This work was supported by the Agriculture and Food Research Initiative Competitive Grant no. 2011-68003-30395 from the United States Department of Agriculture, National Institute of Food and Agriculture through the NoroCORE project. Funding for open access charge was provided by the United States Department of Agriculture. We would like to thank Robert Atmar (Baylor College of Medicine, Houston, TX) for kindly providing us the purified capsids and Valerie Lapham for her assistance with the TEM images. We would also like to thank Frank N. Barry for helping us start the experiments presented.

1. Plate-based Binding Assay for Evaluating Loss of Higher Order Norovirus Capsid Structure
NOTE: A very similar ELASA protocol to the one presented here has been published29, and similar ELASA assays have previously been reported as part of research articles elsewhere17,18,22.
<ol>
	<li>Heat treatment of human norovirus GII.4 Sydney capsids
	<ol>
		<li>Obtain purified human norovirus major capsid protein (VP1) of GII.4 Sydney (Accession: JX459908) assembled in capsids. 
		NOTE: Capsids in the study were obtained courtesy of R. Atmar (Baylor College of Medicine, Houston, TX).</li>
		<li>Dilute capsids to 50 &#181;g/mL in 1x phosphate-buffered saline (PBS, pH 7.2) to a maximum volume of 15 &#181;L in individual capped PCR tubes. Ensure that the tube contains at least 600 ng of capsid. Ensure that there is 600 ng of capsid per treatment-ligand combination.</li>
		<li>Preheat thermal cycler to desired heat treatment. 
		NOTE: For the purposes of this protocol, treatment at 68 &#176;C for different times (0 - 25 min) was chosen.</li>
		<li>Preheat an additional thermal cycler to 4 &#176;C for immediate cooling. Add tubes with capsid solution to the thermal cycler for the desired time. Immediately transfer to pre-cooled 4 &#176;C cycler for 5 min after heating.
		<ol>
			<li>Include 95 &#176;C for 5 min treatment as a denatured capsid control. Include untreated (23 &#176;C) capsid solution as a positive control. Include PBS with no capsid as an additional negative control.</li>
		</ol>
		</li>
		<li>Briefly spin down in a centrifuge to get all droplets to the bottom of the tube and dilute the treated capsid solutions in PBS to 3 &#181;g/mL. Ensure that there is at least 200 &#181;L of diluted, treated capsid (100 &#181;L/well).</li>
	</ol>
	</li>
	<li>Apply 100 &#181;L of capsid solution to each well, ensuring there are at least two wells per treatment. Additionally, include 2 control wells with 100 &#181;L PBS for each ligand; this provides the background absorbance of the assay. Cover the plate with a lid, seal the edges with paraffin film to reduce evaporation, and leave overnight on a shaking incubator at 4 &#176;C or for 2 h at room temperature.</li>
	<li>Prepare the blocking buffer by making 5% skim milk solids (w/v) in PBS with 0.05% Tween 20 (PBST).</li>
	<li>Remove the treated capsid solutions from the plate. Add 200 &#181;L/well of blocking buffer. Incubate for 2 h at room temperature or overnight, sealed at 4 &#176;C.</li>
	<li>Prepare the ligand binding solutions for the biotinylated aptamer M6-218,29 and biotinylated synthetic HBGA blood type A or biotinylated type H.
	<ol>
		<li>Dilute the biotinylated aptamer to 1 &#181;M in nuclease-free water. Ensure that there is enough solution for 200 &#181;L total for each treatment. Dilute the chosen biotinylated HBGA to 30 &#181;g/mL in the blocking buffer. Ensure that there is enough solution for 200 &#181;L total volume for each treatment. 
		NOTE: To use less HBGA, 10 &#181;g/mL of HBGA in 0.25% skim milk-PBST can be substituted. Concentrations for both biotinylated M6-2 and HBGA have been previously optimized and reported.</li>
	</ol>
	</li>
	<li>Remove blocking buffer and wash the plates 3 times with 200 &#181;L/well PBST. Pat the plate upside down on sterile paper towels to dry the residual moisture.</li>
	<li>Add 100 &#181;L/well of the ligand binding solutions, ensuring that there are 2 wells per heat treatment-ligand combination. Incubate the plate covered with a lid on an orbital shaker at about 60 rpm for 1 h at room temperature. 
	NOTE: Be sure to include 2 wells each of the untreated capsids and completely denatured capsids for each ligand as positive and negative controls, respectively. Additionally, include 2 &#34;no capsid&#34; wells for each ligand as the plate background control.</li>
	<li>Remove the ligand solutions and wash the wells 3 times with 200 &#181;L/well PBST. Pat the plate upside down on sterile paper towels to dry residual moisture.</li>
	<li>Add 100 &#181;L/well of solution of 0.2 &#181;g/mL streptavidin-horseradish peroxidase in PBS. Incubate for 15 min at room temperature with gentle shaking on an orbital shaker. 
	NOTE: Different streptavidin-horseradish peroxidase conjugates will have different concentrations. Consult the user&#39;s manual for the ideal range of concentrations for ELISA applications of enzyme and be sure it is optimal.</li>
	<li>Remove the conjugate solution. Wash 3 times with 200 &#181;L/well PBST. Pat the plate upside down on sterile paper towels to dry residual moisture.</li>
	<li>Add 100 &#181;L/well 3,3&#39;,5,5&#39;-tetramethylbenzidine (TMB) substrate, and allow the color to develop for 5 - 15 min. Observe negative control wells for any color and be sure to consistently develop for the same time between replicate plates. Be aware of the absorbance range of the plate reader used, as well. 
	NOTE: The developing times may differ based on the quality of the ligands/reagents used.</li>
	<li>Stop the development of the reaction with 100 &#181;L/well 1M phosphoric acid. Immediately read plate at 450 nm. Save the data. 
	NOTE: Introduction of the acid generally slows the reaction drastically but does not completely stop it. Do not leave the stopped plate for an extended amount of time before reading the absorbance.</li>
</ol>
2. Analysis of Plate-based Assay Results
<ol>
	<li>Save the raw absorbance data in a spreadsheet program. Produce the average absorbances for each well pair with the specific treatment and ligand. Use these averages for all subsequent analyses. 
	NOTE: Compare both well absorbances to be sure that no pairs of wells have significantly disparate values.</li>
	<li>To analyze the absolute capsid integrity (all binding), subtract the raw absorbance of the &#34;no capsid&#34; control from every other sample absorbance value. 
	NOTE: Alternatively, loss of binding due to loss of higher order (secondary, tertiary, quaternary) structure can directly be analyzed. Instead of subtracting the absorbance of the negative (no capsid) control, subtract the value of the completely denatured capsid control. This removes all binding signal due to nonspecific binding to the apparatus as well as binding due to the capsid sequence. HBGA and aptamer M6-2 display little binding to completely denatured capsid, so either method produces similar results. False positive signal attributed to nonspecific aptamer binding must be considered when choosing which analysis to use.</li>
	<li>With the negative or denatured control-adjusted absorbances, divide the treatment absorbances by their respective positive (no treatment) control absorbances and multiply by 100. This provides the percentage of signal of the treated capsid relative to the untreated control.</li>
	<li>To estimate the degree of binding signal for each ligand attributable to the capsid sequence, subtract the &#34;no capsid&#34; negative control from the initial absorbances, and take the adjusted absorbance of the denatured capsid. Divide this by the adjusted absorbance of the positive control signal, and multiply it by 100. This gives the apparent percentage of signal due to ligand binding to denatured capsid/capsid sequence.</li>
