This work was supported by &#34;The Sanitation Value Chain: Designing Sanitation Systems as Eco-Community Value System&#34; Project, ResearchInstitute for Humanity and Nature (RIHN, Project No.14200107).

1. Medium Preparation
<ol>
	<li>To make a cell culture medium (serum-containing medium), add 4.7 g of Eagle&#8217;s MEM powder to 500 mL of distilled water. Autoclave at 120 &#176;C for 20 min and let the medium cool to room temperature. Add fetal bovine serum (final concentration: 10%), L-Glutamine (2 mM), Penicillin Streptomycin (1%) and sodium bicarbonate (1.125 g/L). Store at 4 &#176;C for 1 month.</li>
	<li>Prepare the serum-free medium for the virus propagation as described in step 1.1, but without the fetal bovine serum. Store at 4 &#176;C for 1 month.</li>
	<li>For the plaque assay, sterilize 100 mL of Eagle&#8217;s MEM medium (non-containing phenol red) by autoclaving. Let the medium cool to room temperature, and then add 2% FBS, 2% Penicillin Streptomycin, 4 mM L-Glutamine, and 2.25 g/L NaHCO3. Store at 4 &#176;C.</li>
	<li>For the plaque assay, sterilize 100 mL of 2.5% agarose gel by autoclave. Prepare the gel the same day the plaque assay is conducted. Store the gel at 47 &#176;C in a water bath.</li>
</ol>
2. Cell Culture
<ol>
	<li>Remove a cryotube containing MA104 cell lines from the liquid nitrogen container. Place the cryotube in a water bath at 37 &#176;C to thaw the cells. Add 1 mL of the cell suspension to 20 mL of the serum-containing medium in a T75 flask. Incubate the flask in an incubator at 37 &#176;C and 5% CO2 for 2 or 3 days. 
	NOTE: The final cell concentration in the suspension is about 106 cells/mL.</li>
	<li>Once the cell monolayer reaches 80% confluency, remove the supernatant and wash the cells twice with 5 mL of 1x Dulbecco&#8217;s PBS (phosphate buffered saline).</li>
	<li>Add 4 mL of 0.05% trypsin-EDTA to the flask and incubate at 37 &#176;C for 5 min to detach the cells from the flask. Transfer the cell suspension to a 15 mL tube and centrifuge at 190 x g for 5 min.</li>
	<li>Discard the supernatant and resuspend the pelleted cells (106 cells) in 1 mL of serum-containing medium prepared in 1.1. Dilute the resuspended cells at 100-fold with the medium.</li>
	<li>Add 3 mL of the diluted cell suspension to each well of 6-well (for the plaque assay) or 24-well plates (for the cell-binding assay), respectively. Incubate the plates in an incubator at 37 &#176;C and 5% CO2 under the saturated vapor for 2 or 3 days. 
	NOTE: A T75 flask is suitable to collect the time-course samples because the sample volume of the supernatant (1 mL) can be ignored compared to the total supernatant volume (30 mL). Meanwhile, the infectious titer of the virus in each supernatant is measured by the plaque assay, which is usually conducted using a 6-well plate. A 24-well plate is utilized for the cell-binding assay.</li>
</ol>
3. Specific Growth Rate of Rotavirus
NOTE: Rhesus rotavirus (RRV, genotype: G3P[3]) is utilized in this protocol because RRV can rapidly and easily form plaques with MA104 cells.
<ol>
	<li>Place a tube containing 1 mL of the virus suspension (107 pfu/mL) in a serum-free medium stored at -80 &#176;C in a water bath at 37 &#176;C to thaw. Add 1 &#181;g/&#181;L trypsin from porcine pancreas to 1 mL of the virus suspension (final trypsin concentration is 4 &#181;g/mL) and then vortex. Incubate the virus suspension at 37 &#176;C and 5% CO2 under the saturated vapor for 30 min. 
	NOTE: Trypsin from the other sources can be used, but the effect on rotavirus infectivity needs to be tested in advance.</li>
	<li>Dilute the activated virus suspension with a serum-free medium to adjust the multiplicity of infection (MOI) to 0.1 pfu/cell.</li>
	<li>Add 1 mL of diluted virus suspension to MA104 cell lines (80% confluent) in a T75 flask 3 days after the cell plating (2.1), incubate at 37 &#176;C for 1 h, and gently shake the flask every 15 min.</li>
	<li>Then, add 30 mL of a serum-free medium containing 0.13 &#181;g/mL of trypsin from a porcine pancreas to the flask. Incubate the flask at 37 &#176;C and 5% CO2 under the saturated vapor.</li>
	<li>Collect 1 mL of the supernatant in the flask at 0, 6, 12, 18, 24, and 36 (and/or 48) h post-infection (hpi) and replace the supernatant in the 1.5 mL tubes using a pipette.</li>
	<li>Conduct the freeze (-80 &#176;C) and melt in a water bath at 37 &#176;C cycle three times. Then centrifuge the tubes at 12,600 x g for 10 min at 4 &#176;C. Collect the supernatant.</li>
	<li>Filter the supernatant with a distilled 0.2 &#181;m filter to remove the cell fraction. Store the supernatant -80 &#176;C in the refrigerator until applying it to the plaque assay for measuring the virus titer.</li>
	<li>Place the tubes containing the collected supernatant (step 3.5) in a water bath at 37 &#176;C. Add 4 &#181;g/mL trypsin to a 1 mL of 10-fold diluted sample and incubate at 37 &#176;C for 30 min.</li>
	<li>During the 30 min incubation in 3.8, to begin the plaque assay for measuring the virus titer obtained from time course samples (step 3.5), wash the MA104 cells twice in a 6-well plate with 2 mL of 1x PBS after removing the serum-containing medium.</li>
	<li>Serially dilute the incubated samples with a serum-free medium and inoculate 1 mL of the diluted sample into each well. Incubate the plate for 90 min at 37 &#176;C and 5% CO2 under the saturated vapor, and gently shake the plate every 15 min.</li>
	<li>After incubation, remove the inoculum from the 6-well plate. Add 4 &#181;g/mL trypsin to the medium prepared in (step 1.3). Gently but immediately add 3 mL of the medium mixed with agarose gel (the ratio is 1:1) to each well.</li>
	<li>Keep the plate at room temperature for more than 10 min (until the agarose gel becomes solid) and incubate for 2 days at 37 &#176;C and 5% CO2 under the saturated vapor. 
	NOTE: Pour the medium mixed with agar from the edge of the well.</li>
	<li>Add 1 mL of the 0.015% neutral red solution diluted with 1x PBS to each well and incubate at 37 &#176;C and 5% CO2 under the saturated vapor. Remove the dye after 3 h and incubate for 1 day at 37 &#176;C and 5% CO2 under the saturated vapor.</li>
	<li>The next day, count the number of plaques in each well and calculate the pfu/mL. Carefully check the cell confluence before the plaque assay to assure the plaque numbers.</li>
</ol>
4. Cell-binding Assay
NOTE: This protocol is based on Gilling&#8217;s report13.
<ol>
	<li>Add 1 &#181;g/&#181;L trypsin from a porcine pancreas to 1 mL of the virus suspension (final trypsin concentration is 4 &#181;g/mL) and then vortex (in the same manner as in 2.1). Dilute the virus suspension with a serum-free medium to adjust the MOI of 1 pfu/cell.</li>
	<li>Then, wash the MA104 cells twice on 24-well plate with 1 ml of Tris-buffered saline (TBS; 2.53 g/L Tris base, 6.54 g/L NaCl, 0.3 g/L KCl, 0.046 g/l Na2HPO4 to reach 1 L with distilled water).</li>
	<li>Inoculate 100 &#181;L of diluted virus suspension to each well of a 24-well plate with cells, and incubate at 4 &#176;C for 90 min, with gentle shaking every 15 min.</li>
	<li>Remove the virus inoculum and wash the cells twice with 1 mL of TBS. To extract the double-stranded (ds) RNA of the rotavirus, add 140 &#181;L of 1x PBS and 560 &#181;L of the RNA extraction buffer (see Table of Materials) to each well. Mix adequately with a pipette (about 10x or until the haze or contaminant of cells in the buffer is not seen).</li>
	<li>After recovering the double stranded RNA (dsRNA) according to the manufacturer&#8217;s protocol, place the 1.5 mL tubes containing the dsRNA extract on a heat block at 95 &#176;C for 5 min to denature the dsRNA, and then immediately place the tubes on ice and incubate for more than 2 min.</li>
	<li>Synthesize the cDNA by using a reverse transcription kit (see Table of Materials). Add 4 &#181;L of denatured viral RNA solution to a PCR tube containing 16 &#181;l of mixture (Table 1) and mix it carefully with a pipette so as not to generate bubbles. Spin down the tubes.</li>
	<li>Perform the reverse transcription with a thermal cycler under the condition shown in Table 2. If the cDNA is not used immediately, store the PCR tube containing the cDNA at -20 &#176;C for up to 1 year.</li>
	<li>Use the primers for quantitative PCR (Forward; 5&#8217;-ACCATCTACACATGACCCTC-3&#8217;, Reverse; 5&#8217;-GGTCACATAACGCCCC-3&#8217;)14 and a probe inserting a quencher (qPCR Probes; 5&#8217;-/FAM/ATGAGCACA/quencher/ATAGTTAAAAGCTAACACTGTCAA/TAMRA/-3&#8217;), targeting the 963 &#8211; 1049 region of NSP3 genome segment of rotavirus (ST3 strain, GenBank: X81436). 
	NOTE: Quencher is inserted into the probe designed by Zeng et al.14</li>
	<li>Dilute the standard plasmid serially (101 to 106 copies/mL) with PCR grade water to the qPCR mixture (Table 3) and make the master mix (20 &#181;L/sample) for qPCR following Table 4.</li>
	<li>Add 20 &#181;L of the master mix to the well of a 96-well PCR plate, and then mix 5 &#181;L of cDNA samples or 5 &#181;L of the standard plasmid by pipetting 10 times. Start the reaction of the qPCR system according to the conditions shown in Table 4.</li>
	<li>To calculate the rotavirus genome bound to the MA104 cell surface, conduct linear regression between Ct values and the known genome number of a standard plasmid, and estimate the sample&#8217;s genome number. Then calculate the ratio of virion numbers binding to cells (Gt) to those in the initial inoculum (G0).</li>
</ol>

