The authors wish to thank Kami Harris for primer design, Ashley McKibbon and Jessica Thomas-Ebbett for filming, and John Blakely, Alexandra Foley-Eby, Chris Langley, Julie Lewis, Kelsey McIntyre, Ashley McKibbon, Chris Zinck, and Rosie the dog for appearing in the video. A. M. K. was supported by the Canadian Lyme Disease Research Foundation, and project funding was provided by the Natural Sciences and Engineering Research Council of Canada (NSERC). M. K. B. W. received salary funding from the New Brunswick Innovation Foundation (NBIF).

1. DNA Isolation from Ticks
<ol>
	<li>Acquire ticks via field collection, or passive surveillance from veterinarians and members of the public. Ticks should be killed by freezing, placed in a sealed bag, and mailed at room temperature.
	<ol>
		<li>Using a submission form, gather information on the date and geographic location of the encounter, tick attachment status, host species, and recent travel history of the host.</li>
		<li>Since nested PCR is inherently vulnerable to contamination, ensure that the laboratory workspace is set up to minimize cross-exposure of samples. This involves executing different elements of the protocol in separate, dedicated spaces well isolated from each other that are thoroughly cleaned and sterilized, and ensuring that all instruments are free of contaminants.</li>
		<li>Upon receiving the specimen, photograph the tick and determine species, developmental stage, sex, and engorgement status by comparison to an identification key32 .</li>
		<li>Under aseptic conditions, bisect the tick using a sterile razor blade or scalpel, and place the two tick fragments into separate microcentrifuge tubes.</li>
	</ol>
	</li>
	<li>To extract total DNA, use any isolation procedure that yields PCR-compatible template; this protocol demonstrates a simple chelation-based approach.
	<ol>
		<li>Begin by adding an appropriate volume (often between 50 - 200 &#181;L) of a lytic chelation reagent to the tick fragment. The specific amount will depend on the specimen size and engorgement status; guidelines should be provided by the manufacturer. Homogenize using a microtube pestle.</li>
		<li>Incubate samples in a water bath at 60 &#176;C for 45 min, and vortex briefly.</li>
		<li>Centrifuge samples for 4 min at 16,276 x g (13,300 rpm) in a desktop microcentrifuge.</li>
		<li>Transfer supernatant to a fresh, labeled microtube containing 50 &#181;L isopropanol, mix by inversion, and re-centrifuge as in (1.2.3).</li>
		<li>Decant the supernatant, and rinse the DNA pellet with 50 &#181;L of 70% ethanol.</li>
		<li>Remove excess ethanol with a pipette, and allow the pellet to air-dry for 15 min at room temperature.</li>
		<li>To resuspend DNA, add 50 &#181;L of 1 mM Tris pH 7.0, and incubate samples in a water bath for 1 h at 60 &#176;C. The DNA can now be stored at -20 &#176;C for future molecular analysis.</li>
	</ol>
	</li>
</ol>
2. Nested PCR Detection of Borrelia OspA and FlaB.
NOTE: An overview of general PCR principles and practices is provided by Lorenz, 201233.
<ol>
	<li>Synthesize or obtain Borrelia gene-specific outer and inner oligonucleotide primers. See Table 1 for primer sets, their respective amplicon sizes, and melting temperatures.</li>
</ol>
<table border="1">
	<tbody>
		<tr>
			<td>Primer Name</td>
			<td>Gene Target</td>
			<td colspan="2">Sequence (5&#8217;-3&#8217;)</td>
			<td>Amplicon Size</td>
			<td>Annealing Temperature</td>
		</tr>
		<tr>
			<td>FlaB Out Fw</td>
			<td>FlaB</td>
			<td colspan="2">gcatcactttcagggtctca</td>
			<td rowspan="2">503 bp</td>
			<td rowspan="2">55&#176;C</td>
		</tr>
		<tr>
			<td>FlaB Out Rv</td>
			<td>FlaB</td>
			<td colspan="2">tggggaacttgattagcctg</td>
		</tr>
		<tr>
			<td>FlaB In Fw</td>
			<td>FlaB</td>
			<td colspan="2">ctttaagagttcatgttggag</td>
			<td rowspan="2">447 bp</td>
			<td rowspan="2">58&#176;C</td>
		</tr>
		<tr>
			<td>FlaB In Rv</td>
			<td>FlaB</td>