</ol>
3. DLS for Detecting Virus Aggregation After Heat Treatment
NOTE: The steps below may be specific to the software and instrument used, but can be adapted and applied to similar devices.
<ol>
	<li>Create a new size SOP in the DLS instrument software using: Material = Protein, Dispersant = PBS, Temperature = 25 &#176;C, Equilibration time = 0 sec, Cell type = disposable cuvette (small volume, ZEN0040), Measurement angle = 173&#176; Backscatter, Measurement duration = automatic, Number of measurements = 3, Delay between measurements = 0 sec, Data processing: Analysis model = General purpose (normal resolution). Use the default settings for all other parameters.</li>
	<li>Select the green run arrow within the software, and name the sample.</li>
	<li>Follow steps 1.1.1 through 1.1.4 for the heat treatment of VLPs.</li>
	<li>Dilute the heat treated VLPs 1:10 in 1x PBS for a final concentration of 5 &#181;g/mL. (Optional) Filter the sample with a 1 &#181;m pore size to remove dust particles; DLS is very sensitive to dust, as large particles scatter much more light than small particles.</li>
	<li>Transfer 50 &#181;L of diluted VLPs into a small volume disposable cuvette. Insert the cuvette into the sample chamber of the instrument.</li>
	<li>Start the run, and use the &#39;Correlogram&#39;, &#39;Cumulants Fit&#39;, and &#39;Expert Advice&#39; tabs to evaluate data quality.
	<ol>
		<li>During the run, check that the polydispersity index value is less than 0.3, representing a quality measurement.&#160; In the &#8216;Multi-view&#8217; tab, make sure the correlation coefficient is constant and close to, but not more than 1, at a short time, and drops off sharply to 0 at a later time, characteristic of particle size. Use the &#8216;Expert Advice&#8217; tab for feedback on the data quality during the measurements.</li>
		<li>After the measurement is complete, check again that the polydispersity index value is less than 0.3. Make sure that the cumulants fit line follows the data points closely in the &#8216;Cumulants fit&#8217; tab.</li>
	</ol>
	</li>
	<li>Take the average of the Z-average particle diameter reported for each measurement as the particle size of each sample. Plot the diameter in nm vs. temperature in &#176;C.</li>
</ol>
4. DLS for Detecting Virus Aggregation in Real Time
NOTE: The steps below may be specific to the software and instrument used, but can be adapted and applied to similar devices.
<ol>
	<li>Create a new size SOP in the DLS instrument software using: Material = Protein, Dispersant = PBS, Temperature = as desired, Equilibration time = 0 sec, Cell type = quartz cuvette, Measurement angle = 173&#176; Backscatter, Measurement duration = automatic, Number of measurements = 50 (may be increased or decreased depending on aggregation rate), Delay between measurements = 0 sec, Data processing: Analysis model = Multiple narrow modes (high resolution). Use the default settings for all other parameters.</li>
	<li>Select the run arrow within the software to open and name a new sample, and allow the instrument to reach the temperature equilibrium.</li>
	<li>Suspend the VLPs in 1X&#160;PBS in a microcentrifuge tube at a concentration of 5 &#181;g/mL and a volume between 200 - 500 &#181;L. Vortex the suspension.</li>
	<li>Spin down the VLP suspension for 5 - 10 s in a tabletop centrifuge to de-gas. This helps to prevent bubble formation during the heat treatment that interferes with size measurements.</li>
	<li>Transfer the VLP suspension to a small volume quartz cuvette-avoid bubbles and pipette slowly against the wall of the cuvette. After the instrument has reached temperature equilibrium, insert the cuvette into the sample chamber.</li>
	<li>Wait 10 s for the sample temperature to equilibrate, then start the run. Start a timer at the start of the run. Stop the timer at the end of the first measurement. Take this time as the first time point. Obtain subsequent time points from the measurement times recorded by the software.</li>
	<li>Start the run, and monitor the correlogram, distribution fit, and expert advice to evaluate the data quality. 
	NOTE: The PDI will not necessarily be less than 0.3 for these measurements as the sample is expected to be polydisperse during aggregation.
	<ol>
		<li>Make sure the correlation coefficient is constant and close to, but not more than 1 at short time, and drops off sharply at one or more later times, characteristic of particle size.</li>
		<li>Make sure the distribution fit line follows the data points closely.</li>
	</ol>
	</li>
	<li>Analyze the size data.
	<ol>
		<li>Determine each time point from the difference in time between each measurement and the initial time point. Measurement durations are not all exactly the same.</li>
		<li>Using an intensity distribution, record the size of the peaks with the largest areas for each measurement/time point.</li>
		<li>Plot the peak diameters in nm vs. time in min.</li>
	</ol>
	</li>
</ol>
5. TEM Sample Preparation
<ol>
	<li>Obtain carbon support film (nickel) grids designed for TEM. 
	NOTE: Consult with the core facility on recommended reagents and their handling for use with the facility microscope. Be sure to store grids in a box containing desiccant or a vacuum chamber to minimize exposure to moisture.</li>
	<li>Tear approximately 5 cm x 5 cm pieces of filter paper. Obtain glass Petri dishes and proper self-closing reverse tweezers designed for use in microscopy.</li>
	<li>Cut approximately 2.5 cm x 5 cm piece of paraffin film. Place on the benchtop.</li>
	<li>Heat treatment of norovirus GII.4 Sydney capsids
	<ol>
		<li>Follow the heat treatment procedure exactly as described above in steps 1.1.1 - 1.1.5 except: use 10 mM HEPES (pH 7.4) for treatment instead of PBS and do not further dilute capsids after treatment (keep solution at 50 &#181;g/mL). Pipette the entire ~15 &#181;L drop of treated capsid solution onto paraffin film.</li>
	</ol>
	</li>
	<li>Grab the grid edge with tweezers, allowing them to close on the edge to hold the grid, and place the grid carbon-side-down on top of the drop of treated solution. Let incubate for 10 min to allow the capsid to attach to the grid.
	<ol>
		<li>Depending on the purity of the capsid preparation, add washes of the 10 mM HEPES solution if needed in the form of 10-15 &#181;L droplets placed in line after the treated capsid droplet.</li>
		<li>After 10 min, pick up the grid with the droplet. Place the grid nearly perpendicular to a piece of filter paper to wick away the droplet. Pick the droplet of 10 - 15 &#181;L HEPES buffer up with the grid, hold for 30 s, then wick away with another piece of filter paper to wash.</li>
	</ol>
	</li>
	<li>Place a 15 &#181;L droplet of 2% uranyl acetate solution on the paraffin film in an empty area.
	<ol>
		<li>Pick up the droplet of uranyl acetate with the grid and hold for 45 s. Wick away the uranyl acetate, being sure to remove most of the solution. Place the grid carbon-side up on a piece of filter paper, being careful that the grid does not &#34;stick&#34; to the moisture on the tweezers. Place the filter paper with the grid on it in an open glass Petri dish. 
		NOTE: Do not use plastic Petri dishes, as the grids will be electrostatically attracted to them and become stuck to dish.</li>
	</ol>
	</li>
	<li>Repeat for all treatments. Place the Petri dish halves with the grids in a desiccator overnight to dry prior to observing with TEM.</li>
	<li>Consult the microscopy facility at the respective institution regarding observing the prepared grids. Some facilities permit the user to be trained on the operation of their facility&#39;s instrument. Specific details regarding the setup and observation of a specific microscope is beyond the scope of this article.</li>
</ol>