<ol>
	<li>Domingo, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rna+Virus+Mutations.">Rna Virus Mutations.</a> Annual review of microbiology. 51, 151-178 (1997).</li><li>Gouvea, V., Brantly, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Is+rotavirus+a+population+of+reassortants?.">Is rotavirus a population of reassortants?.</a> Trends in Microbiology. 3, 159-162 (1995).</li><li>Rachmadi, A. T., Kitajima, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Free-chlorine+disinfection+as+a+selection+pressure+on+norovirus.">Free-chlorine disinfection as a selection pressure on norovirus.</a> Applied and Environmental Microbiology. 84, (2018).</li><li>Ghosh, S., Kobayashi, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-genomic+analysis+of+rotavirus+strains:+current+status+and+future+prospects.">Whole-genomic analysis of rotavirus strains: current status and future prospects.</a> Future Microbiology. 6, 1049-1065 (2011).</li><li>Tate, J. E., Burton, A. H., Boschi-Pinto, C., Steele, A. D., Duque, J., Parashar, U. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=2008+estimate+of+worldwide+rotavirus-associated+mortality+in+children+younger+than+5+years+before+the+introduction+of+universal+rotavirus+vaccination+programmes:+A+systematic+review+and+meta-analysis.">2008 estimate of worldwide rotavirus-associated mortality in children younger than 5 years before the introduction of universal rotavirus vaccination programmes: A systematic review and meta-analysis.</a> The Lancet Infectious Diseases. 12, 136-141 (2008).</li><li>Franco, M. A., Angel, J., Greenberg, H. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunity+and+correlates+of+protection+for+rotavirus+vaccines.">Immunity and correlates of protection for rotavirus vaccines.</a> Vaccine. 24, 2718-2731 (2006).</li><li>Santos, N., Hoshino, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+distribution+of+rotavirus+serotypes/+genotypes+and+its+implication+for+the+development+and+implementation+of+an+effective+rotavirus+vaccine.">Global distribution of rotavirus serotypes/ genotypes and its implication for the development and implementation of an effective rotavirus vaccine.</a> Reviews in Medical Virology. 15, 29-56 (2005).</li><li>Matthijnssens, J., Heylen, E., Zeller, M., Rahman, M., Lemey, P., Van Ranst, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phylodynamic+analyses+of+rotavirus+genotypes+G9+and+G12+underscore+their+potential+for+swift+global+spread.">Phylodynamic analyses of rotavirus genotypes G9 and G12 underscore their potential for swift global spread.</a> Molecular Biology and Evolution. 27, 2431-2436 (2010).</li><li>Mukhopadhya, I., Murdoch, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changing+molecular+epidemiology+of+rotavirus+infection+after+introduction+of+monovalent+rotavirus+vaccination+in+Scotland.">Changing molecular epidemiology of rotavirus infection after introduction of monovalent rotavirus vaccination in Scotland.</a> Vaccine. 35, 156-163 (2017).</li><li>Londrigan, S. L., Hewish, M. J., Thomson, M. J., Sanders, G. M., Mustafa, H., Coulson, B. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growth+of+rotaviruses+in+continuous+human+and+monkey+cell+lines+that+vary+in+their+expression+of+integrins.">Growth of rotaviruses in continuous human and monkey cell lines that vary in their expression of integrins.</a> Journal of General Virology. 81, 2203-2213 (2000).</li><li>Hewish, M. J., Takada, Y., Coulson, B. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrins+a2b1+and+a4b1+can+mediate+SA11+rotavirus+attachment+and+entry+into+cells.">Integrins a2b1 and a4b1 can mediate SA11 rotavirus attachment and entry into cells.</a> Journal of Virology. 74, 228-236 (2000).</li><li>Zwietering, M. H., Jongenburger, I., Rombouts, F. M., van't Riet, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+of+the+bacterial+growth+curve.">Modeling of the bacterial growth curve.</a> Applied and Environmental Microbiology. 56, 1875-1881 (1990).</li><li>Gilling, D. H., Kitajima, M., Torrey, J. R., Bright, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+antiviral+action+of+plant+antimicrobials+against+murine+norovirus.">Mechanisms of antiviral action of plant antimicrobials against murine norovirus.</a> Applied and Environmental Microbiology. 80, 4898-4910 (2014).</li><li>Zeng, S. Q., Halkosalo, A., Salminen, M., Szakal, E. D., Puustinen, L., Vesikari, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+quantitative+RT-PCR+for+the+detection+of+rotavirus+in+acute+gastroenteritis.">One-step quantitative RT-PCR for the detection of rotavirus in acute gastroenteritis.</a> Journal of Virological Methods. 153, 238-240 (2008).</li><li>Rolsma, M. D., Gelberg, H. B., Kuhlenschmidt, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assay+for+evaluation+of+rotavirus-cell+interactions:+identification+of+an+enterocyte+ganglioside+fraction+that+mediates+group+A+porcine+rotavirus+recognition.">Assay for evaluation of rotavirus-cell interactions: identification of an enterocyte ganglioside fraction that mediates group A porcine rotavirus recognition.</a> Journal of Virology. 68, 258-268 (1994).</li><li>Br&#252;ssow, H., Hilpert, H., Walther, I., Sidoti, J., Mietens, C., Bachmann, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bovine+milk+immunoglobulins+for+passive+immunity+to+infantile+rotavirus+gastroenteritis.">Bovine milk immunoglobulins for passive immunity to infantile rotavirus gastroenteritis.</a> Journal of Clinical Microbiology. 25, 982-986 (1987).</li><li>Outzen, H., Berglund, G. I., Smal&#229;s, A. O., Willassen, N. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temperature+and+pH+sensitivity+of+trypsins+from+Atlantic+salmon+(Salmo+salar)+in+comparison+with+bovine+and+porcine+trypsin.">Temperature and pH sensitivity of trypsins from Atlantic salmon (Salmo salar) in comparison with bovine and porcine trypsin.</a> Comparative Biochemistry and Physiology - B Biochemistry and Molecular Biology. 115B, 33-45 (1996).</li><li>Saxena, K., Blutt, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+Intestinal+Enteroids:+a+New+Model+To+Study+Human+Rotavirus+Infection,+Host+Restriction,+and+Pathophysiology.">Human Intestinal Enteroids: a New Model To Study Human Rotavirus Infection, Host Restriction, and Pathophysiology.</a> Journal of Virology. 90, 43-56 (2016).</li><li>Yin, Y., Bijvelds, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+rotavirus+infection+and+antiviral+therapy+using+primary+intestinal+organoids.">Modeling rotavirus infection and antiviral therapy using primary intestinal organoids.</a> Antiviral Research. 123, 120-131 (2015).</li></ol>

