We gratefully acknowledge financial support through the DFG TRR 235 (Emergence of Life, project P15), the European Research Council (grant agreement no. 694410 AEDNA), and the TUM International Graduate School for Science and Engineering IGSSE (project no. 9.05). We thank E. Falgenhauer for her help with sample preparation. We thank A. Dupin and M. Schwarz-Schilling for their help with the TX-TL system and useful discussions. We thank N. B. Holland for useful discussions.

1. Expression of Elastin-like Polypeptides
<ol>
	<li>Day 1: Preparation of a starter culture and supplies for peptide expression
	<ol>
		<li>Prepare and autoclave expression culture flasks (4 x 2.5 L) and 3 L of LB medium. For 1 L of LB medium, add 25 g of LB powder to 1 L of ultrapure water.</li>
		<li>Prepare a starter culture with 100 mL of LB medium, 50 &#181;L of sterile-filtered (0.22 &#181;m filter) chloramphenicol solution (25 mg/mL in EtOH), and 50 &#181;L of sterile-filtered (0.22 &#181;m filter) carbenicillin solution (100 mg/mL in 50% EtOH and 50% ultrapure water).</li>
		<li>Add a small streak from a pre-made bacterial stock containing E. coli strain BL21(DE3)pLysS with the pET20b(+) expression vector encoding the polypeptide sequence MGHGVGVP((GEGVP)4(GVGVP))4((GFGVP)4(GVGVP))3(GFGVP)4GWP (abbreviated as EF) to a pre-warmed 100 mL starter culture and incubate at 37 &#176;C for 16 h with 250 rpm in a shaking incubator (E. coli strains and vectors are available upon request).</li>
		<li>Pre-warm the expression culture flasks and the LB media at 37 &#176;C overnight so that they are prepared for the next day.</li>
	</ol>
	</li>
	<li>Day 2: Protein expression
	<ol>
		<li>Add 750 mL of LB medium to each expression culture flask, 375 &#181;L of sterile-filtered (0.22 &#181;m filter) chloramphenicol stock (25 mg/mL in EtOH), and 375 &#181;L of sterile-filtered (0.22 &#181;m filter) carbenicillin stock (100 mg/mL in 50% EtOH and 50% ultrapure water).</li>
		<li>After agitation to distribute the antibiotics, take 2 mL of the media as a reference sample for the optical density measurement at 600 nm (OD600).</li>
		<li>Add 7.5 mL of the starting culture to the expression flask and incubate for 1 h at 37 &#176;C with 250 rpm.</li>
		<li>After this step the OD600 of each flask will be checked every 20 min.</li>
		<li>When the optical density reaches approximately 0.8 reduce the temperature to 16 &#176;C and induce peptide expression by adding 750 &#181;L of 1 M sterile-filtered &#946;-isopropyl thiogalactoside (IPTG) in ultrapure water into each expression flask.</li>
		<li>Incubate the expression flask with the induced bacteria at 16 &#176;C for 16 h with 250 rpm.</li>
	</ol>
	</li>
	<li>Day 3: Extraction of the expressed polypeptide
	<ol>
		<li>Pre-weigh the centrifugation flask to enable determination of the mass of the cell pellet after harvesting.</li>
		<li>Harvest all the bacteria from the expression flasks by centrifugation for 20 min using a pre-cooled centrifuge at 4,000 x g and 4 &#176;C.</li>
		<li>Pour out the supernatant and blot the centrifuge bottles on a sterile paper towel.</li>
		<li>Weigh the centrifugation flasks and calculate the cell pellet mass.</li>
		<li>Resuspend the cells, which are pelleted down from 750 mL of original cell culture, in 15 mL of phosphate-buffered saline (PBS, pH 7.4) by pipetting, and centrifuge at 4,000 x g for 20 min at 4 &#176;C. Pour out the supernatant and blot the centrifuge bottles on a sterile paper towel.</li>
		<li>Resuspend the cell pellet for the lysis step in 2 mL of buffer per 1 gram of cell pellet using PBS (pH 7.4) supplemented with lysozyme (1&#8201;mg/mL), 1&#8201;mM phenylmethylsulfonyl fluoride (PMSF), 1&#8201;mM benzamidine, and 0.5&#8201;U of DNase I.</li>
		<li>Sonicate the cells for further lysis on ice with a sonicator at 8 W for 9 min with alternating 10 s sonication and 20 s pausing steps, followed by a 9 min pause during which the sample should be cooled on ice. Repeat the 9 min sonication step once more.</li>
		<li>Add 2 mL of 10% (w/v) polyethyleneimine (PEI) per 1&#8201;L of original cell culture for nucleic acid precipitation.</li>
		<li>Distribute the sample into 2 mL centrifuge tubes and incubate at 60 &#176;C for 10 min followed by an incubation for 10 min at 4 &#176;C.</li>
		<li>Centrifuge the solution at 16,000 x g for 10 min at 4 &#176;C and collect the supernatant containing the ELP.</li>
	</ol>
	</li>
	<li>Protein purification via inverse temperature cycling:
	<ol>
		<li>Adjust the supernatant to a pH of 2 to switch the hydrophilic part of the peptide to hydrophobic and induce aggregation. To adjust the pH, phosphoric acid and sodium hydroxide are used. pH stripes are sufficient to determine the pH level.</li>
		<li>To improve the yield of the purification the sample, heat the sample to 60 &#176;C and add sodium chloride up to 2 M.</li>
		<li>Subsequently, centrifuge the sample at 16,000 x g for 10 min at room temperature (RT).</li>
		<li>Discard the supernatant and re-dissolve the pellet in PBS (but only half of the initial volume is used compared to the previous step).</li>
		<li>Adjust the pH to 7 with phosphoric acid and sodium hydroxide. pH stripes are sufficiently accurate to determine the pH.</li>
		<li>Centrifuge the sample subsequently at 16,000 x g for 10 min at 4 &#176;C.</li>
		<li>Collect the supernatant and repeat steps 1.4.1&#8211;1.4.6 up to 3x total, except that in the last repetition of step 1.4.4, only water is added instead of PBS.</li>
		<li>Measure the concentration of the peptides with an absorption spectrometer. Use an extinction coefficient of 5500/M/cm at 280&#8201;nm.</li>
		<li>Adjust the concentration of the ELP to 700 &#181;M.</li>
	</ol>
	</li>
</ol>
2. Vesicle Production Using the Glass Beads Method
<ol>
	<li>Concentrate the ELP solution to 1.1 mM using a centrifugal vacuum concentrator.</li>
	<li>Mix 200 &#181;L of the concentrated ELP solution with 1,250 &#181;L of a 2:1 chloroform/methanol mixture followed by vortexing.</li>
	<li>Add 1.5 g of spherical glass beads (212&#8211;300&#8201;&#181;m in size) to a 10 mL round bottom flask.</li>
	<li>Add the solution containing ELP and the chloroform/methanol mixture to the round bottom flask and mix by gentle shaking.</li>
	<li>Connect the flask to a rotary evaporator. Adjust the speed to 150 rpm and regulate the pressure to -0.2 x 105 Pa (-200 mbar) for approximately 4 min until the liquid is evaporated at room temperature.</li>
	<li>Place the round bottom flask into a desiccator for at least 1 h to ensure that remaining chloroform and methanol are evaporated. To avoid loss of the glass beads, loosely attached aluminum foil should be wrapped around the round bottom flask opening.</li>
	<li>For a single experiment, mix 100 mg of the peptide covered glass beads with 60 &#181;L of the swelling solution, such as PBS. Incubate this sample at 25 &#176;C for 5 min.</li>