			<td colspan="2">tcattgccattgcagattgt</td>
		</tr>
		<tr>
			<td>OspA Out Fw</td>
			<td>OspA</td>
			<td colspan="2">cttgaagttttcaaagaagat</td>
			<td rowspan="2">487 bp</td>
			<td rowspan="2">55&#176;C</td>
		</tr>
		<tr>
			<td>OspA Out Rv</td>
			<td>OspA</td>
			<td colspan="2">caactgctgacccctctaat</td>
		</tr>
		<tr>
			<td>OspA In Fw</td>
			<td>OspA</td>
			<td colspan="2">acaagagcagacggaaccag</td>
			<td rowspan="2">350 bp</td>
			<td rowspan="2">58&#176;C</td>
		</tr>
		<tr>
			<td>OspA In Rv</td>
			<td>OspA</td>
			<td colspan="2">ttggtgccatttgagtcgta</td>
		</tr>
	</tbody>
</table>
Table 1: Inner and outer primers for nPCR of Borrelia burgdorferiFlaB and OspA. 
In practice, the FlaB primers detect B. burgdorferi s.s. and other closely related Borrelia genospecies, while OspA primers capture only B. burgdorferi s.s. Amplification from both loci would indicate B. burgdorferi. s.s.
<ol start="2">
	<li>Pre-sterilize a PCR cabinet with UV light and 70% ethanol. 
	NOTE: To minimize potential sample contamination, this workspace should be distinct from the location of tick dissection, DNA extraction, and gel electrophoresis.
	<ol>
		<li>For the initial PCR run, use the outer primers in conjunction with the template DNA recovered in step 1.0 above, and set up the reaction mixture as described in Table 2. In parallel, perform positive control runs consisting of verified Borrelia DNA, and negative control runs including no-template reactions to detect reagent and aerosol contamination. Add DNA at the end to minimize potential contamination of reagents. Ensure each tube is closed at all times when reagents are not being added and close tubes immediately after DNA addition and before other tubes are&#160;opened.</li>
		<li>Program a thermal cycler as follows: 95 &#176;C for 5 min; 40 cycles of 95 &#176;C for 15 s, annealing temperature for 30 s, 72 &#176;C for 45 s; 72 &#176;C for 5 min; and hold at 4 &#176;C.</li>
	</ol>
	</li>
	<li>Perform the second round of PCR similar to the first reaction, except use inner primers with 2 &#181;L of the first PCR product (produced in 2.2.2). 
	NOTE: Reaction volumes are again provided in Table 2. Care must be taken to avoid cross-contamination of amplicons by ensuring that template DNA is added last and that only tubes corresponding to one sample are open at a time. 
	&#160;
	<table border="1">
		<tbody>
			<tr>
				<td>Component</td>
				<td>PCR # 1 Volumes</td>
				<td>PCR # 2 Volumes</td>
			</tr>
			<tr>
				<td>Taq Polymerase Master Mix 2X</td>
				<td>12.5 &#181;L</td>
				<td>12.5 &#181;L</td>
			</tr>
			<tr>
				<td>Nuclease-free Water</td>
				<td>8.5 &#181;L</td>
				<td>8.5 &#181;L</td>
			</tr>
			<tr>
				<td>10 &#181;M Forward and Reverse primers</td>
				<td>1.0 &#181;L Outer Primers</td>
				<td>1.0 &#181;L Inner Primers</td>
			</tr>
			<tr>
				<td>DNA Template</td>
				<td>2.0 &#181;L, from sample extraction (1.2.7)</td>
				<td>2.0 &#181;L, from round 1 of PCR (2.2.2)</td>
			</tr>
		</tbody>
	</table>
	Table 2: PCR reaction mixtures for first and second amplifications. 
	&#160;
	<ol>
		<li>Program the thermal cycler as before, but adjust the annealing temperature to accommodate the inner primers (refer to Table 1).</li>
	</ol>
	</li>
</ol>
3. Agarose Gel Electrophoresis and Imaging
NOTE: For basic instructions on separating DNA by electrophoresis, see Lee et al., 201234.
<ol>
	<li>Prepare a 1.2% agarose gel using 20X SB buffer (0.2 M NaOH, 0.8 M Boric Acid pH 8), diluted to 1X, and add approximately 5 &#181;L of a DNA stain, before pouring, if pre-staining of the gel is desired.</li>
	<li>Load 10 &#181;L of the product from the second (inner) PCR reaction from each experimental and control sample, alongside a 100 bp ladder (5 &#181;L).
	<ol>
		<li>Electrophorese for 1 h at 107 V (5V/cm).</li>
	</ol>
	</li>
	<li>View and document the gel using a transilluminator and associated camera and software.</li>
</ol>