The authors have nothing to disclose.

Our protocol for measuring the specific growth rate is easier than previous ones and can be adapted for other viruses unless their cell culture system has not yet been established. In this study, we used RRV (G3P[3]) because this strain can form plaques easier than human rotaviruses when using MA104 cell lines. Some human rotavirus strains cannot form plaque in this cell line. Therefore, instead of the plaque assay, the focus forming unit (FFU) assay15 or median tissue culture infectious dose (TCID50) assay can be applied for many rotavirus strains16. The presented protocol for determining the specific growth rate can be used for other virus types but is not suitable for viruses for which no established cell culture system is established. Before starting the experiment for the specific growth rate, it is better to know in advance when the virus infectious titer starts to increase and reaches the stationary phase in a preliminary test. If too many plaques are present, the plaque assay should be conducted again after changing the dilution rate of the virus samples. The hours post-infection (hpi) to collect samples are also important because the slope of the exponential growth phase may be underestimated if the proper time point to reach the stationary phase is missed. In the approximation by the modified Gompertz model, a coefficient of determination should always be calculated and checked. If the fitness to the modified Gompertz model is low, other growth models such as the modified logistic model12 may be preferable.
In handling cells, when removing the medium or virus inoculum, the PBS for washing or agarose gel for plaque assay must be promptly added to each well of a cell culture plate to prevent the cells from dryness. At the same time, you must gently pour PBS or agarose to cells not to detach from wells. This step is the most important in both assays (step 3.9 and 3.11). If the plaque assay has too many samples, we recommend subdividing the agarose gel (100 mL each maximum is recommended) into several medium bottles and keeping the bottles warm until just before use since agarose gel is solidified within about 10 min at room temperature. Since trypsin is vulnerable to high temperatures17, a trypsin solution should be added to a medium and agarose for the plaque assay after adequately cooling down.
In the cell-binding assay, the incubation for virus binding to cells must be done at 4 &#176;C to prevent invasion of the cells. According to Gilling&#39;s method13, cells are prone to drying at low temperatures, so gentle shaking is necessary every 15 min during incubation. The RNA extraction kit utilized here can be substituted for other kits. The slope of the standard curve in RT-qPCR should be approximately 3.3, and the coefficient of determination should be more than 0.98. Compared to the fluorescence microscope to visualize the localization of viruses in cells, the assay is more rapid and easier to use because binding of fluorescent substances to viruses is not necessary.
Recently, human intestinal enteroid (HIE), exhibiting a similar cellular composition and function as human gastrointestinal epithelium, has become available for rotavirus propagation18. The use of HIE may enable us to evaluate the specific growth rate and cell-binding ability of non-culturable strains of rotavirus. Also, both experiments described here may be applied to the evaluation of drug effects on both phenotypes19. The protocols presented here make it possible to quantitatively discuss the changes in phenotype parameter values of rotavirus strains under varied conditions.