	<li>Centrifuge the sample quickly with a table-top centrifuge to sediment the glass beads.</li>
	<li>Use a pipette to collect the supernatant which contains the vesicles.</li>
</ol>
3. Transcription of RNA Aptamer dBroccoli Inside the Vesicles
<ol>
	<li>Clean the lab bench with wipes containing RNase decontamination solution to create an RNase-free working environment.</li>
	<li>Mix the ssDNA (5 &#181;M) comprising the T7 promotor and dBroccoli sequence (GAGACGGTCGGGTCCATCTGAGACGGTCGGGTCCAGATATTCGTATCTGTCGAGTAGAGTGTGGGCTCAGATGTCGAGTAGAGTGTGGGCTC), as well as the noncoding strand (5 &#181;M) in nuclease-free water supplemented with RNAPol reaction buffer [40&#8201;mM Tris-HCl (pH = 7.9), 6&#8201;mM MgCl2, 1&#8201;mM dithiothreitol (DTT), and 2&#8201;mM spermidine], to prepare the DNA template for the transcription reaction.</li>
	<li>Incubate the solution at 90 &#176;C for 5 min followed by a slow temperature decrease to 20 &#176;C for 30 min.</li>
	<li>Prepare a 1 mM (5Z)-5-(3,5-difluoro-4-hydroxybenzylidene)-2,3-dimethyl-3,5-dihydro-4H-imidazol-4-one (DFHBI) solution by dissolving 1.26 mg of DFHBI in 5 mL of DMSO.</li>
	<li>Prepare the transcription reaction by mixing RNAPol reaction buffer [40&#8201;mM Tris-HCl (pH = 7.9), 6&#8201;mM MgCl2, 1&#8201;mM dithiothreitol (DTT), and 2&#8201;mM spermidine] with 125&#8201;mM KCl, 15&#8201;mM MgCl2, 4&#8201;mM rNTP, 10&#8201;&#181;M DFHBI, 200&#8201;nM DNA template, 0.5&#8201;U/&#181;L RNase inhibitor murine, and water.</li>
	<li>Right before the reaction is started, add 4&#8201;U/&#181;L T7 polymerase.</li>
	<li>Use this reaction mix as the swelling solution in step 2.7 and incubate at 37 &#176;C for the duration of the experiment, which is typically 1 h.</li>
</ol>
4. Transcription-translation (TX-TL) Reaction
NOTE: For the transcription-translation reaction, a crude cell extract is required as well as reaction buffer and DNA. The crude cell extract is prepared as described in Sun et al.18. For a TX-TL reaction, use the following: 33% (v/v) of the crude E. coli extract, 42% (v/v) reaction buffer, and 25% (v/v) phenol-chloroform purified DNA plus additives. The final concentrations are approximately 9 mg/mL protein, 50&#8201;mM HEPES (pH = 8), 1.5&#8201;mM ATP, 1.5 mM GTP, 0.9&#8201;mM CTP, 0.9 mM UTP, 0.2&#8201;mg/mL tRNA, 26&#8201;mM coenzyme A, 0.33&#8201;mM NAD, 0.75&#8201;mM cAMP, 68&#8201;mM folinic acid, 1&#8201;mM spermidine, 30&#8201;mM PEP, 1&#8201;mM DTT, 2% PEG-8000, 13.3 mM maltose, 1 U of T7 RNA polymerase, and 50 nM plasmid DNA in ultrapure water.
<ol>
	<li>Phenol-chloroform purification of the DNA template
	<ol>
		<li>Prepare six overnight cultures with 5 mL of LB medium and 5 &#181;L of sterile-filtered (0.22 &#181;m filter) carbenicillin solution (100 mg/mL in 50% EtOH and 50% ultrapure water).</li>
		<li>Add a small streak from a pre-made bacterial stock containing DH5&#945; E. coli with the pET20b(+) expression vector to each pre-warmed 5 mL overnight culture and incubate at 37 &#176;C for 16 h with 250 rpm. Depending on which peptide (EF) or protein (YPet or mVenus) is to be expressed, a specific encoding plasmid is used.</li>
		<li>Extract the plasmid with a mini-prep kit as described in the user manual or by following the protocol provided by Zhang et al.24.</li>
		<li>Prepare 100 &#181;L of the pre-purified plasmid DNA (concentration can range from 200&#8211;600 ng/&#181;L) and mix with 100 &#181;L of Roti-phenol/chloroform/isoamyl alcohol (pH = 7.5&#8211;8.0) in a microcentrifuge tube to enable better phase separation.</li>
		<li>Gently invert the tube up to 6x and centrifuge for 5 min at 16,000 x g at RT.</li>
		<li>Add 200 &#181;L of chloroform to the upper phase of the tube and invert the tube up to 6x.</li>
		<li>Centrifuge the sample at 16,000 x g for 5 min at RT.</li>
		<li>Pipet the supernatant to a separate tube and add 10 &#181;L of 3 M of sodium acetate for ethanol precipitation.</li>
		<li>Add 1 mL of -80 &#176;C cold ethanol and store the sample at -80 &#176;C for 1 h.</li>
		<li>Centrifuge the sample at 16,000 x g for 15 min at 4 &#176;C.</li>
		<li>Decant the supernatant and add 1 mL of -20 &#176;C cold 70% (v/v) ethanol.</li>
		<li>Centrifuge at 16,000 x g for 5 min at 4 &#176;C.</li>
		<li>Remove the liquid by pipetting. Be careful to not disturb the DNA pellet.</li>
		<li>Store the sample at RT for approximately 15 min to evaporate the remaining ethanol.</li>
		<li>Add ultrapure water to the sample to adjust the sample concentration to approximately 300 nM, which is measured by absorption at 260 nm.</li>
	</ol>
	</li>
	<li>Preparation of the TX-TL reaction
	<ol>
		<li>Thaw the prepared crude cell extract and the reaction buffer on ice.</li>
		<li>For a 60 &#181;L reaction mix, add the plasmid DNA (phenol-chloroform purified) to 37.5 &#181;L of the reaction buffer [50&#8201;mM HEPES (pH = 8), 1.5&#8201;mM ATP, 1.5 mM GTP, 0.9&#8201;mM CTP, 0.9 mM UTP, 0.2&#8201;mg/mL tRNA, 26&#8201;mM coenzyme A, 0.33&#8201;mM NAD, 0.75&#8201;mM cAMP, 68&#8201;mM folinic acid, 1&#8201;mM spermidine, 30&#8201;mM PEP, 1&#8201;mM DTT, 2% PEG-8000, and 13.3 mM maltose), followed by the addition of 28.7 &#181;L of crude cell extract. Fill to a final volume with ultrapure water to 58.8 &#181;L.</li>
		<li>Right before the reaction starts, add 1.2 &#181;L of the T7 RNA polymerase solution and mix the sample by pipetting up and down.</li>
		<li>Use this reaction mix as a swelling solution in step 2.7 and incubate at 29 &#176;C for the duration of the experiment, which is typically 4&#8211;8 h.</li>
	</ol>
	</li>
</ol>
5. Conjugation of Elastin-like Polypeptides with Fluorophores via Copper Catalyzed Azide-alkyne Huisgen Cycloaddition
<ol>
	<li>Prepare a 20 mM NHS-azide linker (&#947;-azidobutyric acid N-hydroxysuccinimide ester) solution in DMSO.</li>
	<li>Mix 250 &#181;L of the ELP solution (600 &#181;M) with PBS (8&#8201;g/L NaCl, 0.2&#8201;g/L KCl, 1.42&#8201;g/L Na2HPO4, 0.27&#8201;g/L K2HPO4, pH = 7.2) and NHS-azide (1.2 mM) and incubate for 12 h at RT.</li>
	<li>Load the sample in a 10 kDa dialysis cassette and store it at 4 &#176;C for 12 h in 1 L of ultrapure water to remove the salts and residual NHS-azide.</li>
	<li>Mix the activated ELP (500 &#181;M) with the alkyne-conjugated dye (500 &#181;M), Cy5-alkyne, or Cy3-alkyne.</li>
	<li>Mix this sample with 1&#8201;mM TBTA (tris(benzyltriazolylmethyl)amine), 10&#8201;mM TCEP (tris(2-carboxyethyl)-phosphine hydrochloride) and 10&#8201;mM CuSO4 and incubate at 4 &#176;C for 12 h.</li>
	<li>Load the sample in a 10 kDa dialysis cassette and store it at 4 &#176;C for 12 h in 1 L of ultrapure water, to remove the salts and residual alkyne-conjugated dyes.</li>
	<li>These dye-modified ELPs are used in a 1:1 mixture of the Cy3 labeled ELPs and the Cy5 labeled ELPs analogous to the peptides in part two.</li>
</ol>