<ol>
	<li>Kirk, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=World+Health+Organization+estimates+of+the+global+and+regional+disease+burden+of+11+foodborne+bacterial,+protozoal,+and+viral+diseases,+2010:+A+data+synthesis.">World Health Organization estimates of the global and regional disease burden of 11 foodborne bacterial, protozoal, and viral diseases, 2010: A data synthesis.</a> PLOS Med. 12 (12), e1001920 (2015).</li><li>Scharff, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+burden+from+health+losses+due+to+foodborne+illness+in+the+United+States.">Economic burden from health losses due to foodborne illness in the United States.</a> J. Food Prot. 75 (1), 123-131 (2012).</li><li>Lee, B. Y., Mcglone, S. M., Bailey, R. R., Zachary, S., Umscheid, C. A., Muder, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+impact+of+outbreaks+of+norovirus+infection+in+hospitals.">Economic impact of outbreaks of norovirus infection in hospitals.</a> Infect. Control Hosp. Epidemiol. 32 (2), 191-193 (2011).</li><li>Law, J. W. -. F., Ab Mutalib, N. -. S., Chan, K. -. G., Lee, L. -. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+methods+for+the+detection+of+foodborne+bacterial+pathogens:+principles,+applications,+advantages+and+limitations.">Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations.</a> Front. Microbiol. 5, 770 (2015).</li><li>Jones, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enteric+bacteria+promote+human+and+mouse+norovirus+infection+of+B+cells.">Enteric bacteria promote human and mouse norovirus infection of B cells.</a> Science. 346 (6210), 755-759 (2014).</li><li>Ettayebi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+of+human+noroviruses+in+stem+cell+-+derived+human+enteroids.">Replication of human noroviruses in stem cell - derived human enteroids.</a> Science. 5211, (2016).</li><li>Moore, M. D., Goulter, R. M., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+as+a+foodborne+pathogen:+challenges+and+developments.">Human norovirus as a foodborne pathogen: challenges and developments.</a> Annu. Rev. Food Sci. Technol. 6 (1), 411-433 (2015).</li><li>Miura, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histo-blood+group+antigen-like+substances+of+human+enteric+bacteria+as+specific+adsorbents+for+human+noroviruses.">Histo-blood group antigen-like substances of human enteric bacteria as specific adsorbents for human noroviruses.</a> J. Virol. 87 (17), 9441-9451 (2013).</li><li>Almand, E. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+binding+to+select+bacteria+representative+of+the+human+gut+microbiota.">Human norovirus binding to select bacteria representative of the human gut microbiota.</a> Plos One. 12 (3), e0173124 (2017).</li><li>Rubio-del-Campo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Noroviral+P-Particles+as+an+in+vitro+model+to+assess+the+interactions+of+noroviruses+with+probiotics.">Noroviral P-Particles as an in vitro model to assess the interactions of noroviruses with probiotics.</a> PLoS ONE. 9 (2), e89586 (2014).</li><li>Hirneisen, K. A., Kniel, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+ELISA+attachment+and+infectivity+assays+for+murine+norovirus.">Comparison of ELISA attachment and infectivity assays for murine norovirus.</a> J. Virol. Methods. 186 (1-2), 14-20 (2012).</li><li>Dancho, B. A., Chen, H., Kingsley, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discrimination+between+infectious+and+non-infectious+human+norovirus+using+porcine+gastric+mucin.">Discrimination between infectious and non-infectious human norovirus using porcine gastric mucin.</a> Int. J. Food Microbiol. 155 (3), 222-226 (2012).</li><li>Li, X., Chen, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+porcine+gastric+mucin+binding+assay+for+high-pressure-inactivation+studies+using+murine+norovirus+and+Tulane+virus.">Evaluation of the porcine gastric mucin binding assay for high-pressure-inactivation studies using murine norovirus and Tulane virus.</a> Appl. Environ. Microbiol. 81 (2), 515-521 (2015).</li><li>Lou, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+inactivation+of+human+norovirus+virus-like+particles+provides+evidence+that+the+capsid+of+human+norovirus+is+highly+pressure+resistant.">High-pressure inactivation of human norovirus virus-like particles provides evidence that the capsid of human norovirus is highly pressure resistant.</a> Appl. Environ. Microbiol. 78 (15), 5320-5327 (2012).</li><li>Wang, D., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+conditions+for+human+norovirus+measured+by+an+in+situ+capture-qRT-PCR+method.">Inactivation conditions for human norovirus measured by an in situ capture-qRT-PCR method.</a> Int. J. Food Microbiol. 172, 76-82 (2014).</li><li>Wang, D., Xu, S., Yang, D., Young, G. M., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+in+situ+capture+quantitative+(real-time)+reverse+transcription-PCR+method+as+an+alternative+approach+for+determining+inactivation+of+Tulane+virus.">New in situ capture quantitative (real-time) reverse transcription-PCR method as an alternative approach for determining inactivation of Tulane virus.</a> Appl. Environ. Microbiol. 80 (7), 2120-2124 (2014).</li><li>Moore, M. D., Bobay, B. G., Mertens, B., Jaykus, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+aptamer+exhibits+high+degree+of+target+conformation-dependent+binding+similar+to+that+of+receptors+and+discriminates+particle+functionality.">Human norovirus aptamer exhibits high degree of target conformation-dependent binding similar to that of receptors and discriminates particle functionality.</a> mSphere. 1 (6), e00298-e00216 (2016).</li><li>Moore, M. D., Escudero-Abarca, B. I., Suh, S. H., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+characterization+of+nucleic+acid+aptamers+targeting+the+capsid+P+domain+of+a+human+norovirus+GII.4+strain.">Generation and characterization of nucleic acid aptamers targeting the capsid P domain of a human norovirus GII.4 strain.