RNA viruses form a genetically diverse population, known as quasispecies1, because of their mutation rate,2 which is higher than that of DNA-based organisms. Population structure in quasispecies is affected by the population genetic factors, including mutation, selection pressure, and genetic drift. Strains within a single genetic lineage may show different phenotypes because of the genetic diversity. For example, Rachmadi et al. showed that free chlorine sensitivity was different among murine norovirus strains that originated from a plaque-purified strain S7-PP33.
Rotaviruses (genus rotavirus in reoviridae family) are non-enveloped ds RNA viruses forming quasispecies2. In addition to the population genetic factors described above, genome reassortment affects the genetic diversity of rotavirus because this virus has 11 segmented genomes4. Rotaviruses cause diarrhea mainly among infants, and infant deaths in 2013 were estimated about 250,0005. Two vaccines are in use in several countries and have been effective in reducing the burden of rotavirus infection, but some researchers are now discussing the presence of vaccine-escape mutants6,7,8,9. The characterization of these mutants is important to understand the vaccine-escape mechanisms.
Here, we present protocols for two assays for evaluating the specific growth rate and cell-binding ability of rotavirus in order to understand the phenotypic differences among strains/mutants. The growth curve of rotaviruses has been presented in previous reports10, but growth parameters such as specific growth rate are not usually measured. A cell-binding assay conducted previously involves the immunofluorescent staining technique11. We show here easier methods of using the plaque assay and RT-qPCR, which allow us to quantitatively discuss the difference in viral phenotypes. These methods are appropriate for the characterization of rotavirus phenotypes and may finally contribute to the construction of new vaccines effective for multiple genotypes.

<table>
	<tbody>
		<tr>
			<td>7500 Real Time PCR System</td>
			<td>Applied Biosystems</td>
			<td></td>
			<td>qPCR</td>
		</tr>
		<tr>
			<td>Agar-EPI</td>
			<td>Nakalai Tesque, Inc</td>
			<td>01101-34</td>
			<td>Plaque assay</td>
		</tr>
		<tr>
			<td>Disodium Hydrogenphosphate</td>
			<td>Wako Pure Chemical Corporation</td>
			<td>194-02875</td>
			<td>Cell binding assay</td>
		</tr>
		<tr>
			<td>Eagle&#39;s MEM &#34;Nissui&#34; <img alt="One" src="/files/ftp_upload/58821/01.jpg" /></td>
			<td>Nissui Pharmaceutical Co., Ltd</td>
			<td>_05900</td>
			<td>Cell culture</td>
		</tr>
		<tr>
			<td>Eagle&#39;s MEM &#34;Nissui&#34; <img alt="Two" src="/files/ftp_upload/58821/02.jpg" /></td>
			<td>Nissui Pharmaceutical Co., Ltd</td>
			<td>_05901</td>
			<td>Plaque assay</td>
		</tr>
		<tr>
			<td>EasYFlask 75 cm2</td>
			<td>Thermo Scientific</td>
			<td>156499</td>
			<td>Cell culture</td>
		</tr>
		<tr>
			<td>Fetal bovine Serim, qualified, USDA-approved regions</td>
			<td>Gibco</td>
			<td>10437028</td>
			<td>Cell culture and Plaque assay</td>
		</tr>
		<tr>
			<td>Forward / Reverse primers</td>
			<td>Eurofins Genomics</td>
			<td></td>
			<td>qPCR</td>
		</tr>
		<tr>
			<td>L-Glutamine, 200 mM Solution</td>
			<td>Gibco</td>
			<td>2530081</td>
			<td>Cell culture and Plaque assay</td>
		</tr>
		<tr>
			<td>Neutral Red</td>
			<td>Wako Pure Chemical Corporation</td>
			<td>140-00932</td>
			<td>Plaque assay</td>
		</tr>
		<tr>
			<td>PBS (-) &#34;Nissui&#34;</td>
			<td>Nissui Pharmaceutical Co., Ltd</td>
			<td>_05913</td>
			<td>Cell culture and Plaque assay</td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin, Liguid</td>
			<td>Gibco</td>
			<td>15140122</td>
			<td>Cell culture and Plaque assay</td>
		</tr>
		<tr>
			<td>Potassium Chloride</td>
			<td>Wako Pure Chemical Corporation</td>
			<td>163-03545</td>
			<td>Cell binding assay</td>
		</tr>
		<tr>
			<td>Premix ExTaq (Perfect Real Time)</td>
			<td>TAKARA Bio Inc.</td>
			<td>RR039A</td>
			<td>qPCR</td>
		</tr>
		<tr>
			<td>PrimeScriptTN RT reagent Kit (Perfect Real Time)</td>
			<td>TAKARA Bio Inc.</td>
			<td>RR037A</td>
			<td>cDNA synthesis</td>
		</tr>
		<tr>
			<td>PrimeTime qPCR Probes</td>
			<td>Medical and Biological Laboratories Co., Ltd.</td>
			<td></td>
			<td>qPCR</td>
		</tr>
		<tr>
			<td>QIAamp Viral RNA Mini Kit</td>
			<td>QIAGEN</td>
			<td>52904</td>
			<td>RNA extraction</td>
		</tr>
		<tr>
			<td>Sodium Bicarbonate</td>
			<td>Wako Pure Chemical Corporation</td>
			<td>199-05985</td>
			<td>Cell culture and Plaque assay</td>
		</tr>
		<tr>
			<td>Sodium Chloride</td>
			<td>Wako Pure Chemical Corporation</td>
			<td>198-01675</td>
			<td>Cell binding assay</td>
		</tr>
		<tr>
			<td>Tissue culture plates 24-well plate</td>
			<td>TPP</td>
			<td>92024</td>
			<td>Cell binding assay</td>
		</tr>
		<tr>
			<td>Tissue culture plates 6-well plate</td>
			<td>TPP</td>
			<td>92006</td>
			<td>Plaque assay</td>
		</tr>
		<tr>
			<td>Trizma base</td>
			<td>SIGMA-ALDRICH</td>
			<td>T1503</td>
			<td>Cell binding assay</td>
		</tr>
		<tr>
			<td>Trypsin from porcine pancrease</td>
			<td>SIGMA-ALDRICH</td>
			<td>T0303-1G</td>
			<td>Activate for rotavirus</td>
		</tr>
		<tr>
			<td>Trypsin-EDTA (0.05 %), phenol red</td>
			<td>Gibco</td>
			<td>25300054</td>
			<td>Cell culture</td>
		</tr>
		<tr>
			<td>Vertical 96-Well Thermal Cycler</td>
			<td>Applied Biosystems</td>
			<td></td>
			<td>cDNA synthesis</td>
		</tr>
	</tbody>
</table>