<ol>
	<li>Chen, I. A., Szostak, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+kinetic+study+of+the+growth+of+fatty+acid+vesicles.">A kinetic study of the growth of fatty acid vesicles.</a> Biophysical Journal. 87 (2), 988-998 (2004).</li><li>Nourian, Z., Roelofsen, W., Danelon, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Triggered+gene+expression+in+fed-vesicle+microreactors+with+a+multifunctional+membrane.">Triggered gene expression in fed-vesicle microreactors with a multifunctional membrane.</a> Angewandte Chemie International Edition. 51 (13), 3114-3118 (2012).</li><li>Hardy, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-reproducing+catalyst+drives+repeated+phospholipid+synthesis+and+membrane+growth.">Self-reproducing catalyst drives repeated phospholipid synthesis and membrane growth.</a> Proceedings of the National Academy of Sciences of the United States of America. 112 (27), 8187-8192 (2015).</li><li>Scott, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-Free+Phospholipid+Biosynthesis+by+Gene-Encoded+Enzymes+Reconstituted+in+Liposomes.">Cell-Free Phospholipid Biosynthesis by Gene-Encoded Enzymes Reconstituted in Liposomes.</a> PLoS ONE. 11 (10), e0163058 (2016).</li><li>Deamer, D. W., Barchfeld, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Encapsulation+of+macromolecules+by+lipid+vesicles+under+simulated+prebiotic+conditions.">Encapsulation of macromolecules by lipid vesicles under simulated prebiotic conditions.</a> Journal of Molecular Evolution. 18 (3), 203-206 (1982).</li><li>Adamala, K., Szostak, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonenzymatic+Template-Directed+RNA+Synthesis+Inside+Model+Protocells.">Nonenzymatic Template-Directed RNA Synthesis Inside Model Protocells.</a> Science. 342 (6162), 1098-1100 (2013).</li><li>Zhu, T. F., Szostak, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coupled+growth+and+division+of+model+protocell+membranes.">Coupled growth and division of model protocell membranes.</a> Journal of the American Chemical Society. 131 (15), 5705-5713 (2009).</li><li>Kurihara, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-reproduction+of+supramolecular+giant+vesicles+combined+with+the+amplification+of+encapsulated+DNA.">Self-reproduction of supramolecular giant vesicles combined with the amplification of encapsulated DNA.</a> Nature Chemistry. 3 (10), 775-781 (2011).</li><li>Chu, H. -. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+analysis+of+an+elastin-like+polypeptide+(ELP)+in+a+cell-free+protein+synthesis+system.">Expression analysis of an elastin-like polypeptide (ELP) in a cell-free protein synthesis system.</a> Enzyme and Microbial Technology. 46 (2), 87-91 (2010).</li><li>Martino, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+Expression,+Aggregation,+and+Triggered+Release+from+Polymersomes+as+Artificial+Cell-like+Structures.">Protein Expression, Aggregation, and Triggered Release from Polymersomes as Artificial Cell-like Structures.</a> Angewandte Chemie International Edition. 51 (26), 6416-6420 (2012).</li><li>Vogele, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+synthetic+cells+using+peptide-based+reaction+compartments.">Towards synthetic cells using peptide-based reaction compartments.</a> Nature Communications. 9 (1), 3862 (2018).</li><li>Huber, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Designer+amphiphilic+proteins+as+building+blocks+for+the+intracellular+formation+of+organelle-like+compartments.">Designer amphiphilic proteins as building blocks for the intracellular formation of organelle-like compartments.</a> Nature Materials. 14 (1), 125-132 (2014).</li><li>McPherson, D. T., Xu, J., Urry, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Product+purification+by+reversible+phase+transition+following+Escherichia+coli+expression+of+genes+encoding+up+to+251+repeats+of+the+elastomeric+pentapeptide+GVGVP.">Product purification by reversible phase transition following Escherichia coli expression of genes encoding up to 251 repeats of the elastomeric pentapeptide GVGVP.</a> Protein Expression and Purification. 7 (1), 51-57 (1996).</li><li>Urry, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physical+chemistry+of+biological+free+energy+transduction+as+demonstrated+by+elastic+protein-based+polymers.">Physical chemistry of biological free energy transduction as demonstrated by elastic protein-based polymers.</a> The Journal of Physical Chemistry B. 101 (51), 11007-11028 (1997).</li><li>Urry, D. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elastin:+a+representative+ideal+protein+elastomer.">Elastin: a representative ideal protein elastomer.</a> Philosophical Transactions of the Royal Society B: Biological Sciences. 357 (1418), 169-184 (2002).</li><li>Meyer, D. E., Chilkoti, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+recombinant+proteins+by+fusion+with+thermally-responsive+polypeptides.">Purification of recombinant proteins by fusion with thermally-responsive polypeptides.</a> Nature Biotechnology. 17 (11), 1112-1115 (1999).</li><li>Meyer, D. E., Chilkoti, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+encoded+synthesis+of+protein-based+polymers+with+precisely+specified+molecular+weight+and+sequence+by+recursive+directional+ligation:+examples+from+the+elastin-like+polypeptide+system.">Genetically encoded synthesis of protein-based polymers with precisely specified molecular weight and sequence by recursive directional ligation: examples from the elastin-like polypeptide system.</a> Biomacromolecules. 3 (2), 357-367 (2002).</li><li>Sun, Z. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protocols+for+implementing+an+Escherichia+coli+based+TX-TL+cell-free+expression+system+for+synthetic+biology.">Protocols for implementing an Escherichia coli based TX-TL cell-free expression system for synthetic biology.</a> Journal of Visualized Experiments. (79), e50762 (2013).</li><li>Caschera, F., Noireaux, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+2.3+mg/ml+of+protein+with+an+all+Escherichia+coli+cell-free+transcription-translation+system.">Synthesis of 2.3 mg/ml of protein with an all Escherichia coli cell-free transcription-translation system.</a> Biochimie. 99, 162-168 (2014).</li><li>Schwarz-Schilling, M., Aufinger, L., M&#252;ckl, A., Simmel, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+communication+between+bacteria+and+cell-free+gene+expression+systems+within+linear+chains+of+emulsion+droplets.">Chemical communication between bacteria and cell-free gene expression systems within linear chains of emulsion droplets.</a> Integrative Biology. 8 (4), 564-570 (2016).</li><li>Garamella, J., Marshall, R., Rustad, M., Noireaux, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+All+E.+coli+TX-TL+Toolbox+2.0:+A+Platform+for+Cell-Free+Synthetic+Biology.">The All E. coli TX-TL Toolbox 2.0: A Platform for Cell-Free Synthetic Biology.</a> ACS Synthetic Biology. 5 (4), 344-355 (2016).</li><li>Rideau, E., Dimova, R., Schwille, P., Wurm, F. R., Landfester, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Liposomes+and+polymersomes:+a+comparative+review+towards+cell+mimicking.">Liposomes and polymersomes: a comparative review towards cell mimicking.</a> Chemical Society Reviews. 47 (23), 8572-8610 (2018).</li><li>Filonov, G. S., Moon, J. D., Svensen, N., Broccoli Jaffrey, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broccoli:+Rapid+Selection+of+an+RNA+Mimic+of+Green+Fluorescent+Protein+by+Fluorescence-Based+Selection+and+Directed+Evolution.">Broccoli: Rapid Selection of an RNA Mimic of Green Fluorescent Protein by Fluorescence-Based Selection and Directed Evolution.</a> Journal of the American Chemical Society. 136 (46), 16299-16308 (2014).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+Plasmid+DNA+from+Bacterial+Colonies+Using+the+Qiagen+Miniprep+Kit.">Purifying Plasmid DNA from Bacterial Colonies Using the Qiagen Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Stetefeld, J., McKenna, S. A., Patel, T. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+light+scattering:+a+practical+guide+and+applications+in+biomedical+sciences.">Dynamic light scattering: a practical guide and applications in biomedical sciences.</a> Biophysical Reviews. 8 (4), 409-427 (2016).</li></ol>