</a> J. Biotechnol. 209, 41-49 (2015).</li><li>Kitamoto, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-Reactivity+among+Several+Recombinant+Calicivirus+Virus-Like+Particles+(VLPs)+with+Monoclonal+Antibodies+Obtained+from+Mice+Immunized+Orally+with+One+Type+of+VLP.">Cross-Reactivity among Several Recombinant Calicivirus Virus-Like Particles (VLPs) with Monoclonal Antibodies Obtained from Mice Immunized Orally with One Type of VLP.</a> J. Clin. Microbiol. 40 (7), 2459-2465 (2002).</li><li>Giamberardino, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrasensitive+norovirus+detection+using+DNA+aptasensor+technology.">Ultrasensitive norovirus detection using DNA aptasensor technology.</a> PloS one. 8 (11), e79087 (2013).</li><li>Beier, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+a+DNA+aptamer+against+norovirus+capsid+protein+VP1.">Selection of a DNA aptamer against norovirus capsid protein VP1.</a> FEMS Microbiol. Lett. 351 (2), 162-169 (2014).</li><li>Escudero-Abarca, B. I., Suh, S. H., Moore, M. D., Dwivedi, H. P., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection,+characterization+and+application+of+nucleic+acid+aptamers+for+the+capture+and+detection+of+human+norovirus+strains.">Selection, characterization and application of nucleic acid aptamers for the capture and detection of human norovirus strains.</a> PloS one. 9 (9), e106805 (2014).</li><li>Bhattacharjee, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DLS+and+zeta+potential+-+What+they+are+and+what+they+are+not?.">DLS and zeta potential - What they are and what they are not?.</a> Journal Control. Release. 235, 337-351 (2016).</li><li>Khodabandehloo, A., Chen, D. D. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Particle+sizing+methods+for+the+detection+of+protein+aggregates+in+biopharmaceuticals.">Particle sizing methods for the detection of protein aggregates in biopharmaceuticals.</a> Bioanalysis. 9 (3), 313-326 (2017).</li><li>Mattle, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+virus+aggregation+on+inactivation+by+peracetic+acid+and+implications+for+other+disinfectants.">Impact of virus aggregation on inactivation by peracetic acid and implications for other disinfectants.</a> Environ. Sci. Technol. 45, 7710-7717 (2011).</li><li>Samandoulgou, I., Fliss, I., Jean, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeta+potential+and+aggregation+of+virus-like+particle+of+human+norovirus+and+feline+calicivirus+under+different+physicochemical+conditions.">Zeta potential and aggregation of virus-like particle of human norovirus and feline calicivirus under different physicochemical conditions.</a> Food Environ. Virol. 7 (3), 249-260 (2015).</li><li>Mertens, B. S., Velev, O. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Soft+matter+norovirus+interactions.">Soft matter norovirus interactions.</a> Soft Matter. 11, 8621-8631 (2015).</li><li>Panyukov, Y., Yudin, I., Drachev, V., Dobrov, E., Kurganov, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+study+of+amorphous+aggregation+of+tobacco+mosaic+virus+coat+protein+by+dynamic+light+scattering.">The study of amorphous aggregation of tobacco mosaic virus coat protein by dynamic light scattering.</a> Biophys. Chem. 127 (1-2), 9-18 (2007).</li><li>Moore, M. D., Escudero-Abarca, B. I., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Enzyme-Linked+Aptamer+Sorbent+Assay+to+Evaluate+Aptamer+Binding.">An Enzyme-Linked Aptamer Sorbent Assay to Evaluate Aptamer Binding.</a> Methods in Molecular Biology. 1575, 291-302 (2017).</li><li>Langlet, J., Gaboriaud, F., Gantzer, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+pH+on+plaque+forming+unit+counts+and+aggregation+of+MS2+bacteriophage.">Effects of pH on plaque forming unit counts and aggregation of MS2 bacteriophage.</a> J. Appl. Microbiol. 103, 1632-1638 (2007).</li><li>Manuel, C. S., Moore, M. D., Jaykus, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Destruction+of+the+Capsid+and+Genome+of+GII.4+Human+Norovirus+Occurs+during+Exposure+to+Metal+Alloys+Containing+Copper.">Destruction of the Capsid and Genome of GII.4 Human Norovirus Occurs during Exposure to Metal Alloys Containing Copper.</a> Appl. Environ. Microbiol. 81 (15), 4940-4946 (2015).</li><li>Warnes, S. L., Summersgill, E. N., Keevil, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+murine+norovirus+on+a+range+of+copper+alloy+surfaces+is+accompanied+by+loss+of+capsid+integrity.">Inactivation of murine norovirus on a range of copper alloy surfaces is accompanied by loss of capsid integrity.</a> Appl. Environ. Microbiol. , (2014).</li><li>Manuel, C., Moore, M. D., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficacy+of+a+disinfectant+containing+silver+dihydrogen+citrate+against+GI.6+and+GII.4+human+norovirus.">Efficacy of a disinfectant containing silver dihydrogen citrate against GI.6 and GII.4 human norovirus.</a> J. Appl. Microbiol. 122 (1), 78-86 (2017).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin+and+streptavidin.">Avidin and streptavidin.</a> Methods Enzymol. 184, 51-67 (1990).</li><li>Kingsley, D. H., Vincent, E. M., Meade, G. K., Watson, C. L., Fan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+human+norovirus+using+chemical+sanitizers.">Inactivation of human norovirus using chemical sanitizers.</a> Int. J. Food Microbiol. 171, 94-99 (2014).</li><li>Tian, P., Yang, D., Quigley, C., Chou, M., Jiang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+the+Tulane+virus,+a+novel+surrogate+for+the+human+norovirus.">Inactivation of the Tulane virus, a novel surrogate for the human norovirus.</a> J. Food Prot. 76 (4), 712-718 (2013).</li><li>Li, D., Baert, L., Van Coillie, E., Uyttendaele, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+studies+on+binding-based+RT-PCR+detection+of+infectious+noroviruses.">Critical studies on binding-based RT-PCR detection of infectious noroviruses.</a> J. Virol. Methods. 177 (2), 153-159 (2011).</li></ol>

