' terminal (8 nucleotides) and a 3' terminal tag derived from the repeat sequence 9. A repeated infection of the virus can now be blocked as the new crRNA will be directed by a Cas protein complex (Cascade) to the viral DNA and identify it as such via base complementarity10. Finally, for CRISPR/Cas type 1 systems, the nuclease Cas3 will destroy the detected invader DNA 11,12 .
These processes define CRISPR/Cas as an adaptive immune system of prokaryotes and opened a fascinating research field for the study of the involved Cas proteins. The function of many Cas proteins is still elusive and the causes for the apparent diversity of the CRISPR/Cas systems remain to be illuminated. Potential activities of most Cas proteins were predicted via detailed computational analyses. A major fraction of Cas proteins are either shown or proposed to function as endonucleases 4.
Here, we present methods to generate crRNAs and precursor-cRNAs for the study of Cas endoribonucleases. Different endonuclease assays require either short repeat sequences that can directly be synthesized as RNA oligonucleotides or longer crRNA and pre-crRNA sequences that are generated via in vitro T7 RNA polymerase run-off transcription. This methodology allows the incorporation of radioactive nucleotides for the generation of internally labeled endonuclease substrates and the creation of synthetic or mutant crRNAs. Cas6 endonuclease activity is utilized to mature pre-crRNAs into crRNAs with 5'-hydroxyl and a 2',3'-cyclic phosphate termini.

CRISPR/Cas systems mediate adaptive immunity in Bacteria and Archaea. Many Cas proteins are proposed to act as endoribonucleases acting on crRNA precursors of varying length. Here we illustrate three different approaches to generate pre-crRNA substrates for the biochemical analysis of Cas endonuclease activity.

The  interaction of viruses and their prokaryotic hosts shaped the evolution of  bacterial and archaeal life. Prokaryotes developed several strategies to ...

Cell-Free Protein Synthesis from Exonuclease-Deficient Cellular Extracts Utilizing Linear DNA Templates

Cell-free protein synthesis (CFPS) has recently become very popular in the field of synthetic biology due to its numerous advantages. Using linear DNA templates for CFPS will further enable the technology to reach its full potential, decreasing the experimental time by eliminating the steps of cloning, transformation, and plasmid extraction. Linear DNA can be rapidly and easily amplified by PCR to obtain high concentrations of the template, avoiding potential in vivo expression toxicity. However, linear DNA templates are rapidly degraded by exonucleases that are naturally present in the cell extracts. There are several strategies that have been proposed to tackle this problem, such as adding nuclease inhibitors or chemical modification of linear DNA ends for protection. All these strategies cost extra time and resources and are yet to obtain near-plasmid levels of protein expression. A detailed protocol for an alternative strategy is presented here for using linear DNA templates for CFPS. By using cell extracts from exonuclease-deficient knockout cells, linear DNA templates remain intact without requiring any end-modifications. We present the preparation steps of cell lysate from Escherichia coli BL21 Rosetta2 &#916;recBCD strain by sonication lysis and buffer calibration for Mg-glutamate (Mg-glu) and K-glutamate (K-glu) specifically for linear DNA. This method is able to achieve protein expression levels comparable to that from plasmid DNA in E. coli CFPS.

Presented here is a protocol for the preparation and buffer calibration of cell extracts from exonuclease V knockout strains of Escherichia coli BL21 Rosetta2 (&#916;recBCD and &#916;recB). This is a fast, easy, and direct approach for expression in cell-free protein synthesis systems using linear DNA templates.

Cell-free protein synthesis (CFPS) has recently become very popular in the field of synthetic biology due to its numerous advantages. Using linear DNA ...

Mouse Genome Engineering Using Designer Nucleases

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well as for modeling human diseases and testing therapeutic strategies. Recent advances in the use of designer nucleases such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system for site-specific genome engineering open the possibility to perform rapid targeted genome modification in virtually any laboratory species without the need to rely on embryonic stem (ES) cell technology. A genome editing experiment typically starts with identification of designer nuclease target sites within a gene of interest followed by construction of custom DNA-binding domains to direct nuclease activity to the investigator-defined genomic locus. Designer nuclease plasmids are in vitro transcribed to generate mRNA for microinjection of fertilized mouse oocytes. Here, we provide a protocol for achieving targeted genome modification by direct injection of TALEN mRNA into fertilized mouse oocytes.

Designer nucleases such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) can be used to modify the genome of mouse preimplantation embryos by triggering both the nonhomologous end joining (NHEJ) and homologous recombination (HR) pathways. These advances enable the rapid generation of mice with precise genetic modifications.

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well ...

Versatile Biomolecular Condensates from Amphiphilic DNA Nanostars or C-Stars

Synthetic Condensates and Cell-Like Architectures from Amphiphilic DNA Nanostructures

Synthetic droplets and condensates are becoming increasingly common constituents of advanced biomimetic systems and synthetic cells, where they can be used to establish compartmentalization and sustain life-like responses. Synthetic DNA nanostructures have demonstrated significant potential as condensate-forming building blocks owing to their programmable shape, chemical functionalization, and self-assembly behavior. We have recently demonstrated that amphiphilic DNA "nanostars", obtained by labeling DNA junctions with hydrophobic moieties, constitute a particularly robust and versatile solution. The resulting amphiphilic DNA condensates can be programmed to display complex, multi-compartment internal architectures, structurally respond to various external stimuli, synthesize macromolecules, capture and release payloads, undergo morphological transformations, and interact with live cells. Here, we demonstrate protocols for preparing amphiphilic DNA condensates starting from constituent DNA oligonucleotides. We will address (i) single-component systems forming uniform condensates, (ii) two-component systems forming core-shell condensates, and (iii) systems in which the condensates are modified to support in vitro transcription of RNA nanostructures.

Author Spotlight: Developing Synthetic Cells from Programmable Amphiphilic DNA Nanostructures

We present a protocol for preparing synthetic biomolecular condensates consisting of amphiphilic DNA nanostars starting from their constituent DNA oligonucleotides. Condensates are produced from either a single nanostar component or two components and are modified to sustain in vitro transcription of RNA from an embedded DNA template.

Synthetic droplets and condensates are becoming increasingly common constituents of advanced biomimetic systems and synthetic cells, where they can be ...

DNA-Tethered RNA Polymerase for Programmable In vitro Transcription and Molecular Computation

Summary

Explore More Videos

Chapters in this video

In Vitro Transcription Assays and Their Application in Drug Discovery

Artificial RNA Polymerase II Elongation Complexes for Dissecting Co-transcriptional RNA Processing Events

RNA Interference in Aquatic Beetles as a Powerful Tool for Manipulating Gene Expression at Specific Developmental Time Points

Practical Aspects of Sample Preparation and Setup of ¹H R_1ρ Relaxation Dispersion Experiments of RNA

Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides

Rapid Characterization of Genetic Parts with Cell-Free Systems

Substrate Generation for Endonucleases of CRISPR/Cas Systems

Cell-Free Protein Synthesis from Exonuclease-Deficient Cellular Extracts Utilizing Linear DNA Templates

Mouse Genome Engineering Using Designer Nucleases

Synthetic Condensates and Cell-Like Architectures from Amphiphilic DNA Nanostructures