The authors have nothing to disclose.

Over decades of use, PCR-based techniques have consistently proven their value in the detection of Borrelia from arthropod and mammalian specimens, whether Borrelia come from environmental or clinical origins. PCR offers many improvements over pre-existing approaches to surveillance. Notably, it is not reliant on the development and performance of antibody reagents, and instead can be easily adapted to detect new targets of interest simply by modifying primer sequences. PCR also accommodates the evaluation of multiple loci in parallel, either independently or via a multiplex reaction. It can be applied to diverse specimen inputs, including fresh and archived ticks22, animal or human bodily fluids, and resected tissue25. PCR also yields amplicons that can be further processed, for example by restriction enzyme digestion, probe hybridization, or sequencing, to provide increased insight into microbial identity21.
As a clinical tool, PCR is conceptually preferable to the standard serological diagnostics, as it provides a direct indication of bacterial presence, rather than relying on host immune response as a secondary measure of infection. However, Lyme borreliosis is associated with a relatively modest microbial burden (&#60;50 organisms/mL of urine or plasma) and transient spirochetemia, which can give rise to false negative results25. The sensitivity of this technique in the clinic varies considerably depending on the tissue type, stage of infection, and sample condition, falling between 12.5% and 62% in existing studies of blood, cerebrospinal fluid, and biopsied tissue36. Molecular sensitivity limitations are not a concern if PCR is undertaken subsequent to bacterial culture, however recovery of viable spirochetes from clinical specimens has proven similarly challenging. Only recently have protocols been optimized for higher yield35. Meanwhile, the gut of an infected adult tick can harbor on average anywhere from 2,000 to over 50,000 Borrelia37,38,39, which is solidly within the detection range of nPCR. Thus, the protocol is well suited to tick surveillance efforts.
Despite its many advantages, nPCR does pose certain challenges, and the capacity of this technique to accurately report tick infection therefore depends on strategic selection of genes and amplicons, meticulous experimental workflows that recover quality DNA from specimens while minimizing cross-exposure of samples, and the use of appropriate controls that can report contaminants in the laboratory environment and reagents. Prior to any experimentation, the scope and intentions of the investigation should be clearly defined so that appropriate genetic loci, and regions therein, can be selected. If the objective is to provide an unbiased screen for the Lyme-causing Borrelia burgdorferi s.l. complex, primers should be created to detect all of the associated strains with similar affinity and amplification efficiency, without capturing unrelated organisms25. New primers can be designed and assessed in silico using software tools such as Primer-BLAST40, although they should also be validated experimentally against standard reference isolates before being applied to uncharacterized samples. The goal of the DNA extraction procedure is to recover intact microbial template from a mixed environmental sample (tick homogenate). An optional step before proceeding with PCR is to evaluate the integrity of the extracted DNA. Additionally, parallel reactions could be set up to target a housekeeping gene in the tick. The latter method can also indicate the presence of inhibitors in the reaction mixture, providing increased confidence that negative Borrelia reactions are due to the absence of the organism, and not to the presence of an inhibitory contaminant.
The increased sensitivity of the nested PCR approach comes at the expense of potential contamination that generates false-positive results. Exogenous template could be introduced to a sample during tick dissection and DNA recovery, or in the process of setting up the outer and inner amplification reactions. It is therefore especially important to follow best practice protocols for PCR to avoid template or amplicon cross-contamination. These include the use of separate work stations with independent airflows, containment in PCR and biological safety cabinets where appropriate, thorough chemical and physical cleaning and sterilization of surfaces and reagents, and cautious handling of DNA41. No-template controls are also vital in identifying contamination of stock reagents. A particular vulnerability of nPCR is the amplicon handling that occurs when transferring the products of the first reaction into the second PCR vessel. Since the target DNA has already undergone exponential enrichment in positive samples, this step is especially prone to cross-contamination, and a single-tube nPCR protocol has been developed to circumvent this limitation. In this approach, both sets of primers for a given gene are added together to a reaction tube that remains sealed for both rounds of PCR31. The outer and inner primer pairs must be thermodynamically distinct, such that the outer couple amplifies template at a high annealing temperature that is prohibitive for the inner primers. In the second round, the annealing temperature is lowered to accommodate the internal pair. Not only does this bypass a potentially confounding step, it also permits the use of additional anti-contamination measures31,42. However, this modification may sacrifice some assay sensitivity. Regardless of the approach, increasing the number of technical replicates performed independently on a sample will help to identify spurious contamination.
Molecular techniques have continued to evolve since the introduction of nPCR, and these newer approaches offer select advantages over the original designs, albeit at increased financial expense. As the name suggests, quantitative PCR (qPCR or real time (RT)-PCR) allows for the enumeration of pathogens in a sample, while conventional techniques are qualitative in nature43. The sensitivity of qPCR is reportedly similar to that of nPCR38, although it can fluctuate depending on primer characteristics28. A variation of qPCR that uses molecular beacons (MB) in place of conventional TaqMan probes has also shown promise in the detection of Borrelia in clinical specimens44,45,46. Due to their unique secondary structure, molecular beacons reportedly produce lower background fluorescence and higher legitimate signals, thereby providing superior sensitivity47. Pre-clinical evaluations suggest a potential detection threshold of between one and ten spirochetes44,45. Moreover, the technique has been successfully applied in multiplex reactions to simultaneously detect a mammalian host gene44 and other tick-borne pathogens45, which is not as readily achievable with nPCR. Other design modifications include droplet digital PCR (ddPCR) technology, which can quantify DNA without the use of a standard curve39,48. The lower detection limit of this technique for Borrelia is likewise around ten spirochetes/sample39. Compared to nPCR, these approaches also have the advantage of reduced potential for contamination, as they only require a single amplification protocol.
If the objective of surveillance is instead to profile the varied bacterial contents of a tick, 16S rRNA metagenomic screening is an attractive option49. Although this approach is costlier, requires specialized DNA sequencers not found in all molecular biology laboratories, and necessitates more sophisticated bioinformatics-based interpretation, it can capture a broad spectrum of microbes to more accurately represent the pathogen load of the vector.
While qPCR and its derivatives are methods of choice for quantitative applications, and metagenomics screens provide broad inventories of the tick microbiome, targeted surveillance efforts are often concerned with binary reporting of the presence or absence of one or a few pathogens in a vector. Under such circumstances, these newer, more elaborate approaches may introduce unnecessary complexity and financial burden into the process. For these reasons, nPCR has withstood the test of time as a pivotal technique in tick testing.