The authors declare no competing financial interests.

Film rehydration is a common procedure for the creation of small unilamellar vesicles. The main source of failure is the wrong handling of the materials used in the procedure.

Initially, the ELPs are produced by E. coli cells. The yield after ELP purification can vary significantly depending on how carefully the protocol is conducted during its crucial steps. These are the inverse temperature cycling (ITC) step and th...

The creation of synthetic living cellular systems is usually approached from two different directions. In the top-down method, the genome of a bacterium is reduced to its essential components, ultimately leading to a minimal cell. In the bottom-up approach, artificial cells are assembled de novo from molecular components or cellular subsystems, which need to be functionally integrated into a consistent cell-like system.
In the de novo approach, compartmentalization of the necessary biochemical components is usually achieved using membranes made from phospholipids or fatty acids1,2,3,4. This is because &#34;modern&#34; cell membranes mainly consist of phospholipids, while fatty acids are regarded plausible candidates of prebiotic membrane enclosures5,6. For the formation of new membranes or to facilitate membrane growth, amphiphilic building blocks must be provided from the exterior7 or ideally through production within a membranous compartment using the corresponding anabolic processes4,8.
While lipid synthesis is a relatively complex metabolic process, peptides can be produced quite readily using cell-free gene expression reactions9,10. Hence, peptide membranes formed by amphiphilic peptides represent an interesting alternative to lipid membranes as enclosures for artificial cell mimics that are able to grow11.
Amphiphilic elastin-like di-block copolymers (ELPs) are an attractive class of peptides, which can serve as the building block for such membranes12. The basic amino acid sequence motif of ELPs is (GaGVP)n, where &#8220;a&#8221; can be any amino acid except for proline and &#8220;n&#8221; is the number of motif repeats13,14,15,16,17. ELPs have been created with a hydrophobic block containing mainly phenylalanine for a and a hydrophilic block mainly composed of glutamic acid11. Depending on a and solution parameters, such as pH and salt concentration, ELPs exhibit a so-called inverse temperature transition at temperature Tt, where the peptides undergo a fully reversible phase transition from a hydrophilic to hydrophobic state. The synthesis of the peptides can be easily implemented inside vesicles using the &#8220;TX-TL&#8221; bacterial cell extract11,18,19,20,21, which provides all necessary components for coupled transcription and translation reactions.
The TX-TL system was encapsulated together, with the DNA template encoding the ELPs into ELP vesicles utilizing dehydration-rehydration from glass beads as a solid support. The formation of vesicles occurs through rehydration of the dried peptides from the bead surface11. Other methods22 for vesicle formation can be used, which potentially show lower polydispersity and larger vesicle sizes (e.g., electro-formation, emulsion phase transfer, or microfluidics-based methods). To test the viability of the encapsulation method, transcription of the fluorogenic aptamer dBroccoli23 can alternatively be used11, which is less complex than gene expression with the TX-TL system.
Due to the expression of the membrane building blocks in vesiculo and their subsequent incorporation into the membrane, the vesicles start to grow11. Membrane incorporation of the ELPs can be demonstrated through a FRET assay. To this end, the ELPs used for formation of the initial vesicle population are be conjugated with fluorescent dyes in equal shares constituting a FRET pair. Upon expression of non-labeled ELPs in vesiculo and their incorporation into the membrane, the labeled ELPs in the membrane are diluted and consequently the FRET signal decreases11. As a versatile and common method for conjugation, copper catalyzed azide-alkyne cycloaddition is used. With the use of a stabilizing ligand such as tris(benzyltriazolylmethyl)-amine, the reaction can be carried out in an aqueous solution at a physiological pH without the hydrolysis of reactants11, which is appropriate for conjugation reactions involving peptides.
The following protocol presents a detailed description of the preparation for growing ELP-based peptidosomes. The expression of the peptides and vesicle formation using the glass beads method are described. Furthermore, it is described how to implement transcription of the fluorogenic dBroccoli aptamer and the transcription-translation reaction for protein expression inside the ELP vesicles. Finally, provided is a procedure for the conjugation of ELPs with fluorophores, which can be used to prove vesicle growth through a FRET assay11.