assays for the specific growth rate and cell-binding ability of rotavirus

Rotavirus is the main etiological factor for infantile diarrhea. It is a double-stranded (ds) RNA virus and forms a genetically diverse population, known as quasispecies, owing to their high mutation rate. Here, we describe how to measure the specific growth rate and the cell-binding ability of rotavirus as its phenotypes. Rotavirus is treated with trypsin to recognize the cell receptor and then inoculated into MA104 cell culture. The supernatant, including viral progenies, is collected intermittently. The plaque assay is used to confirm the virus titer (plaque-forming unit: pfu) of each collected supernatant. The specific growth rate is estimated by fitting time-course data of pfu/mL to the modified Gompertz model. In the assay of cell-binding, MA104 cells in a 24-well plate are infected with rotavirus and incubated for 90 min at 4 &#176;C for rotavirus adsorption to cell receptors. A low temperature restrains rotavirus from invading the host cell. After washing to remove unbound virions, RNA is extracted from virions attached to cell receptors followed by cDNA synthesis and reverse-transcription quantitative PCR (RT-qPCR). These protocols can be applied for investigating the phenotypic differences among viral strains.

An overview of two protocols for the specific growth rate and cell-binding assay of plaque- purified RRV strains is shown in Figure 1A and 2A, respectively.
In the assay for the specific growth rate, the final virus titer reaches more than 107 pfu/mL when propagating on the T75 flask. If the maximum concentration is lower than 107 pfu/mL, the MA104 cell may not have become confluent or RRV was not activated well by trypsin. Some growth models are available for estimating the specific growth rate using the infectious unit data. In this protocol, the modified Gompertz model12 is employed as an example; 
<img alt="Equation" src="/files/ftp_upload/58821/58821eq1.jpg" />
where N0 (104 pfu/mL in this study) and Nt (104 to 108 pfu/mL) are the virus infectious titer (pfu/mL) at 0 and t (example: 0, 6, 12, 18, 24, 36) hpi, respectively, A is the asymptotic value [log(N&#8734;/N0)] (example: 3 to 4), &#181; is the specific growth rate [1/h], e is the Napier&#39;s constant and &#955; is the lag period [h]. Model parameters are obtained by the solver function of the analysis software, which minimizes the sum of squares of the difference between the observed and modeled values. In the example in Figure 1B, the specific growth rate (&#181;) is estimated to be 0.197 [1/h] and the lag period (&#955;) is 6.61 [h] by applying the least square method to a modified Gompertz model, and the relative virus titer at the stationary phase to the initial titer (log scale) (A) is 3.15 [log (N&#8734;/N0)]. We have tested 6 rotavirus clones in total, and the estimated values of the specific growth rate ranged from 0.19 to 0.27 [1/h]. These estimated values are reliable because the coefficient of determination values in the model fitting is more than 0.98.
RRV virions binding to cell surfaces were about 103 copies/mL (binding efficiency was around 1%) when using a 24-well plate for the cell-binding assay (Figure 2B). The assay is usually conducted three times for every sample, and if a large variance in the copy number is observed in a sample, some problems such as over-washing and insufficient activation of RRV by trypsin may occur. The Ct value of qPCR exceeding about 36.0 is not preferable and is regarded to be below a detection limit in our qPCR condition.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td>Volume/ 1 reaction</td>
		</tr>
		<tr>
			<td>5 x PrimeScript Buffer</td>
			<td>4.0 &#181;L</td>
		</tr>
		<tr>
			<td>PrimeScript RT Enzyme Mix I</td>
			<td>1.0 &#181;L</td>
		</tr>
		<tr>
			<td>Oligo dT Primer</td>
			<td>1.0 &#181;L</td>
		</tr>
		<tr>
			<td>Random 6 mers</td>
			<td>4.0 &#181;L</td>
		</tr>
		<tr>
			<td>Deionized distilled water</td>
			<td>6.0 &#181;L</td>
		</tr>
		<tr>
			<td>ssRNA sample</td>
			<td>4.0 &#181;L</td>
		</tr>
		<tr>
			<td>Total</td>
			<td>20.0 &#181;L</td>
		</tr>
	</tbody>
</table>
Table 1: Master mix composition for cDNA synthesis of rotavirus genome.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Temperature [&#176;C]</td>
			<td>Time</td>
		</tr>
		<tr>
			<td>37</td>
			<td>15 min</td>
		</tr>
		<tr>
			<td>42</td>
			<td>15 min</td>
		</tr>
		<tr>
			<td>85</td>
			<td>5 s</td>
		</tr>
		<tr>
			<td>4</td>
			<td>&#8734;</td>
		</tr>
	</tbody>
</table>
Table 2: Reaction condition for cDNA synthesis of rotavirus genome.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td>Volume/1 reaction</td>
		</tr>
		<tr>
			<td>Premix Taq</td>
			<td>12.5 &#181;L</td>
		</tr>
		<tr>
			<td>Forward primer (10 &#181;M)</td>
			<td>0.5 &#181;L</td>
		</tr>
		<tr>
			<td>Reverse primer (10 &#181;M)</td>
			<td>0.5 &#181;L</td>
		</tr>
		<tr>
			<td>Probe (10 &#181;M)</td>
			<td>0.5 &#181;L</td>
		</tr>
		<tr>
			<td>Reference Dye II</td>
			<td>0.5 &#181;L</td>
		</tr>
		<tr>
			<td>Deionized distilled water</td>
			<td>5.5 &#181;L</td>
		</tr>
		<tr>
			<td>cDNA sample</td>
			<td>5.0 &#181;L</td>
		</tr>
		<tr>
			<td>Total</td>
			<td>25 &#181;L</td>
		</tr>
	</tbody>
</table>
Table 3: Master mix composition for quantitative PCR of rotavirus A genome.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Temperature [&#176;C]</td>
			<td>Time</td>
			<td></td>
		</tr>
		<tr>
			<td>95</td>
			<td>5 min</td>
			<td></td>
		</tr>
		<tr>
			<td>94</td>
			<td>20 s</td>
			<td rowspan="2">45 cycle</td>
		</tr>
		<tr>
			<td>60</td>
			<td>1 min</td>
		</tr>
		<tr>
			<td>72</td>
			<td>5 min</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 4: Reaction condition for quantitative PCR of rotavirus A genome.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58821/58821fig1.jpg" /> 
Figure 1: Schematic overview of the estimation of rotavirus growth and the growth curve of rotavirus.&#160;(A) The infectious unit of rotavirus is measured with the plaque assay. (B) The curve (blue line) was approximated by the modified Gompertz model based on observed data in our laboratory (white circle). The specific growth rate [&#181;]; 0.197 [h-1], lag period (&#955;); 6.61 [h], the relative virus titer at the stationary phase to the initial titer (log scale) (A); 3.15 [log (N&#8734;/N0)]. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/58821/58821fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/58821/58821fig2.jpg" /> 
Figure 2: Schematic overview and representative result of the cell-binding assay of five RRV strains purified from plaques in our laboratory.&#160;(A) A cell culture plate inoculated with rotavirus is incubated at 4 &#176;C for inhibiting the virus invasion into cells. After incubation and removing the unbound viral particles to cells, quantify the number of genomes originating from bound viral particles to the cell surface with RT-qPCR. (B) The result of the cell-binding assay was displayed as binding efficiency (%), which was the ratio of bound viral particles to those present in the inoculum. Bold bar: median, end of boxes: quartile deviation, end of line: maximum and minimum. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/58821/58821fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Assays for the Specific Growth Rate and Cell-binding Ability of Rotavirus at JoVE.com