The authors have nothing to disclose.

The protocol and techniques described here provide a means of assessing human norovirus capsid integrity/functionality. These methods can be used for obtaining mechanistic insight into the effects of inactivation treatments against the virus, and can potentially supplement more traditional inactivation evaluation methods such as RT-qPCR or plaque assay. For instance, the evaluation of chemical or physical inactivation by plaque assay alone provides a measure of degree of virus inactivation but not the underlying mechanis...

Human norovirus is responsible for a considerable public health burden globally, causing about 685 million illnesses and 212,000 deaths annually1, at a cost in the billions of dollars2,3. Today, norovirus detection and quantification involves genome amplification and/or ligand-based platforms. The former is generally preferred as it is more sensitive, provides quantitative information, and has generally lower risk of false positive results4. The most common norovirus detection and quantification genome amplification technique is reverse transcriptase quantitative polymerase chain reaction (RT-qPCR). Because it targets and amplifies a small segment of the human norovirus genome, RT-qPCR alone is not capable of discriminating between infectious and non-infectious particles, as free genomic RNA, damaged capsids containing genomes, and capsids with fatally mutated/truncated genomes can still be amplified by RT-qPCR. While two new in vitro cultivation techniques for human norovirus5,6 have been reported recently, both still rely on RT-qPCR for virus quantification and are not yet feasible methods for routine clinical/environmental testing for human noroviruses. Thus, RT-qPCR remains the gold standard for clinical/environmental testing.
Other in vitro methods have been developed in an effort to better estimate the infectivity status of norovirus particles. These methods can be generally categorized as those that address the integrity of the norovirus capsid and those evaluating genome integrity. The former approach is more popular. A commonly used method is RNase pretreatment prior to extraction of viral genomic RNA, however this does not account for viral particles that remain intact but lack the ability to bind host receptors/co-factors, as well as viral particles that have fatally mutated or have truncated or marginally damaged genomes7. Capsid integrity can also be evaluated based on the ability of the virus to bind to human norovirus co-receptor/co-factors, which are carbohydrates known as histo-blood group antigens (HBGAs). HBGAs are present in host intestinal epithelial cells as part of glycoproteins or glycolipids (among multiple other tissues) and may be secreted in bodily fluids like saliva. Enteric bacteria containing HBGA-like substances on their surfaces have also been shown to bind human norovirus8,9,10, and such interactions may promote norovirus infection5. The basic concept of utilizing HBGA binding is that only viral particles capable of binding the putative receptor/co-factor would be capable of infecting cells. Multiple studies suggest that bead-based HBGA binding preceding nucleic acid amplification is a promising method for infectivity discrimination11,12,13,14,15,16. A major challenge regarding HBGAs is that no single HBGA type can bind all human norovirus genotypes. To address this, porcine gastric mucin, which contains HBGAs, has been used in place of purified HBGA carbohydrates in the interest of ease of synthesis, consistency, and reduced cost.
A recent publication by Moore et al.17 introduced a set of new techniques for estimating human norovirus capsid integrity. In place of HBGAs, Moore et al.17 investigated binding of a broadly reactive nucleic acid aptamer (M6-2)18 and broadly reactive monoclonal antibody (NS14)19 to heat-treated GII.4 Sydney norovirus capsids (virus-like particles or VLPs) and compared this to the binding to synthetic HBGAs. Nucleic acid aptamers are short (~20 - 80 nt) single stranded nucleic acids (ssDNA or RNA) that fold into unique three-dimensional structures as a consequence of their sequence and bind a target. Because they are nucleic acids, they are less costly; easily chemically synthesized, purified, and modified; and stable to heat. Several reports of aptamers generated against noroviruses exist, with some of them showing broad reactivity to a variety of strains18,20,21,22. By way of example, Moore et al.17 demonstrated that aptamer M6-2 bound to purified, assembled human norovirus capsids (VLPs) and behaved similarly to HBGA in the reliance on the viral capsid to maintain higher order (e.g., secondary and tertiary) protein structure for binding to occur. On the other hand, a significant proportion of norovirus VLP binding to antibody NS14 remained after capsids were completely denatured. Evaluation of norovirus binding in the study by Moore et al.17 was done using a simple, plate-based method similar to ELISA, with the exception that aptamers are used in place of antibodies (hence the method was called ELASA). This high throughput experimental method was used to evaluate the effects of different treatments on the norovirus capsid, work that is valuable for understanding the mechanism of viral inactivation upon exposure to physical or chemical stressors. However, one drawback to this method is the lower sensitivity and lack of tolerance for matrix-associated contaminants at higher levels that cause non-specific binding by aptamers.
Moore et al.17 used another method, dynamic light scattering (DLS), to monitor aggregation of viral particles in response to heat treatment. DLS is commonly used to evaluate the size of nanoparticle suspensions and has been extended to proteins23,24 and viruses25,26,27. The intensity of light scattered by particles in solution fluctuates as a function of particle size, allowing for the calculation of diffusion coefficient and then particle diameter using well-established formulae. The DLS technique can distinguish the hydrodynamic diameter of dispersed particles down to the nanoscale, which allows detection of dispersed viruses, individual capsid proteins or dimers, and virus aggregates based on size27. Virus aggregation, represented by an increase in particle size, is indicative of loss of capsid integrity. As the capsid is denatured and its structure disrupted, hydrophobic residues become exposed and cause the particles to stick together and form aggregates. DLS can be used to measure particle size after a specified treatment or the kinetics of aggregation in real time17,28. This method has the advantage of allowing observation of capsid behavior in solution but requires high concentrations of purified capsid, which may not be entirely representative of the virus in its natural state.
The final method utilized by Moore et al.17 was transmission electron microscopy (TEM). Although this method lacks sensitivity and does not produce quantitative data, it allows for visualization of the effects of different treatments on the viral capsid structure. Although not yet ideal for clinical/environmental settings, the use of these methods in combination is valuable in understanding human norovirus inactivation. The purpose of this article is to provide in-depth protocols for the plate-based binding assay (ELASA), DLS, and TEM preparation methods used to investigate the effects of heat treatments on the norovirus capsid in the context of the treatments&#39; effects on capsid integrity as presented in Moore et al.17.