Lyme disease (LD) is the most prevalent vector-borne infection in the northern hemisphere, and its incidence continues to increase1. This debilitating illness is caused by spirocheteal pathogens of the Lyme borreliosis (LB) complex (commonly referred to as Borrelia burgdorferi sensu lato, or s.l.), which historically&#160;comprises the predominant North American pathogen, B. burgdorferi sensu stricto (s.s), in addition to B. afzelii and B. garinii, which are widespread throughout Europe and Asia, and are species of emerging clinical relevance2,3. These bacteria are transmitted to humans through the bite of infected Ixodes ticks2. Although the main North American vectors are I. scapularis and I. pacificus, multiple species within this genus have been found to harbor and transmit the bacterium4. In humans, B. burgdorferi can cause multisystem symptoms affecting the skin, joints, heart, nervous system, endocrine glands, gastrointestinal tract, and internal organs5,6,7,8,9,10. The Center for Disease Control and Prevention currently estimates over 300,000 new human cases annually in the United States11,12. While prognosis is often favorable when the illness is diagnosed and treated in the early stages, studies have suggested that anywhere between 10% and 60% of patients who received the recommended antibiotic regimen continued to experience symptoms after therapy cessation, in a phenomenon termed Post Treatment Lyme Disease Syndrome (PTLDS)13,14,15. Moreover, delays in clinical intervention can arise as a result of lack of awareness of a tick bite, non-specific presentation of the initial illness, and the low sensitivity of traditional serology-based diagnostics when used at the onset of infection. Failure to treat swiftly and appropriately enables symptom progression that can manifest in increasingly debilitating complications16,17. Lyme disease prevention is therefore a cornerstone of risk management. Strategies to combat this growing threat include robust surveillance measures to indicate the pathogen prevalence in ticks, and identify geographic regions of concern.
This article demonstrates the utility of nested polymerase chain reaction (nPCR) as a molecular screening tool by which to identify infected ticks. To increase specificity, two Borrelia genes are used for parallel amplification. Flagellin B (FlaB) encodes a major filament protein of the flagellum18, and the gene is located on the single linear chromosome, while the lipoprotein product of Outer surface protein A (OspA) mediates tick midgut colonization, and is plasmid-encoded19,20. The workflow consists of tick collection, DNA extraction, and then an initial round of PCR to detect Borrelia-specific loci. Subsequent PCR uses the product of the first reaction as a new template to generate smaller, internal amplification fragments. A tick is considered positive for Borrelia burgdorferi when inner amplicons from both Borrelia genes can be detected by agarose gel electrophoresis.
Both the nPCR technique, and the FlaB and OspA gene targets, have been widely used for ecological surveillance and clinical detection of the Lyme spirochete since the early 1990s21,22,23,24,25. Prior to the development of molecular protocols, ticks were assessed by subjecting gut contents to anti-Borrelia immunofluorescence (IF) staining, microbial culture, or a combination thereof26. These approaches suffer from inherent limitations, including the slow growth and fastidious nature of Borrelia27, antibody performance issues, and the requirement of live ticks for IF processing21. PCR was subsequently adopted to provide fast, sensitive, and specific identification of infected vectors. It offered marked improvements over the traditional methodology, including culture-independent direct application to diverse specimen types, such as dead and archived ticks that would otherwise be unsuitable for testing21,22. Nested experimental designs further improve upon the specificity and sensitivity of classical PCR by employing two distinct sets of gene-specific primers in two consecutive rounds of amplification25,28.
Experimental success is critically dependent on strategic gene selection and amplicon design. To accurately estimate the presence of Borrelia burgdorferi, primers should detect the relevant pathogens without cross-reacting with relapsing fever spirochetes also in the Borrelia genus. In the case of FlaB, this specificity is achieved by targeting a variable internal region of the gene, rather than the relatively conserved flanking sequences that are shared by diverse bacteria (Figure 1)24,29,30.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56471/56471fig1.jpg" /> 
Figure 1: The concept of nPCR, as illustrated using Borrelia&#160;FlaB gene as a target. The 5&#39; and 3&#39; termini of the gene are common to organisms beyond Borrelia burgdorferi s.l., rendering these regions unsuitable for the specific assessment of Lyme-causing pathogens. Using the less-conserved interior sequences as primer targets, two rounds of PCR are executed to detect a final, internal amplicon. <a href="//cloudflare.jove.com/files/ftp_upload/56471/56471fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
In a test of their discriminatory capacity, interior FlaB primers were evaluated with over 80 different Borrelia isolates, and found to identify only those associated with Lyme disease24. The lower detection limit of nPCR has been documented at between six24 and ten31 bacteria from pure culture, although the sensitivity can be further improved by Southern blotting the amplicon, and hybridizing a radiolabelled or chemiluminescent probe. Coupling the techniques reduces the detection threshold to a single spirochete31. By direct comparison, conventional, unprobed single-round PCR was found to report the presence of a minimum of 104 spirochetes31. It should be noted, however, that assay sensitivity will be lower when working with complex environmental and clinical samples, due to the overwhelming presence of unrelated DNA and potential inhibitory substances. These challenges can be largely circumvented by the use of nPCR.
Despite advances in molecular technologies in the past decades, nPCR remains a staple technique in modern surveillance efforts. If care is taken in the design and execution of this protocol, it is a powerful, adaptable, and relatively straightforward approach to capture the presence of pathogens in tick vectors.

<table><tbody><tr><td>LabGard Class II, Type A2 biological safety cabinet</td><td>Nuaire</td><td>ES AIR NU-543&amp;nbsp;</td><td></td></tr><tr><td>Razor blades</td><td>VWR</td><td>55411-050</td><td>0.22 mm thickness</td></tr><tr><td>Microfuge Tubes (Microtubes 1.5 mL)</td><td>Axygen</td><td>311-08-051</td><td></td></tr><tr><td>AquaGenomic&amp;nbsp;</td><td>MultiTarget Pharmaceuticals</td><td>2030</td><td>DNA extraction reagent</td></tr><tr><td>Microtube Pestle</td><td>Diamed</td><td>DIATEC610-1551</td><td>Designed for 1.5 ml tubes</td></tr><tr><td>Water bath - Isotemp 202</td><td>Fishse Scientific</td><td>15-462-2</td><td></td></tr><tr><td>Vortex</td><td>Labnet</td><td>S0100 CAN</td><td></td></tr><tr><td>Spectrafuge 24D Digital Microcentrifuge</td><td>Labnet</td><td>C2400</td><td></td></tr><tr><td>Isopropanol</td><td>Sigma-Aldrich</td><td>190764</td><td></td></tr><tr><td>BIS-TRIS</td><td>Sigma-Aldrich</td><td>B9754</td><td></td></tr><tr><td>Primer Synthesis</td><td>Sigma-Aldrich</td><td>OLIGO</td><td></td></tr><tr><td>PCR Cabinet</td><td>Misonix</td><td>PCR6-482</td><td></td></tr><tr><td>PCR tube with attached flat caps 0.2mL</td><td>VWR</td><td>20170-012</td><td></td></tr><tr><td>GoTaq Green Master Mix 2x</td><td>Promega</td><td>M7123</td><td></td></tr><tr><td>Nuclease-free water</td><td>Promega</td><td>M7123</td><td>The water comes with the GTG</td></tr><tr><td>Spectrafuge Mini</td><td>Labnet</td><td>C1301</td><td></td></tr><tr><td>SYBR Safe DNA Stain 10,000X Concentration</td><td>EDVOTEK</td><td>608</td><td></td></tr><tr><td>Froggarose LE (Molecular Biology Grade Agarose)</td><td>FroggaBio</td><td>A87-500G</td><td></td></tr><tr><td>GD 100 bp DNA Ladder</td><td>FroggaBio</td><td>DM001-R500&amp;nbsp;</td><td></td></tr><tr><td>Electrophoresis power pack&amp;nbsp;</td><td>VWR</td><td>VWR 105</td><td>EC Apparatus Corporation</td></tr><tr><td>Fluor-S MultiImager&amp;nbsp;</td><td>BioRad</td><td>170-7700 (Serial number 433B0154)</td><td></td></tr><tr><td>Quantity One 1-D Analysis Software (V. 4.5.2)</td><td>BioRad</td><td>1709600</td><td></td></tr></tbody></table>

detecting the lyme disease spirochete, borrelia burgdorferi, in ticks using nested pcr