Assays for the Specific Growth Rate and Cell-binding Ability of Rotavirus

Here we present two protocols, one for measuring the specific growth rate and the other for the cell-binding ability of rotavirus using the plaque assay and RT-qPCR. These protocols are available for confirming the differences in phenotypes between rotavirus strains.

Rotavirus is the main etiological factor for infantile diarrhea. It is a double-stranded (ds) RNA virus and forms a genetically diverse population, known ...

assays-for-specific-growth-rate-cell-binding-ability

Research

JoVE Journal

Immunology and Infection

8.5K Views.  Tohoku University. Here we present two protocols, one for measuring the specific growth rate and the other for the cell-binding ability of rotavirus using the plaque assay and RT-qPCR. These protocols are available for confirming the differences in phenotypes between rotavirus strains.

Video: Assays for the Specific Growth Rate and Cell-binding Ability of Rotavirus

Assays for the Identification of Novel Antivirals against Bluetongue Virus

To identify potential antivirals against BTV, we have developed, optimized and validated three assays presented here. The CPE-based assay was the first assay developed to evaluate whether a compound showed any antiviral efficacy and have been used to screen large compound library. Meanwhile, cytotoxicity of antivirals could also be evaluated using the CPE-based assay. The dose-response assay was designed to determine the range of efficacy for the selected antiviral, i.e. 50% inhibitory concentration (IC50) or effective concentration (EC50), as well as its range of cytotoxicity (CC50). The ToA assay was employed for the initial MoA study to determine the underlying mechanism of the novel antivirals during BTV viral lifecycle or the possible effect on host cellular machinery. These assays are vital for the evaluation of antiviral efficacy in cell culture system, and have been used for our recent researches leading to the identification of a number of novel antivirals against BTV.

Three assays, including the cytopathic effect (CPE)-based assay, dose-response assay and Time-of-Addition (ToA) assay have been developed, optimized, validated and utilized to identify novel antivirals against Bluetongue virus (BTV), as well as to determine the possible Mechanism-of-Action (MoA) for newly identified antivirals.

To identify potential antivirals against BTV, we have  developed, optimized and validated three assays presented here. The CPE-based  assay was the first ...

ScanLag: High-throughput Quantification of Colony Growth and Lag Time

Growth dynamics are fundamental characteristics of microorganisms. Quantifying growth precisely is an important goal in microbiology. Growth dynamics are affected both by the doubling time of the microorganism and by any delay in growth upon transfer from one condition to another, the lag. The ScanLag method enables the characterization of these two independent properties at the level of colonies originating each from a single cell, generating a two-dimensional distribution of the lag time and of the growth time. In ScanLag, measurement of the time it takes for colonies on conventional nutrient agar plates to be detected is automated on an array of commercial scanners controlled by an in house application. Petri dishes are placed on the scanners, and the application acquires images periodically. Automated analysis of colony growth is then done by an application that returns the appearance time and growth rate of each colony. Other parameters, such as the shape, texture and color of the colony, can be extracted for multidimensional mapping of sub-populations of cells. Finally, the method enables the retrieval of rare variants with specific growth phenotypes for further characterization. The technique could be applied in bacteriology for the identification of long lag that can cause persistence to antibiotics, as well as a general low cost technique for phenotypic screens.