<table><tbody><tr><td>&lt;strong&gt;Plate-Based Binding Assay for Evaluating Loss of Higher Order Norovirus Capsid Structure&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>96-well, medium-binding polystyrene EIA plate</td><td>Fisher (Costar)</td><td>07-200-36</td><td></td></tr><tr><td>Lid for 96-well plate</td><td>Thermo Fisher</td><td>3098</td><td></td></tr><tr><td>Paraffin film (Parafilm)</td><td>Thermo Fisher</td><td>PM999</td><td></td></tr><tr><td>1x PBS (pH 7.2)</td><td>Life Technologies</td><td>20012-050</td><td></td></tr><tr><td>Polysorbate 20</td><td>Sigma-Aldrich</td><td>P9416</td><td></td></tr><tr><td>1x PBS (pH 7.2) + 0.05% Polysorbate 20</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>Purified, assembled human norovirus GII.4 capsids</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>Individual 0.2 ml PCR tubes</td><td>Genesee Scientific</td><td>22-154G</td><td></td></tr><tr><td>2 thermocyclers</td><td>Bio-Rad</td><td>1861096</td><td></td></tr><tr><td>Tabletop mini centrifuge</td><td>Fisher Scientific</td><td>12-006-901</td><td></td></tr><tr><td>Skim milk solids</td><td>Thermo Fisher</td><td>LP0031B</td><td></td></tr><tr><td>Synthetic histo-blood group type A disaccharide, biotinylated</td><td>Glycotech</td><td>01-017</td><td></td></tr><tr><td>Biotinylated aptamer M6-2 (stock concentration 100 &amp;micro;M in nuclease-free water): 5&#039;-/5Biosg/AGTATACGTATTACCTGCAGCTGGGAAGAGGTCCGGTAAATGCAGGGTCAGCCCGGAGAGCGATATCTCGGAGATCTTGC -3&amp;rsquo;</td><td>Integrated DNA Technologies</td><td>N/A</td><td></td></tr><tr><td>Streptavidin-horseradish peroxidase conjugate (ELISA grade), We use Life Technologies SNN2004</td><td>Life Technologies</td><td>SNN2004</td><td></td></tr><tr><td>3,3&amp;rsquo;,5,5&amp;rsquo;-tetramethylbenzidine (TMB) substrate, room temperature</td><td>Thermo Fisher</td><td>50-76-00</td><td></td></tr><tr><td>1 M phosphoric acid</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>Microplate reader capable of reading 450 nm</td><td>Tecan</td><td>Infinite m200 Pro</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Analysis of Plate-Based Assay Results&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Microsoft Excel or similar program</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Dynamic Light Scattering Experiments&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Zetasizer ZSP, or similar particle size analysis instrument</td><td>Malvern Instruments</td><td>N/A</td><td></td></tr><tr><td>Vortex</td><td>Fisher Scientifc</td><td>02-215-365</td><td></td></tr><tr><td>Quartz cuvette</td><td>Hellma</td><td>104-002-10-40</td><td></td></tr><tr><td>Small volume disposable cuvette (to reduce VLP use)</td><td>Malvern Instruments</td><td>ZEN0040</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Transmission Electron Microscopy Sample Preparation&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Nickel electron microscopy grids with carbon support film</td><td>Ladd Research</td><td>10880-100</td><td></td></tr><tr><td>Self-closing reverse electron microscopy tweezers</td><td>Ted Pella</td><td>5372-NM</td><td></td></tr><tr><td>Qualitative filter paper</td><td>Sigma-Aldrich (Whatman)</td><td>WHA1002055</td><td></td></tr><tr><td>Glass petri dishes</td><td>Sigma-Aldrich</td><td>BR455743</td><td></td></tr><tr><td>100 mM stock HEPES solution (pH 7.2)</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>2% uranyl acetate</td><td>N/A</td><td>N/A</td><td></td></tr></tbody></table>

alternative in vitro methods for the determination of viral capsid structural integrity