Lyme disease is a serious vector-borne infection that is caused by the Borrelia burgdorferi sensu lato family of spirochetes, which are transmitted to humans through the bite of infected Ixodes ticks. The primary etiological agent in North America is Borrelia burgdorferi sensu stricto. As geographic risk regions expand, it is prudent to support robust surveillance programs that can measure tick infection rates, and communicate findings to clinicians, veterinarians, and the general public. The molecular technique of nested polymerase chain reaction (nPCR) has long been used for this purpose, and it remains a central, inexpensive, and robust approach in the detection of Borrelia in both ticks and wildlife. 
This article demonstrates the application of nPCR to tick DNA extracts to identify infected specimens. Two independent B. burgdorferi targets, genes encoding Flagellin B (FlaB) and Outer surface protein A (OspA), have been used extensively with this technique. The protocol involves tick collection, DNA extraction, and then an initial round of PCR to detect each of the two Borrelia-specific loci. Subsequent polymerase chain reaction (PCR) uses the product of the first reaction as a new template to generate smaller, internal amplification fragments. The nested approach improves upon both the specificity and sensitivity of conventional PCR. A tick is considered positive for the pathogen when inner amplicons from both Borrelia genes can be detected by agarose gel electrophoresis.

nPCR is an elegant approach to increase the specificity and sensitivity of pathogen detection, particularly when complex environmental samples are under investigation. As depicted in Figure 1, two rounds of PCR targeting a strategic region of the Borrelia FlaB locus (and OspA, not pictured) can report the presence of the Borrelia burgdorferi bacteria through the generation of short inner amplicons. When resolved by gel electrophoresis, the FlaB and OspA reaction products from each tick can be visually scored and compared against controls. In Figure 2, unique specimen identifiers are provided along the top of each gel, and no-template and aerosol controls are represented at the far left and right, respectively, adjacent to the ladders.
Robust amplicon bands are clearly visible in select experimental samples, and they are easily distinguished from surplus primers and residual DNA (Figure 2). Based on the experimental design principles set forth, a tick is considered positive for Borrelia when parallel negative controls demonstrate no amplification, and inner amplicons are produced from both FlaB and OspA primers. In this case, specimens T907, T604, and T606 met surveillance criteria for the Lyme pathogen (Figure 2). By contrast, T923 was only positive for OspA, an outcome for which there are multiple possible explanations: A) The tick of origin was negative for Borrelia, but the outer or inner OspA PCR preparation was spuriously contaminated with template DNA (note that systemic contamination of reagents was ruled out via negative controls), B) the tick carried Lyme Borrelia, but low template amounts or experimental error prevented amplification of FlaB, or C) an organism was present that contained the conserved OspA sequence, but lacked Flagellin or had insufficient identity in the targeted region of FlaB to anneal to the primers. Indeed,&#160;OspA&#160;sequence similarities have been noted in a variety of organisms, including plants and animals28. The converse situation, amplification of the more conserved Flagellin&#160;gene, but not the OspA&#160;gene, could indicate a related Borrelia&#160;species. In practice, this protocol yields more&#160;OspA&#160;single-positive results than do the&#160;FlaB&#160;primers, suggesting that scenario &#39;A&#39; is the least likely explanation.&#160;Without further experimental analysis of the contentious specimen, however, it is not possible to determine the source of the single-positive result. Increasing the number of technical replicates performed on equivocal samples may help to reconcile their true status, since any contaminants that were spuriously introduced to previous reactions would not be present in the archived DNA. However, if subsequent reactions with these primers fail to provide conclusive results, other Borrelia loci could be investigated by PCR. Amplicons generated from these reactions could also be sequenced and compared among isolates to help assign identity, and estimate the degree of strain divergence. Sapi and colleagues provide an example of this workflow using human clinical samples35.
All factors considered, the outlined protocol and interpretation criteria have been estimated to yield false positive and false negative rates of 0.17% and 0.0063%, respectively.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56471/56471fig2.jpg" /> 
Figure 2: Detection of Borrelia burgdorferi in individual ticks by nPCR of FlaB and OspA. Codes assigned to each tick are represented across the top of the gels, and identities align vertically to report the detection of OspA and FlaB in each specimen. Lanes entitled B at the left of the image represent no-template controls, while A (right hand lanes) are aerosol controls to capture contamination of the laboratory environment. <a href="https://cloudflare.jove.com/files/ftp_upload/56471/56471fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR at JoVE.com

Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR

Nested PCR is a sensitive, specific, and straightforward technique that can be applied to tick DNA extracts to probe for Borrelia burgdorferi, the causative agent of Lyme disease. The initial PCR experiment uses gene-specific primers to generate long amplicons, which then become templates for a subsequent reaction using internal primers.

Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR

Lyme disease is a serious vector-borne infection that is caused by the Borrelia burgdorferi sensu lato family of spirochetes, which are transmitted to ...

detecting-lyme-disease-spirochete-borrelia-burgdorferi-ticks-using

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

17.8K Views.  Mount Allison University. Nested PCR is a sensitive, specific, and straightforward technique that can be applied to tick DNA extracts to probe for Borrelia burgdorferi, the causative agent of Lyme disease. The initial PCR experiment uses gene-specific primers to generate long amplicons, which then become templates for a subsequent reaction using internal primers. 