<table><tbody><tr><td>2xYT</td><td>MP biomedicals</td><td>3012-032</td><td></td></tr><tr><td>3-PGA</td><td>Sigma-Aldrich</td><td>P8877</td><td></td></tr><tr><td>5PRIME Phase Lock GelTM tube</td><td>VWR</td><td>733-2478</td><td></td></tr><tr><td>alkine-conjugated Cy3</td><td>Sigma-Aldrich</td><td>777331</td><td></td></tr><tr><td>alkine-conjugated Cy5</td><td>Sigma-Aldrich</td><td>777358</td><td></td></tr><tr><td>ATP</td><td>Sigma-Aldrich</td><td>A8937</td><td></td></tr><tr><td>Benzamidin</td><td>Carl Roth</td><td>CN38.2</td><td></td></tr><tr><td>BL21 Rosetta 2 &lt;em&gt;E. coli&lt;/em&gt; strain</td><td>Novagen</td><td>71402</td><td></td></tr><tr><td>Bradford BSA Protein Assay Kit</td><td>Bio-rad</td><td>500-0201</td><td></td></tr><tr><td>cAMP</td><td>Sigma-Aldrich</td><td>A9501</td><td></td></tr><tr><td>Carbenicillin</td><td>Carl Roth</td><td>6344.2</td><td></td></tr><tr><td>Chloramphenicol</td><td>Sigma-Aldrich</td><td>C1919</td><td></td></tr><tr><td>Chloramphenicol</td><td>Carl Roth</td><td>3886.3</td><td></td></tr><tr><td>Chloroform</td><td>Carl Roth</td><td>4432.1</td><td></td></tr><tr><td>CoA</td><td>Sigma-Aldrich</td><td>C4282</td><td></td></tr><tr><td>CTP</td><td>USB</td><td>14121</td><td></td></tr><tr><td>CuSO&lt;sub&gt;4&lt;/sub&gt;</td><td>Carl Roth</td><td>P024.1</td><td></td></tr><tr><td>DFHBI</td><td>Lucerna Technologies</td><td>410</td><td></td></tr><tr><td>DMSO</td><td>Carl Roth</td><td>A994.1</td><td></td></tr><tr><td>DNase I</td><td>NEB</td><td>M0303S</td><td></td></tr><tr><td>DTT</td><td>Sigma-Aldrich</td><td>D0632</td><td></td></tr><tr><td>Ethanol</td><td>Carl Roth</td><td>9065.2</td><td></td></tr><tr><td>Folinic acid</td><td>Sigma-Aldrich</td><td>F7878</td><td></td></tr><tr><td>Glass beads, acid-washed</td><td>Sigma-Aldrich</td><td>G1277</td><td></td></tr><tr><td>GTP</td><td>USB</td><td>16800</td><td></td></tr><tr><td>HEPES</td><td>Sigma-Aldrich</td><td>H6147</td><td></td></tr><tr><td>IPTG (&amp;beta;-isopropyl thiogalactoside )</td><td>Sigma-Aldrich</td><td>I6758</td><td></td></tr><tr><td>KCl</td><td>Carl Roth</td><td>P017.1</td><td></td></tr><tr><td>K-glutamate</td><td>Sigma-Aldrich</td><td>G1149</td><td></td></tr><tr><td>LB Broth</td><td>Carl Roth</td><td>X968.2</td><td></td></tr><tr><td>Lysozyme</td><td>Sigma-Aldrich</td><td>L6876</td><td></td></tr><tr><td>Methanol</td><td>Carl Roth</td><td>82.2</td><td></td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Carl Roth</td><td>KK36.3</td><td></td></tr><tr><td>Mg-glutamate</td><td>Sigma-Aldrich</td><td>49605</td><td></td></tr><tr><td>Micro Bio-Spin Chromatography Columns</td><td>Bio-Rad</td><td>732-6204</td><td></td></tr><tr><td>NAD</td><td>Sigma-Aldrich</td><td>N6522</td><td></td></tr><tr><td>NHS-azide linker (y-azidobutyric acid oxysuccinimide ester)</td><td>Baseclick</td><td>BCL-033-5</td><td></td></tr><tr><td>PEG-8000</td><td>Carl Roth</td><td>263.2</td><td></td></tr><tr><td>pH stripes</td><td>Carl Roth</td><td>549.2</td><td></td></tr><tr><td>Phenylmethylsulfonyl fluoride</td><td>Carl Roth</td><td>6367.2</td><td></td></tr><tr><td>Phosphate-buffered saline</td><td>VWR</td><td>76180-684</td><td></td></tr><tr><td>Phosphoric acid</td><td>Sigma-Aldrich</td><td>W290017</td><td></td></tr><tr><td>Polyethyleneimine</td><td>Sigma-Aldrich</td><td>408727</td><td></td></tr><tr><td>Potassium phosphate dibasic solution</td><td>Sigma-Aldrich</td><td>P8584</td><td></td></tr><tr><td>Potassium phosphate monobasic solution</td><td>Sigma-Aldrich</td><td>P8709</td><td></td></tr><tr><td>Qiagen Miniprep Kit</td><td>Qiagen</td><td>27106</td><td></td></tr><tr><td>RNAPol reaction buffer</td><td>NEB</td><td>B9012</td><td></td></tr><tr><td>RNase inhibitor murine</td><td>NEB</td><td>M0314S</td><td></td></tr><tr><td>RNaseZap Wipes</td><td>ThermoFisher</td><td>AM9788</td><td></td></tr><tr><td>rNTP</td><td>NEB</td><td>N0466S</td><td></td></tr><tr><td>Roti-Phenol/Chloroform/Isoamyl alcohol</td><td>Carlroth</td><td>A156.1</td><td></td></tr><tr><td>RTS Amino Acid Sampler</td><td>5 Prime</td><td>2401530</td><td></td></tr><tr><td>Slide-A-Lyzer Dialysis Cassettes, 10k MWCO (Kit)</td><td>Thermo-Scientific</td><td>66382</td><td></td></tr><tr><td>Sodium chloride</td><td>Carl Roth</td><td>9265.1</td><td></td></tr><tr><td>Sodium hydroxide</td><td>Carl Roth</td><td>8655.1</td><td></td></tr><tr><td>Spermidine</td><td>Sigma-Aldrich</td><td>85558</td><td></td></tr><tr><td>Sterile-filtered (0.22 &amp;micro;m filter)</td><td>Carl Roth</td><td>XH76.1</td><td></td></tr><tr><td>T7 polymerase</td><td>NEB</td><td>M0251S</td><td></td></tr><tr><td>TBTA (tris(benzyltriazolylmethyl)amine)</td><td>Sigma-Aldrich</td><td>678937</td><td></td></tr><tr><td>TCEP (tris(2-carboxyethyl)-phosphine hydrochloride)</td><td>Sigma-Aldrich</td><td>C4706</td><td></td></tr><tr><td>Tris base</td><td>Fischer</td><td>BP1521</td><td></td></tr><tr><td>tRNA (from E. coli)</td><td>Roche Applied Science</td><td>MRE600</td><td></td></tr><tr><td>UTP</td><td>USB</td><td>23160</td><td></td></tr></tbody></table>