Human norovirus exacts considerable public health and economic losses worldwide. Emerging in vitro cultivation advances are not yet applicable for routine detection of the virus. The current detection and quantification techniques, which rely primarily on nucleic acid amplification, do not discriminate infectious from non-infectious viral particles. The purpose of this article is to present specific details on recent advances in techniques used together in order to acquire further information on the infectivity status of viral particles. One technique involves assessing binding of a norovirus ssDNA aptamer to capsids. Aptamers have the advantage of being easily synthesized and modified, and are inexpensive and stable. Another technique, dynamic light scattering (DLS), has the advantage of observing capsid behavior in solution. Electron microscopy allows for visualization of the structural integrity of the viral capsids. Although promising, there are some drawbacks to each technique, such as non-specific aptamer binding to positively-charged molecules from sample matrices, requirement of purified capsid for DLS, and poor sensitivity for electron microscopy. Nonetheless, when these techniques are used in combination, the body of data produced provides more comprehensive information on norovirus capsid integrity that can be used to infer infectivity, information which is essential for accurate evaluation of inactivation methods or interpretation of virus detection. This article provides protocols for using these methods to discriminate infectious human norovirus particles.

The structural integrity of human norovirus GII.4 Sydney capsids (VLPs) was assessed using several novel methods as presented by Moore et al.17. First, an experiment was done in which the integrity of the capsids as a function of their ability to bind a putative receptor/co-factor (HBGA) or ssDNA aptamer (M6-2) were compared (Figure 1). The results displayed have been previously presented by Moore et al.<sup class="xr...

Watch this Scientific Journal Video about Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity at JoVE.com

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Routine detection methods utilizing viral genome amplification are limited by their inability to discriminate infectious from non-infectious particles. The purpose of this article is to provide detailed protocols for alternative methods to aid in discrimination of infectious norovirus particles using aptamer binding, dynamic light scattering, and transmission electron microscopy.

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Human norovirus exacts considerable public health and economic losses worldwide. Emerging in vitro cultivation advances are not yet applicable for routine ...

alternative-vitro-methods-for-determination-viral-capsid-structural

Universidad de Cartagena UDEC

Research

JoVE Journal

Immunology and Infection

8.0K Views.  North Carolina State University. Routine detection methods utilizing viral genome amplification are limited by their inability to discriminate infectious from non-infectious particles. The purpose of this article is to provide detailed protocols for alternative methods to aid in discrimination of infectious norovirus particles using aptamer binding, dynamic light scattering, and transmission electron microscopy.

Video: Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Preparation of Viral DNA from Nucleocapsids

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. Several downstream applications require large quantities of pure viral DNA, which is provided by this protocol. These applications include viral genome sequencing, where the removal of host DNA is crucial to optimize data output for viral sequences, and the production of new viral recombinant strains, where co-transfection of purified plasmid and linear viral DNA facilitates recombination.1,2,3 
This procedure utilizes a combination of extractions and density-based centrifugation to isolate purified linear herpesvirus nucleocapsid DNA from infected cells.4,5 The initial purification steps aim to isolate purified viral capsids, which contain and protect the viral DNA during the extractions and centrifugation steps that remove cellular proteins and DNA. Lysis of nucleocapsids then releases viral DNA, and two final phenol-chloroform steps remove remaining proteins. The final DNA captured from solution is highly concentrated and pure, with an average OD260/280 of 1.90. Depending on the quantity of infected cells used, yields of viral DNA range from 150-800 &mu;g or more. The purity of this DNA makes it stable during long-term storage at 4C. This DNA is thus ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections. 
Prior to beginning the protocol, it is important to know the average number of cells per dish (e.g. an average of 8 x 106 PK-15 cells in a confluent 15 cm dish), and the titer of the viral stock to be used (e.g. 1 x 108 plaque-forming units per ml). These are necessary to calculate the appropriate multiplicity of infection (MOI) for the protocol.6 For instance, to infect one 15 cm dish of PK-15 cells with the above viral stock, at an MOI of 5, you would use 400 &mu;l of viral stock and dilute it with 3.6 ml of medium (total inoculation volume of 4 ml for one 15 cm plate).
Multiple viral DNA preparations can be prepared at the same time. The number of simultaneous preparations is limited only by the number of tubes held by the ultracentrifuge rotor (one per virus; see step 3.9 below). Here we describe the procedure as though being done for one virus.

We describe the process of isolating high purity herpesvirus nucleocapsid DNA from infected cells. The final DNA captured from solution is of high concentration and purity, making it ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections to produce new viral recombinants.

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. ...

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is composed of CA protein arranged as a lattice of hexagon. The capsid is closed by 7 pentamers at the broad end and 5 at the narrow end of the cone1, 2. Encased in this capsid shell is the viral ribonucleoprotein complex, and together they comprise the core.
Following fusion of the viral membrane with the target cell membrane, the HIV-1 is released into the cytoplasm. The capsid then disassembles releasing free CA in the soluble form3 in a process referred to as uncoating. The intracellular location and timing of HIV-1 uncoating are poorly understood. Single amino-acid substitutions in CA that alter the stability of the capsid also impair the ability of HIV-1 to infect cells4. This indicates that the stability of the capsid is critical for HIV-1 infection.
HIV-1 uncoating has been difficult to study due to lack of availability of sensitive and reliable assays for this process. Here we describe a quantitative method for studying uncoating in vitro using cores isolated from infectious HIV-1 particles. The approach involves isolation of cores by sedimentation of concentrated virions through a layer of detergent and into a linear sucrose gradient, in the cold. To quantify uncoating, the isolated cores are incubated at 37&deg;C for various timed intervals and subsequently pelleted by ultracentrifugation. The extent of uncoating is analyzed by quantifying the fraction of CA in the supernatant. This approach has been employed to analyze effects of viral mutations on HIV-1 capsid stability4, 5, 6. It should also be useful for studying the role of cellular factors in HIV-1 uncoating.

In vitro Uncoating of HIV-1 Cores

Uncoating is an essential step in the early phase of the HIV-1 life cycle and is defined as the disassembly of the capsid shell and the release of the viral ribonucleoprotein complex (vRNP). Here, we demonstrate techniques for isolating intact cores from HIV-1 virions and for quantifying their uncoating in vitro.