Video: Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR

Methods for Rapid Transfer and Localization of Lyme Disease Pathogens Within the Tick Gut

Lyme disease is caused by infection with the spirochete pathogen Borrelia burgdorferi, which is maintained in nature by a tick-rodent infection cycle 1. A tick-borne murine model 2 has been developed to study Lyme disease in the laboratory. While na&iacute;ve ticks can be infected with B. burgdorferi by feeding them on infected mice, the molting process takes several weeks to months to complete. Therefore, development of more rapid and efficient tick infection techniques, such as a microinjection-based procedure, is an important tool for the study of Lyme disease 3,4. The procedure requires only hours to generate infected ticks and allows control over the delivery of equal quantities of spirochetes in a cohort of ticks. This is particularly important as the generation of B. burgdorferi infected ticks by the natural feeding process using mice fails to ensure 100% infection rate and potentially results in variation of pathogen burden amongst fed ticks. Furthermore, microinjection can be used to infect ticks with B. burgdorferi isolates in cases where an attenuated strain is unable to establish infection in mice and thus can not be naturally acquired by ticks 5. This technique can also be used to deliver a variety of other biological materials into ticks, for example, specific antibodies or double stranded RNA 6. In this article, we will demonstrate the microinjection of nymphal ticks with in vitro-grown B. burgdorferi. We will also describe a method for localization of Lyme disease pathogens in the tick gut using confocal immunofluorescence microscopy.

Lyme disease research studies often require generation of ticks infected with the pathogen Borrelia burgdorferi, a process that typically takes several weeks. Here we demonstrate a microinjection-based tick infection procedure that can be accomplished within hours. We also demonstrate an immunofluorescence method for in situ localization of B. burgdorferi within ticks.

Lyme disease is caused by infection with the spirochete pathogen Borrelia burgdorferi, which is maintained in nature by a tick-rodent infection cycle 1.  ...

Immunology and Infection

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these diseases, do not exist in isolation when they colonize the vector; rather, they likely engage in interactions with resident microorganisms in the gut lumen. The vector microbiota has been demonstrated to play an important role in pathogen transmission for several vector-borne diseases. Whether resident bacteria in the gut of the Ixodes scapularis tick, the vector of several human pathogens including Borrelia burgdorferi, influence tick transmission of pathogens is not determined. We require methods for characterizing the composition of the bacteria associated with the tick gut to facilitate a better understanding of potential interspecies interactions in the tick gut. Using whole-mount in situ hybridization to visualize RNA transcripts associated with particular bacterial species allows for the collection of qualitative data regarding the abundance and distribution of the microbiota in intact tissue. This technique can be used to examine changes in the gut microbiota milieu over the course of tick feeding and can also be applied to analyze expression of tick genes. Staining of whole tick guts yield information about the gross spatial distribution of target RNA in the tissue without the need for three-dimensional reconstruction and is less affected by environmental contamination, which often confounds the sequencing-based methods frequently used to study complex microbial communities. Overall, this technique is a valuable tool that can be used to better understand vector-pathogen-microbiota interactions and their role in disease transmission.

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Here, we present a protocol to spatially and temporally assess the presence of viable microbiota in tick guts using a modified whole-mount in situ hybridization approach.

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these ...

Genetics

Evaluation of a Universal Nested Reverse Transcription Polymerase Chain Reaction for the Detection of Lyssaviruses

To detect rabies virus and other member species of the genus Lyssavirus within the family Rhabdoviridae, the pan-lyssavirus nested reverse transcription polymerase chain reaction (nested RT-PCR) was developed to detect the conserved region of the nucleoprotein (N) gene of lyssaviruses. The method applies reverse transcription (RT) using viral RNA as template and oligo (dT)15 and random hexamers as primers to synthesize the viral complementary DNA (cDNA). Then, the viral cDNA is used as a template to amplify an 845 bp N gene fragment in first-round PCR using outer primers, followed by second-round nested PCR to amplify the final 371 bp fragment using inner primers. This method can detect different genetic clades of rabies viruses (RABV). The validation, using 9,624 brain specimens from eight domestic animal species in 10 years of clinical rabies diagnoses and surveillance in China, showed that the method has 100% sensitivity and 99.97% specificity in comparison with the direct fluorescent antibody test (FAT), the gold standard method recommended by the World Health Organization (WHO) and the World Organization for Animal Health (OIE). In addition, the method could also specifically amplify the targeted N gene fragment of 15 other approved and two novel lyssavirus species in the 10th Report of the International Committee on Taxonomy of Viruses (ICTV) as evaluated by a mimic detection of synthesized N gene plasmids of all lyssaviruses. The method provides a convenient alternative to FAT for rabies diagnosis and has been approved as a National Standard (GB/T36789-2018) of China.

A pan-lyssavirus nested reverse transcription polymerase chain reaction has been developed to detect specifically all known lyssaviruses. Validation using rabies brain samples of different animal species showed that this method has a sensitivity and specificity equivalent to the gold standard fluorescent antibody test and could be used for routine rabies diagnosis.

To detect rabies virus and other member species of the genus Lyssavirus within the family Rhabdoviridae, the pan-lyssavirus nested reverse transcription ...

Feeding of Ticks on Animals for Transmission and Xenodiagnosis in Lyme Disease Research

Transmission of the etiologic agent of Lyme disease, Borrelia burgdorferi, occurs by the attachment and blood feeding of Ixodes species ticks on mammalian hosts. In nature, this zoonotic bacterial pathogen may use a variety of reservoir hosts, but the white-footed mouse (Peromyscus leucopus) is the primary reservoir for larval and nymphal ticks in North America. Humans are incidental hosts most frequently infected with B. burgdorferi by the bite of ticks in the nymphal stage. B. burgdorferi adapts to its hosts throughout the enzootic cycle, so the ability to explore the functions of these spirochetes and their effects on mammalian hosts requires the use of tick feeding. In addition, the technique of xenodiagnosis (using the natural vector for detection and recovery of an infectious agent) has been useful in studies of cryptic infection. In order to obtain nymphal ticks that harbor B. burgdorferi, ticks are fed live spirochetes in culture through capillary tubes. Two animal models, mice and nonhuman primates, are most commonly used for Lyme disease studies involving tick feeding. We demonstrate the methods by which these ticks can be fed upon, and recovered from animals for either infection or xenodiagnosis.

Lyme disease is the most commonly-reported vector-borne disease in North America. The causative agent, Borrelia burgdorferi is a spirochete bacterium transmitted by Ixodid ticks. Transmission and detection of infection in animal models is optimized by the use of tick feeding, which we describe here.