in vesiculo synthesis of peptide membrane precursors for autonomous vesicle growth

Compartmentalization of biochemical reactions is a central aspect of synthetic cells. For this purpose, peptide-based reaction compartments serve as an attractive alternative to liposomes or fatty acid-based vesicles. Externally or within the vesicles, peptides can be easily expressed and simplify the synthesis of membrane precursors. Provided here is a protocol for the creation of vesicles with diameters of ~200 nm based on the amphiphilic elastin-like polypeptides (ELP) utilizing dehydration-rehydration from glass beads. Also presented are protocols for bacterial ELP expression and purification via inverse temperature cycling, as well as their covalent functionalization with fluorescent dyes. Furthermore, this report describes a protocol to enable the transcription of RNA aptamer dBroccoli inside ELP vesicles as a less complex example for a biochemical reaction. Finally, a protocol is provided, which allows in vesiculo expression of fluorescent proteins and the membrane peptide, whereas synthesis of the latter results in vesicle growth.

Vesicle production 
Figure 1 shows transmission electron microscopy (TEM) images of vesicles prepared with different swelling solutions and the glass beads method (also see Vogele et al.11). For the sample in Figure 1A, only PBS was used as swelling solution to prove the formation of vesicles and to determine their size. When TX-TL was used as swelling solution (Figure 1B), the vesicles ...

Watch this Scientific Journal Video about In Vesiculo Synthesis of Peptide Membrane Precursors for Autonomous Vesicle Growth at JoVE.com

In Vesiculo Synthesis of Peptide Membrane Precursors for Autonomous Vesicle Growth

Presented here are protocols for the creation of peptide-based small unilamellar vesicles capable of growth. To facilitate in vesiculo production of the membrane peptide, these vesicles are equipped with a transcription-translation system and the peptide-encoding plasmid.

Compartmentalization of biochemical reactions is a central aspect of synthetic cells. For this purpose, peptide-based reaction compartments serve as an ...

in-vesiculo-synthesis-peptide-membrane-precursors-for-autonomous

Universidad de Cartagena UDEC

Research

JoVE Journal

Bioengineering

5.7K Views.  Technische Universität München. Presented here are protocols for the creation of peptide-based small unilamellar vesicles capable of growth. To facilitate in vesiculo production of the membrane peptide, these vesicles are equipped with a transcription-translation system and the peptide-encoding plasmid.

Video: In Vesiculo Synthesis of Peptide Membrane Precursors for Autonomous Vesicle Growth

Detergent-free Ultrafast Reconstitution of Membrane Proteins into Lipid Bilayers Using Fusogenic Complementary-charged Proteoliposomes.

Detergents are indispensable for delivery of membrane proteins into 30-100 nm small unilamellar vesicles, while more complex, larger model lipid bilayers are less compatible with detergents.
Here we describe a strategy for bypassing this fundamental limitation using fusogenic oppositely charged liposomes bearing a membrane protein of interest. Fusion between such vesicles occurs within 5 min in a low ionic strength buffer. Positively charged fusogenic liposomes can be used as simple shuttle vectors for detergent-free delivery of membrane proteins into biomimetic target lipid bilayers, which are negatively charged. We also show how to reconstitute membrane proteins into fusogenic proteoliposomes with a fast 30-min protocol.
Combining these two approaches, we demonstrate a fast assembly of an electron transport chain consisting of two membrane proteins from E. coli, a primary proton pump bo3-oxidase and F1Fo ATP synthase, in membranes of vesicles of various sizes, ranging from 0.1 to &#62;10 microns, as well as ATP production by this chain.

Here we present two ultrafast protocols for reconstitution of membrane proteins into fusogenic proteoliposomes, and fusion of such proteoliposomes with target lipid bilayers for detergent-free delivery of these membrane proteins into the postfusion bilayer. The combination of these approaches enables fast and easily controlled assembly of complex multi-component membrane systems.

Detergents are indispensable for delivery of membrane proteins into 30-100 nm small unilamellar vesicles, while more complex, larger model lipid bilayers ...

Biochemistry

The Encapsulation of Cell-free Transcription and Translation Machinery in Vesicles for the Construction of Cellular Mimics

As interest shifts from individual molecules to systems of molecules, an increasing number of laboratories have sought to build from the bottom up cellular mimics that better represent the complexity of cellular life. To date there are a number of paths that could be taken to build compartmentalized cellular mimics, including the exploitation of water-in-oil emulsions, microfluidic devices, and vesicles. Each of the available options has specific advantages and disadvantages. For example, water-in-oil emulsions give high encapsulation efficiency but do not mimic well the permeability barrier of living cells. The primary advantage of the methods described herein is that they are all easy and cheap to implement. Transcription-translation machinery is encapsulated inside of phospholipid vesicles through a process that exploits common instrumentation, such as a centrifugal evaporator and an extruder. Reactions are monitored by fluorescence spectroscopy. The protocols can be adapted for recombinant protein expression, the construction of cellular mimics, the exploration of the minimum requirements for cellular life, or the assembly of genetic circuitry.

Herein we describe simple methods for the preparation of vesicles, the encapsulation of transcription and translation machinery, and the monitoring of protein production. The resulting cell-free systems can be used as a starting point from which to build increasingly complex cellular mimics.

As interest shifts from individual molecules to systems of molecules, an increasing number of laboratories have sought to build from the bottom up ...