ScanLag is a high-throughput method for measuring the delay in growth, namely lag time, as well as the growth rate of colonies for thousands of cells in parallel. Screening using ScanLag enables the discrimination between long lag-time and slow growth at the level of a single variant.

Growth dynamics are fundamental characteristics of microorganisms. Quantifying growth precisely is an important goal in microbiology. Growth dynamics are ...

Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens

Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the absence of effective control clinical coccidiosis can be devastating. Resistance to the chemoprophylactics frequently used to control Eimeria is common and sub-clinical infection is widespread, influencing feed conversion ratios and susceptibility to other pathogens such as Clostridium perfringens. Despite the availability of polymerase chain reaction (PCR)-based tools, diagnosis of Eimeria infection still relies almost entirely on traditional approaches such as lesion scoring and oocyst morphology, but neither is straightforward. Limitations of the existing molecular tools include the requirement for specialist equipment and difficulties accessing DNA as template. In response a simple field DNA preparation protocol and a panel of species-specific loop-mediated isothermal amplification (LAMP) assays have been developed for the seven Eimeria recognised to infect the chicken. We now provide a detailed protocol describing the preparation of genomic DNA from intestinal tissue collected post-mortem, followed by setup and readout of the LAMP assays. Eimeria species-specific LAMP can be used to monitor parasite occurrence, assessing the efficacy of a farm&#8217;s anticoccidial strategy, and to diagnose sub-clinical infection or clinical disease with particular value when expert surveillance is unavailable.

Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens

Diagnosis of Eimeria infection in chickens remains demanding. Parasite morphology- and host pathology-led approaches are commonly inconclusive, while molecular approaches based on PCR have proven demanding in cost and expertise. The aim of this protocol is to establish loop-mediated isothermal amplification (LAMP) as a straightforward molecular diagnostic for eimerian infection.

Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the ...

Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses

In vitro fitness assays are essential tools for determining viral replication fitness for viruses such as HIV-1. Various measurements have been used to extrapolate viral replication fitness, ranging from the number of viral particles per infectious unit, growth rate in cell culture, and relative fitness derived from multiple-cycle growth competition assays. Growth competition assays provide a particularly sensitive measurement of fitness since the viruses are competing for cellular targets under identical growth conditions. There are several experimental factors to consider when conducting growth competition assays, including the multiplicity of infection (MOI), sampling times, and viral detection and fitness calculation methods. Each factor can affect the end result and hence must be considered carefully during the experimental design. The protocol presented here includes steps from constructing a new recombinant HIV-1 clone to performing growth competition assays and analyzing the experimental results. This protocol utilizes experimental parameter values previously shown to yield consistent and robust results. Alternatives are discussed, as some parameters need to be adjusted according to the cell type and viruses being studied. The protocol contains two alternative viral detection methods to provide flexibility as the availability of instruments, reagents and expertise varies between laboratories.

Growth competition between nearly isogenic viruses provides a sensitive measurement for determining relative replication fitness. The protocols described here include the construction of recombinant HIV-1 clones, virus propagation and growth competition and analysis methods optimized to yield sensitive and consistent results.

In vitro fitness assays are essential tools for determining viral replication fitness for viruses such as HIV-1. Various measurements have been used to ...

Early Viral Entry Assays for the Identification and Evaluation of Antiviral Compounds

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic approach to identify and evaluate antiviral agents that target specific steps of the viral entry. In this report, the methods of examining viral inactivation, viral attachment, and viral entry/fusion as antiviral assays for such purposes are described, using hepatitis C virus as a model. These assays should be useful for discovering novel antagonists/inhibitors to early viral entry and help expand the scope of candidate antiviral agents for further drug development.

Here, we present a protocol that examines specific steps of the viral entry to identify and evaluate novel antiviral agents.

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic ...

Qualitative and Quantitative Assays for Detection and Characterization of Protein Antimicrobials

Initial evaluations of large microbial libraries for potential producers of novel antimicrobial proteins require both qualitative and quantitative methods to screen for target enzymes prior to investing greater research effort and resources. The goal of this protocol is to demonstrate two complementary assays for conducting these initial evaluations. The microslide diffusion assay provides an initial or simple detection screen to enable the qualitative and rapid assessment of proteolytic activity against an array of both viable and heat-killed bacterial target substrates. As a counterpart, the increased sensitivity and reproducibility of the dye-release assay provides a quantitative platform for evaluating and comparing environmental influences affecting the hydrolytic activity of protein antimicrobials. The ability to label specific heat-killed cell culture substrates with Remazol brilliant blue R dye expands this capability to tailor the dye-release assay to characterize enzymatic activity of interest.

Here, we present protocols to rapidly screen and characterize enzymes for antimicrobial activity. The microslide diffusion assay and the dye-release assay utilize target bacterial substrates for qualitative and quantitative enzymatic activity evaluation.

Initial evaluations of large microbial libraries for potential producers of novel antimicrobial proteins require both qualitative and quantitative methods ...

Fast and Specific Assessment of the Halogenating Peroxidase Activity in Leukocyte-enriched Blood Samples

In this paper a protocol for the quick and standardized enrichment of leukocytes from small whole blood samples is described. This procedure is based on the hypotonic lysis of erythrocytes and can be applied to human samples as well as to blood of non-human origin. The small initial sample volume of about 50 to 100 &#181;l makes this method applicable to recurrent blood sampling from small laboratory animals. Moreover, leukocyte enrichment is achieved within minutes and with low material efforts regarding chemicals and instrumentation, making this method applicable in multiple laboratory environments.
Standardized purification of leukocytes is combined with a highly selective staining method to evaluate halogenating peroxidase activity of the heme peroxidases, myeloperoxidase (MPO) and eosinophil peroxidase (EPO), i.e., the formation of hypochlorous and hypobromous acid (HOCl and HOBr). While MPO is strongly expressed in neutrophils, the most abundant immune cell type in human blood as well as in monocytes, the related enzyme EPO is exclusively expressed in eosinophils. The halogenating activity of these enzymes is addressed by using the almost HOCl- and HOBr-specific dye aminophenyl fluorescein (APF) and the primary peroxidase substrate hydrogen peroxide. Upon subsequent flow cytometry analysis all peroxidase-positive cells (neutrophils, monocytes, eosinophils) are distinguishable and their halogenating peroxidase activity can be quantified. Since APF staining may be combined with the application of cell surface markers, this protocol can be extended to specifically address leukocyte sub-fractions. The method is applicable to detect HOCl and HOBr production both in human and in rodent leukocytes.
Given the widely and diversely discussed immunological role of these enzymatic products in chronic inflammatory diseases, this protocol may contribute to a better understanding of the immunological relevance of leukocyte-derived heme peroxidases.