Transmission of the etiologic agent of Lyme disease, Borrelia burgdorferi, occurs by the  attachment and blood feeding of Ixodes species ticks on ...

Cultivation Methods of Spirochetes from Borrelia burgdorferi Sensu Lato Complex and Relapsing Fever Borrelia

The Borrelia consists of three groups of species, those of the Lyme borreliosis (LB) group, also known as B. burgdorferi sensu lato (s.l.) and recently reclassified into Borreliella, the relapsing fever (RF) group Borrelia, and a third reptile-associated group of spirochetes. Culture-based methods remain the gold standard for the laboratory detection of bacterial infections for both research and clinical work, as the culture of pathogens from bodily fluids or tissues directly detects replicating pathogens and provides source material for research. Borrelia and&#160;Borreliella spirochetes&#160;are fastidious and slow growing, and thus are not commonly cultured for clinical purposes; however, culture is necessary for research. This protocol demonstrates the methodology and recipes required to successfully culture LB and RF spirochetes, including all recognized species from B. burgdorferi s.l. complex including&#160;B. afzelii, B. americana, B. andersonii, B. bavariensis, B. bissettii/bissettiae, B. burgdorferi sensu stricto&#160;(s.s.), B. californiensis, B. carolinensis, B. chilensis, B. finlandensis, B. garinii, B. japonica, B. kurtenbachii, B. lanei, B. lusitaniae, B. maritima, B. mayonii, B. spielmanii, B. tanukii, B. turdi, B. sinica, B. valaisiana, B. yangtzensis, and RFspirochetes, B. anserina, B. coriaceae, B. crocidurae, B. duttonii, B. hermsii, B. hispanica, B. persica, B. recurrentis, and B. miyamotoi. The basic medium for growing LB and RF spirochetes is the Barbour-Stoenner-Kelly (BSK-II or BSK-H) medium, which reliably supports the growth of spirochetes in established cultures. To be able to grow newly isolated Borrelia isolates from tick- or host-derived samples where the initial spirochete number is low in the inoculum, modified Kelly-Pettenkofer (MKP) medium is preferred. This medium also supports the growth of B. miyamotoi. The success of the cultivation of RF spirochetes also depends critically on the quality of ingredients.

Cultivation Methods of Spirochetes from Borrelia burgdorferi Sensu Lato Complex and Relapsing Fever Borrelia

In vitro culture is a direct detection method for the presence of living bacteria. This protocol describes methods for the culture of diverse Borrelia spirochetes,&#160;including those of the Borrelia burgdorferi sensu lato complex, relapsing fever Borrelia species, and Borrelia miyamotoi. These species are fastidious and slow growing but can be cultured.

The Borrelia consists of three groups of species, those of the Lyme borreliosis (LB) group, also known as B. burgdorferi sensu lato (s.l.) and recently ...

Phage-Mediated Genetic Manipulation of the Lyme Disease Spirochete Borrelia burgdorferi

Introducing foreign DNA into the spirochete Borrelia burgdorferi has been almost exclusively accomplished by transformation using electroporation. This process has notably lower efficiencies in the Lyme disease spirochete relative to other, better-characterized Gram-negative bacteria. The rate of success of transformation is highly dependent upon having concentrated amounts of high-quality DNA from specific backgrounds and is subject to significant strain-to-strain variability. Alternative means for introducing foreign DNA (i.e., shuttle vectors, fluorescent reporters, and antibiotic-resistance markers) into B. burgdorferi could be an important addition to the armamentarium of useful tools for the genetic manipulation of the Lyme disease spirochete. Bacteriophage have been well-recognized as natural mechanisms for the movement of DNA among bacteria in a process called transduction. In this study, a method has been developed for using the ubiquitous borrelial phage &#966;BB-1 to transduce DNA between B. burgdorferi cells of both the same and different genetic backgrounds. The transduced DNA includes both borrelial DNA and heterologous DNA in the form of small shuttle vectors. This demonstration suggests a potential use of phage-mediated transduction as a complement to electroporation for the genetic manipulation of the Lyme disease spirochete. This report describes methods for the induction and purification of phage &#966;BB-1 from B. burgdorferi, the use of this phage in transduction assays, and the selection and screening of potential transductants.

Phage-Mediated Genetic Manipulation of the Lyme Disease Spirochete Borrelia burgdorferi

The ability of bacteriophage to move DNA between bacterial cells makes them effective tools for the genetic manipulation of their bacterial hosts. Presented here is a methodology for inducing, recovering, and using &#966;BB-1, a bacteriophage of Borrelia burgdorferi, to transduce heterologous DNA between different strains of the Lyme disease spirochete.

Introducing foreign DNA into the spirochete Borrelia burgdorferi has been almost exclusively accomplished by transformation using electroporation. This ...

Multiplex Immunoassay for Borrelia-Specific IgG and IgM in Serum

Simultaneous Detection of Different Antibody Classes in a Multiplexed Serological Test

To monitor the progression of infectious diseases, it is useful to assess immunoreactivity against various antigenic determinants, and measure different antibody isotypes because they appear at different stages of the host immune response. With Lyme borreliosis, the pathogenic agent can be one of the multiple members of the Borrelia species. Therefore, correct sample classification requires evaluating the immunoreactivity against different antigens of different Borrelia species. Additionally, anti-pathogen IgG and IgM responses can have different elicitation time courses during disease progression. Here we demonstrate the development of a two-reporter multiplex immunoassay that has utility in identifying Borrelia-specific immune response in human serum samples by simultaneously evaluating both IgG and IgM immunoreactivity against different bacterial antigens in the same reaction well. This dual-reporter approach retains the analytical performance of single-reporter methods while conserving time and resources and reducing sample size requirements. This assay allows essentially double the serological information to be generated from a blood sample in half the time.