Membrane Remodeling of Giant Vesicles in Response to Localized Calcium Ion Gradients

In a wide variety of fundamental cell processes, such as membrane trafficking and apoptosis, cell membrane shape transitions occur concurrently with local variations in calcium ion concentration. The main molecular components involved in these processes have been identified; however, the specific interplay between calcium ion gradients and the lipids within the cell membrane is far less known, mainly due to the complex nature of biological cells and the difficultly of observation schemes. To bridge this gap, a synthetic approach is successfully implemented to reveal the localized effect of calcium ions on cell membrane mimics. Establishing a mimic to resemble the conditions within a cell is a severalfold problem. First, an adequate biomimetic model with appropriate dimensions and membrane composition is required to capture the physical properties of cells. Second, a micromanipulation setup is needed to deliver a small amount of calcium ions to a particular membrane location. Finally, an observation scheme is required to detect and record the response of the lipid membrane to the external stimulation. This article offers a detailed biomimetic approach for studying the calcium ion-membrane interaction, where a lipid vesicle system, consisting of a giant unilamellar vesicle (GUV) connected to a multilamellar vesicle (MLV), is exposed to a localized calcium gradient formed using a microinjection system. The dynamics of the ionic influence on the membrane were observed using fluorescence microscopy and recorded at video frame rates. As a result of the membrane stimulation, highly curved membrane tubular protrusions (MTPs) formed inside the GUV, oriented away from the membrane. The described approach induces the remodeling of the lipid membrane and MTP production in an entirely contactless and controlled manner. This approach introduces a means to address the details of calcium ion-membrane interactions, providing new avenues to study the mechanisms of cell membrane reshaping.

We present a technique for contactless micromanipulation of vesicles, using localized calcium ion gradients. Microinjection of a calcium ion solution, in the vicinity of a giant lipid vesicle, is utilized to remodel the lipid membrane, resulting in the production of membrane tubular protrusions.

In a wide variety of fundamental cell processes, such as membrane trafficking and apoptosis, cell membrane shape transitions occur concurrently with local ...

Chemistry

Synthesis of Information-bearing Peptoids and their Sequence-directed Dynamic Covalent Self-assembly

This protocol presents the use of Lewis acidic multi-role reagents to circumvent kinetic trapping observed during the self-assembly of information-encoded oligomeric strands mediated by paired dynamic covalent interactions in a manner mimicking the thermal cycling commonly employed for the self-assembly of complementary nucleic acid sequences. Primary amine monomers bearing aldehyde and amine pendant moieties are functionalized with orthogonal protecting groups for use as dynamic covalent reactant pairs. Using a modified automated peptide synthesizer, the primary amine monomers are encoded into oligo(peptoid) strands through solid-phase submonomer synthesis. Upon purification by high-performance liquid chromatography (HPLC) and characterization by electrospray ionization mass spectrometry (ESI-MS), sequence-specific oligomers are subjected to high-loading of a Lewis acidic rare-earth metal triflate which both deprotects the aldehyde moieties and affects the reactant pair equilibrium such that strands completely dissociate. Subsequently, a fraction of the Lewis acid is extracted, enabling annealing of complementary sequence-specific strands to form information-encoded molecular ladders characterized by matrix assisted laser desorption/ionization mass spectrometry (MALDI-MS). The simple procedure outlined in this report circumvents kinetic traps commonly experienced in the field of dynamic covalent assembly and serves as a platform for the future design of robust, complex architectures.

A protocol is presented for the synthesis of information-encoded peptoid oligomers and for the sequence-directed self-assembly of these peptoids into molecular ladders using amines and aldehydes as dynamic covalent reactant pairs and Lewis acidic rare-earth metal triflates as multi-role reagents.

This protocol presents the use of Lewis acidic multi-role reagents to circumvent kinetic trapping observed during the self-assembly of information-encoded ...

Directed Assembly of Elastin-like Proteins into defined Supramolecular Structures and Cargo Encapsulation In Vitro

Tailored proteinaceous building blocks are versatile candidates for the assembly of supramolecular structures such as minimal cells, drug delivery vehicles and enzyme scaffolds. Due to their biocompatibility and tunability on the genetic level, Elastin-like proteins (ELP) are ideal building blocks for biotechnological and biomedical applications. Nevertheless, the assembly of protein based supramolecular structures with distinct physiochemical properties and good encapsulation potential remains challenging.
Here we provide two efficient protocols for guided self-assembly of amphiphilic ELPs into supramolecular protein architectures such as spherical coacervates, fibers and stable vesicles. The presented assembly protocols generate Protein Membrane-Based Compartments (PMBCs) based on ELPs with adaptable physicochemical properties. PMBCs demonstrate phase separation behavior and reveal method dependent membrane fusion and are able to encapsulate chemically diverse fluorescent cargo molecules. The resulting PMBCs have a high application potential as a drug formulation and delivery platform, artificial cell, and compartmentalized reaction space.

At the interface of organic and aqueous solvents, tailored amphiphilic elastin-like proteins assemble into complex supramolecular structures such as vesicles, fibers and coacervates triggered by environmental parameters. The described assembly protocols yield Protein Membrane-Based Compartments (PMBCs) with tunable properties, enabling the encapsulation of various cargo.

Tailored proteinaceous building blocks are versatile candidates for the assembly of supramolecular structures such as minimal cells, drug delivery ...

Preparation, Purification, and Use of Fatty Acid-containing Liposomes

Liposomes containing single-chain amphiphiles, particularly fatty acids, exhibit distinct properties compared to those containing diacylphospholipids due to the unique chemical properties of these amphiphiles. In particular, fatty acid liposomes enhance dynamic character, due to the relatively high solubility of single-chain amphiphiles. Similarly, liposomes containing free fatty acids are more sensitive to salt and divalent cations, due to the strong interactions between the carboxylic acid head groups and metal ions. Here we illustrate techniques for preparation, purification, and use of liposomes comprised in part or whole of single chain amphiphiles (e.g., oleic acids).

Liposomes containing single-chain amphiphiles, particularly fatty acids, exhibit distinct properties compared to those containing diacylphospholipids due to the unique chemical properties of single chain amphiphiles. Here we describe techniques for the preparation, purification, and use of liposomes comprised in part or whole of these amphiphiles.

Liposomes containing single-chain amphiphiles, particularly fatty acids, exhibit distinct properties compared to those containing diacylphospholipids due ...

Lipid Vesicle Encapsulation Protocol for Complex Protein Networks

Construction of Out&#45;of&#45;Equilibrium Metabolic Networks in Nano&#45; and Micrometer&#45;Sized Vesicles

We present a method to incorporate into vesicles complex protein networks, involving integral membrane proteins, enzymes, and fluorescence-based sensors, using purified components. This method is relevant for the design and construction of bioreactors and the study of complex out-of-equilibrium metabolic reaction networks. We start by reconstituting (multiple) membrane proteins into large unilamellar vesicles (LUVs) according to a previously developed protocol. We then encapsulate a mixture of purified enzymes, metabolites, and fluorescence-based sensors (fluorescent proteins or dyes) via freeze-thaw-extrusion and remove non-incorporated components by centrifugation and/or size-exclusion chromatography. The performance of the metabolic networks is measured in real time by monitoring the ATP/ADP ratio, metabolite concentration, internal pH, or other parameters by fluorescence readout. Our membrane protein-containing vesicles of 100-400 nm diameter can be converted into giant-unilamellar vesicles (GUVs), using existing but optimized procedures. The approach enables the inclusion of soluble components (enzymes, metabolites, sensors) into micrometer-size vesicles, thus upscaling the volume of the bioreactors by orders of magnitude. The metabolic network containing GUVs are&#160;trapped in microfluidic devices for analysis by optical microscopy.