This protocol describes the quick enrichment of leukocytes from small blood samples for a subsequent specific determination of the halogenating peroxidase activity within the cells. The method can be applied to human and non-human material and may contribute to the evaluation of new inflammatory markers.

In this paper a protocol for the quick and standardized enrichment of leukocytes from small whole blood samples is described. This procedure is based on ...

Assays for Studying the Role of Vitronectin in Bacterial Adhesion and Serum Resistance

Bacteria utilize complement regulators as a means of evading the host immune response. Here, we describe protocols for evaluating the role vitronectin acquisition at the bacterial cell surface plays in resistance to the host immune system. Flow cytometry experiments identified human plasma vitronectin as a ligand for the bacterial receptor outer membrane protein H of Haemophilus influenzae type f. An enzyme-linked immunosorbent assay was employed to characterize the protein-protein interactions between purified recombinant protein H and vitronectin, and binding affinity was assessed using bio-layer interferometry. The biological importance of the binding of vitronectin to protein H at the bacterial cell surface in evasion of the host immune response was confirmed using a serum resistance assay with normal and vitronectin-depleted human serum. The importance of vitronectin in bacterial adherence was analyzed using glass slides with and without vitronectin coating, followed by Gram staining. Finally, bacterial adhesion to human alveolar epithelial cell monolayers was investigated. The protocols described here can be easily adapted to the study of any bacterial species of interest.

This report describes protocols for characterizing interactions between bacterial outer membrane proteins and the human complement regulator vitronectin. The protocols can be used to study the binding reactions and biological function of vitronectin in any bacterial species.

Bacteria utilize complement regulators as a means of evading the host immune response. Here, we describe protocols for evaluating the role vitronectin ...

Screening Assays to Characterize Novel Endothelial Regulators Involved in the Inflammatory Response

The endothelial layer is essential for maintaining homeostasis in the body by controlling many different functions. Regulation of the inflammatory response by the endothelial layer is crucial to efficiently fight against harmful inputs and aid in the recovery of damaged areas. When the endothelial cells are exposed to an inflammatory environment, such as the outer component of gram-negative bacteria membrane, lipopolysaccharide (LPS), they express soluble pro-inflammatory cytokines, such as Ccl5, Cxcl1 and Cxcl10, and trigger the activation of circulating leukocytes. In addition, the expression of adhesion molecules E-selectin, VCAM-1 and ICAM-1 on the endothelial surface enables the interaction and adhesion of the activated leukocytes to the endothelial layer, and eventually the extravasation towards the inflamed tissue. In this scenario, the endothelial function must be tightly regulated because excessive or defective activation in the leukocyte recruitment could lead to inflammatory-related disorders. Since many of these disorders do not have an effective treatment, novel strategies with a focus on the vascular layer must be investigated. We propose comprehensive assays that are useful to the search of novel endothelial regulators that modify leukocyte function. We analyze endothelial activation by using specific expression targets involved in leukocyte recruitment (such as, cytokines, chemokines, and adhesion molecules) with several techniques, including: real-time quantitative polymerase chain reaction (RT-qPCR), western-blot, flow cytometry and adhesion assays. These approaches determine endothelial function in the inflammatory context and are very useful to perform screening assays to characterize novel endothelial inflammatory regulators that are potentially valuable for designing new therapeutic strategies.

Vascular endothelium tightly controls leukocyte recruitment. Inadequate leukocyte extravasation contributes to human inflammatory diseases. Therefore, searching for novel regulatory elements of endothelial activation is necessary to design improved therapies for inflammatory disorders. Here, we describe a comprehensive methodology to characterize novel endothelial regulators that can modify leukocyte trafficking during inflammation.

The endothelial layer is essential for maintaining homeostasis in the body by controlling many different functions. Regulation of the inflammatory ...

Electrochemiluminescence Assays for Human Islet Autoantibodies

Pinpointing islet autoantibodies associated with type 1 diabetes (T1D) leads the way to project and deter this disease in the general population. A novel ECL assay is a nonradioactive fluid phase assay for islet autoantibodies with higher sensitivity and specificity than the current 'gold' standard radio-binding assay (RBA). ECL assays can more precisely define the onset of presymptomatic T1D by distinguishing the high-risk, high-affinity autoantibodies from the low-risk, low-affinity autoantibodies generated in RBAs, and conventional enzyme-linked immunosorbent assays (ELISA). The antigen protein used in this ECL assay is labeled with Sulfo-tag and Biotin, respectively. Each ECL autoantibody assay that uses a particular antigen protein needs an optimization step before it can be used for laboratory application. This step is especially vital in determining the requirements for serum acid treatments, concentrations, and ratios of the two different antigens labeled with Sulfo-tag and Biotin. To perform the assay, serum samples are mixed with Sulfo-tag-conjugated and biotinylated capture antigen protein in phosphate buffered solution (PBS), containing 5% Bovine Serum Albumin (BSA). Afterwards, the samples are incubated overnight at 4 &#176;C. The same day, a streptavidin-coated plate is prepared with blocker buffer and incubated overnight at 4 &#176;C. On the second day, wash the streptavidin plate and transfer the serum-antigen mixture onto the plate. Place the plate on the plate shaker, set it at low speed, and incubate at room temperature for 1 h. Subsequently, the plate is washed again, and reader buffer is added. The plate is then counted on the plate reader machine. The results are conveyed through an index, which is generated from internal standard positive and negative control serum samples.

Here, we presented the methods to detect human islet autoantibodies using electrochemiluminescence (ECL) assays. The protocol, used to predict type 1 diabetes, can be expanded upon to detect autoantibodies for other autoimmune diseases.

Pinpointing islet autoantibodies associated with type 1 diabetes (T1D) leads the way to project and deter this disease in the general population. A novel ...