Author Spotlight: Expanding the Scope of Multiplex Immunoassays for Lyme Borreliosis Diagnostics and Pathogen Research 

A three-channel dual-reporter fluorescence flow analysis system was used to develop a bead-based multiplex immunoassay that simultaneously evaluates serum samples for IgG and IgM elicited against multiple antigens of different Borrelia species that cause Lyme borreliosis in Europe and North America.

To monitor the progression of infectious diseases, it is useful to assess immunoreactivity against various antigenic determinants, and measure different ...

Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective and widely available vaccines are lacking for a majority of these diseases, necessitating the development of novel disease mitigation strategies. To this end, a promising avenue of disease control involves targeting the vector microbiome, the community of microbes inhabiting the vector. The vector microbiome plays a pivotal role in pathogen dynamics, and manipulations of the microbiome have led to reduced vector abundance or pathogen transmission for a handful of vector-borne diseases. However, translating these findings into disease control applications requires a thorough understanding of vector microbial ecology, historically limited by insufficient technology in this field. The advent of next-generation sequencing approaches has enabled rapid, highly parallel sequencing of diverse microbial communities. Targeting the highly-conserved 16S rRNA gene has facilitated characterizations of microbes present within vectors under varying ecological and experimental conditions. This technique involves amplification of the 16S rRNA gene, sample barcoding via PCR, loading samples onto a flow cell for sequencing, and bioinformatics approaches to match sequence data with phylogenetic information. Species or genus-level identification for a high number of replicates can typically be achieved through this approach, thus circumventing challenges of low detection, resolution, and output from traditional culturing, microscopy, or histological staining techniques. Therefore, this method is well-suited for characterizing vector microbes under diverse conditions but cannot currently provide information on microbial function, location within the vector, or response to antibiotic treatment. Overall, 16S next-generation sequencing is a powerful technique for better understanding the identity and role of vector microbes in disease dynamics.

Here we present a next-generation sequencing protocol for 16S rRNA sequencing which enables identification and characterization of microbial communities within vectors. This method involves DNA extraction, amplification and barcoding of samples through PCR, sequencing on a flow-cell, and bioinformatics to match sequence data to phylogenetic information.

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective ...

Dot-Blot Assay for Detection of Leptospira DNA in Water Samples

Polymerase Chain Reaction and Dot-Blot Hybridization for Leptospira Detection in Water Samples

The dot-blot is a simple, fast, sensitive, and versatile technique that enables the identification of minimal quantities of DNA specifically targeted by probe hybridization in the presence of carrier DNA. It is based on the transfer of a known amount of DNA onto an inert solid support, such as a nylon membrane, utilizing the dot-blot apparatus and without electrophoretic separation. Nylon membranes have the advantage of high nucleic acid binding capacity (400 &#181;g/cm2), high strength, and are positively or neutrally charged. The probe used is a highly specific ssDNA fragment of 18 to 20 bases long labeled with digoxigenin (DIG). The probe will conjugate with the Leptospira DNA. Once the probe has hybridized with the target DNA, it is detected by an anti-digoxigenin antibody, allowing its easy detection through its emissions revealed in an X-ray film. The dots with an emission will correspond to the DNA fragments of interest. This method employs the non-isotopic labeling of the probe, which may have a very long half-life. The drawback of this standard immuno-label is a lower sensitivity than isotopic probes. Nevertheless, it is mitigated by coupling polymerase chain reaction (PCR) and dot-blot assays. This approach enables the enrichment of the target sequence and its detection. Additionally, it may be used as a quantitative application when compared against a serial dilution of a well-known standard. A dot-blot application to detect Leptospira from the three main clades in water samples is presented here. This methodology can be applied to large amounts of water once they have been concentrated by centrifugation to provide evidence of the presence of Leptospiral DNA. This is a valuable and satisfactory tool for general screening purposes, and may be used for other non-culturable bacteria that may be present in water, enhancing the comprehension of the ecosystem.

Author Spotlight: Leptospira DNA Detection in Water for Environmental Analysis and Disease Surveillance

In this study, a dot-blot application was designed to detect Leptospira from the three main clades in water samples. This method allows for the identification of minimal DNA quantities specifically targeted by a digoxigenin-labeled probe, easily detected by an anti-digoxigenin antibody. This approach is a valuable and satisfactory tool for screening purposes.

The dot-blot is a simple, fast, sensitive, and versatile technique that enables the identification of minimal quantities of DNA specifically targeted by ...

Nested-PCR to Detect a Specific Viral Genomic Sequence

Source: Feng, Y., et al. <a href="https://appjove.unicartagenaproxy.elogim.com/v/59428">Evaluation of a Universal Nested Reverse Transcription Polymerase Chain Reaction for the Detection of Lyssaviruses.</a> J. Vis. Exp. (2019).
This video describes nested polymerase chain reaction, a technique that consists of two sequential PCR amplification processes using two primer sets. The first set of primers is intended to anneal to sequences upstream of the second set, resulting in selective amplification of specific gene sequences. This PCR is more sensitive and specific than a normal PCR and is widely used as a detection technique for various diseases.

Source: Feng, Y., et al. Evaluation of a Universal Nested Reverse Transcription Polymerase Chain Reaction for the Detection of Lyssaviruses. J. Vis. Exp. ...

Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR

Summary

Explore More Videos

Chapters in this video

Methods for Rapid Transfer and Localization of Lyme Disease Pathogens Within the Tick Gut

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Evaluation of a Universal Nested Reverse Transcription Polymerase Chain Reaction for the Detection of Lyssaviruses

Feeding of Ticks on Animals for Transmission and Xenodiagnosis in Lyme Disease Research

Cultivation Methods of Spirochetes from Borrelia burgdorferi Sensu Lato Complex and Relapsing Fever Borrelia

Phage-Mediated Genetic Manipulation of the Lyme Disease Spirochete Borrelia burgdorferi

Simultaneous Detection of Different Antibody Classes in a Multiplexed Serological Test

Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing

Polymerase Chain Reaction and Dot-Blot Hybridization for Leptospira Detection in Water Samples

Nested-PCR to Detect a Specific Viral Genomic Sequence