Author Spotlight: Tackling Challenges in Synthetic Cell Engineering

We present a protocol for reconstituting membrane proteins and encapsulating enzymes and other water-soluble components in lipid vesicles of sub-micrometer and micrometer size.

We present a method to incorporate into vesicles complex protein networks, involving integral membrane proteins, enzymes, and fluorescence-based sensors, ...

Measuring Peptide Translocation into Large Unilamellar Vesicles

There is an active interest in peptides that readily cross cell membranes without the assistance of cell membrane receptors1. Many of these are referred to as cell-penetrating peptides, which are frequently noted for their potential as drug delivery vectors1-3. Moreover, there is increasing interest in antimicrobial peptides that operate via non-membrane lytic mechanisms4,5, particularly those that cross bacterial membranes without causing cell lysis and kill cells by interfering with intracellular processes6,7. In fact, authors have increasingly pointed out the relationship between cell-penetrating and antimicrobial peptides1,8. A firm understanding of the process of membrane translocation and the relationship between peptide structure and its ability to translocate requires effective, reproducible assays for translocation. Several groups have proposed methods to measure translocation into large unilamellar lipid vesicles (LUVs)9-13. LUVs serve as useful models for bacterial and eukaryotic cell membranes and are frequently used in peptide fluorescent studies14,15. Here, we describe our application of the method first developed by Matsuzaki and co-workers to consider antimicrobial peptides, such as magainin and buforin II16,17. In addition to providing our protocol for this method, we also present a straightforward approach to data analysis that quantifies translocation ability using this assay. The advantages of this translocation assay compared to others are that it has the potential to provide information about the rate of membrane translocation and does not require the addition of a fluorescent label, which can alter peptide properties18, to tryptophan-containing peptides. Briefly, translocation ability into lipid vesicles is measured as a function of the Foster Resonance Energy Transfer (FRET) between native tryptophan residues and dansyl phosphatidylethanolamine when proteins are associated with the external LUV membrane (Figure 1). Cell-penetrating peptides are cleaved as they encounter uninhibited trypsin encapsulated with the LUVs, leading to disassociation from the LUV membrane and a drop in FRET signal. The drop in FRET signal observed for a translocating peptide is significantly greater than that observed for the same peptide when the LUVs contain both trypsin and trypsin inhibitor, or when a peptide that does not spontaneously cross lipid membranes is exposed to trypsin-containing LUVs. This change in fluorescence provides a direct quantification of peptide translocation over time.

This protocol details a method for the quantitative measure of peptide translocation into large unilamellar lipid vesicles. This method also provides information about the rate of membrane translocation and can be used to identify peptides that efficiently and spontaneously cross lipid bilayers.

There is an active interest in peptides that readily cross cell membranes without the assistance of cell membrane receptors1.  Many of these are referred ...

Biology

Cell-Free Expression of Membrane Proteins in Giant Unilamellar Vesicles

Reconstitution of the Bacterial Glutamate Receptor Channel by Encapsulation of a Cell-Free Expression System

Cell-free expression (CFE) systems are powerful tools in synthetic biology that allow biomimicry of cellular functions like biosensing and energy regeneration in synthetic cells. Reconstruction of a wide range of cellular processes, however, requires successful reconstitution of membrane proteins into the membrane of synthetic cells. While the expression of soluble proteins is usually successful in common CFE systems, the reconstitution of membrane proteins in lipid bilayers of synthetic cells has proven to be challenging. Here, a method for reconstitution of a model membrane protein, bacterial glutamate receptor (GluR0), in giant unilamellar vesicles (GUVs) as model synthetic cells based on encapsulation and incubation of the CFE reaction inside synthetic cells is demonstrated. Utilizing this platform, the effect of substituting the N-terminal signal peptide of GluR0 with proteorhodopsin signal peptide on successful cotranslational translocation of GluR0 into membranes of hybrid GUVs is demonstrated. This method provides a robust procedure that will allow cell-free reconstitution of various membrane proteins in synthetic cells.

Author Spotlight: Membrane Protein Reconstitution in Synthetic Cells

This protocol describes the inverted emulsion method used to encapsulate a cell-free expression (CFE) system within a giant unilamellar vesicle (GUV) for the investigation of the synthesis and incorporation of a model membrane protein into the lipid bilayer.

Cell-free expression (CFE) systems are powerful tools in synthetic biology that allow biomimicry of cellular functions like biosensing and energy ...

Overview of Secretory Vesicles

Secretory vesicles, also known as dense core vesicles (DCVs), are membrane-bound vesicles that transport secretory proteins, such as hormones or neurotransmitters. Regulated secretory vesicles transport proteins from the trans-Golgi network to the exterior of the cell. Proteins present in regulated secretory vesicles are required to be rapidly exocytosed in large amounts upon a specific stimulus.
Various proteins regulate the aggregation of molecules inside the secretory vesicles. Chromogranins (Cgs) A and B are proteins that bind to soluble molecules present in secretory vesicles. This binding aggregates the soluble molecules, forming DCVs. Cgs function optimally at low pH and high intracellular calcium concentration. The low pH is maintained by the continuous pumping of protons by the V-type ATPases. A high concentration of calcium is present in the endoplasmic reticulum and Golgi complex of most mammalian cells. Hence, the secretory vesicles that bud off from the trans-Golgi network are rich in calcium. Calcium induces pH-dependent conformational changes in Cgs A and B. These conformational changes lead to the binding and aggregation of CgsA and B among other vesicular matrix proteins with the vesicular membrane. Aggregation is important for specific proteins to be sorted into regulated secretory vesicles.
The yeast Saccharomyces cerevisiae is a model system for studying the regulation of secretory vesicle-mediated transport. In 1979, Randy Schekman and Peter Novik generated temperature-sensitive mutants of S. cerevisiae. These mutants expressed proteins that were functional only at low temperatures but not at 37&#176;C. Schekman and Novik observed that these mutants accumulated vesicles and internal membranes. These mutants were also defective in different stages of protein secretion and therefore called them sec mutants. Some sec mutants contained vesicles that were unable to fuse with the plasma membrane, while other mutants could not transport proteins to other organelles. Further, molecular analysis of these mutants revealed 23 sec genes that produced proteins with regulatory roles in different transport stages of secretory vesicles.