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal phase during establishment of infection in a given host. Consequently, study of encapsidation deciphers the information regarding the know-how of the mechanism regulating virus assembly to form infectious virions. Such information is vital in formulating novel methods of curbing virus spread and disease control. Virus encapsidation can be studied in vivo and in vitro. Genome encapsidation in vivo is a highly regulated selective process involving macromolecular interactions and subcellular compartmentalization. Therefore, study leading to dissect events encompassing virus encapsidation in vivo would provide basic knowledge to understand how viruses proliferate and assemble. Recently in vitro encapsidation has been exploited for the research in the area of biomedical imaging and therapeutic applications. Non-enveloped plant viruses stand far ahead in the venture of in vitro encapsidation of the negatively charged foreign material. Brome mosaic virus (BMV), a non-enveloped multicomponent RNA virus pathogenic to plants, has been used as a model system for studying genome packaging in vivo and in vitro. For encapsidation assays in Nicotiana benthamiana plants, Agrobacterium -mediated transient expression, refer to as agroinfiltration, is an efficient and robust technique for the synchronized delivery and expression of multiple components to the same cell. In this approach, a suspension of Agrobacterium tumefaciens cells carrying binary plasmid vectors carrying cDNAs of desiredviral mRNAs is infiltrated into the intercellular space withina leaf using nothing more sophisticated than a 1 ml disposable syringe (without needle). This process results in the transfer of DNA insert into plant cells; the T-DNA insert remains transiently in the nucleus and is then transcribed by the host polymerase II, leading to the transient expression. The resulting mRNA transcript (capped and polyadenylated) is then exported to the cytoplasm for translation. After approximately 24 to 48 hours of incubation,sections of infiltrated leaves can be sampled for microscopyor biochemical analyses. Agroinfiltration permits large numbers (hundreds to thousands) of cells to be transfected simultaneously. For in vitro encapsidation, purified virions of BMV are dissociated into capsid protein by dialyzing against dissociation buffer containing calcium chloride followed by removal of RNA and un-dissociated virions by centrifugation. Genome depleted capsid protein subunits are then reassembled with desired viral genome components or non-viral components such as indocyanine dye.

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

A simple, efficient and robust way to synchronize the delivery of multiple viral components to plant cells via Agrobacterium-mediated transient expression is described. This approach is amenable for studying replication, encapsidation followed by in vitro reassembly of non-viral components into genome depleted optical viral ghosts suitable for biomedical applications.

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Isolation and Genome Analysis of Single Virions using 'Single Virus Genomics'

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which are ubiquitous and the most numerous entities on our planet 4 and important in all environments 5, have yet to be revealed via similar approaches. Here we describe an approach for isolating and characterizing the genomes of single virions called 'Single Virus Genomics' (SVG). SVG utilizes flow cytometry to isolate individual viruses and whole genome amplification to obtain high molecular weight genomic DNA (gDNA) that can be used in subsequent sequencing reactions.

Single Virus Genomics (SVG) is a method to isolate and amplify the genomes of single virons. Viral suspensions of a mixed assemblage are sorted using flow cytometry onto a microscope slide with discrete wells containing agarose, thereby capturing the virion and reducing genome shearing during downstream processing. Whole genome amplification is achieved using multiple displacement amplification (MDA) resulting in genomic material that is suitable for sequencing.

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which ...

Method for Measurement of Viral Fusion Kinetics at the Single Particle Level

Membrane fusion is an essential step during entry of enveloped viruses into cells. Conventional fusion assays typically report on a large number of fusion events, making it difficult to quantitatively analyze the sequence of the molecular steps involved. We have developed an in vitro, two-color fluorescence assay to monitor kinetics of single virus particles fusing with a target bilayer on an essentially fluid support.
Influenza viral particles are incubated with a green lipophilic fluorophore to stain the membrane and a red hydrophilic fluorophore to stain the viral interior. We deposit a ganglioside-containing lipid bilayer on the dextran-functionilized glass surface of a flow cell, incubate the viral particles on the planar bilayer and image the fluorescence of a 100 x 100 &mu;m2 area, containing several hundreds of particles, on a CCD camera. By imaging both the red and green fluorescence, we can simultaneously monitor the behavior of the membrane dye (green) and the aqueous content (red) of the particles.
Upon lowering the pH to a value below the fusion pH, the particles will fuse with the membrane. Hemifusion, the merging of the outer leaflet of the viral membrane with the outer leaflet of the target membrane, will be visible as a sudden change in the green fluorescence of a particle. Upon the subsequent fusion of the two remaining distal leaflets a pore will be formed and the red-emitting fluorophore in the viral particle will be released under the target membrane. This event will give rise to a decrease of the red fluorescence of individual particles. Finally, the integrated fluorescence from a pH-sensitive fluorophore that is embedded in the target membrane reports on the exact time of the pH drop.
From the three fluorescence-time traces, all the important events (pH drop, lipid mixing upon hemifusion, content mixing upon pore formation) can now be extracted in a straightforward manner and for every particle individually. By collecting the elapsed times for the various transitions for many individual particles in histograms, we can determine the lifetimes of the corresponding intermediates. Even hidden intermediates that do not have a direct fluorescent observable can be visualized directly from these histograms.

We present an in vitro, two-color fluorescence assay to visualize the fusion of single virus particles with a fluid target bilayer. By labeling viral particles with fluorophores that differentially stain the viral membrane and its interior, we are able to monitor the kinetics of hemifusion and pore formation.

Membrane fusion is an essential step during entry of enveloped viruses into cells. Conventional fusion assays typically report on a large number of fusion ...

Biology

Nucleocapsid Annealing-Mediated Electrophoresis (NAME) Assay Allows the Rapid Identification of HIV-1 Nucleocapsid Inhibitors

RNA or DNA folded in stable tridimensional folding are interesting targets in the development of antitumor or antiviral drugs. In the case of HIV-1, viral proteins involved in the regulation of the virus activity recognize several nucleic acids. The nucleocapsid protein NCp7 (NC) is a key protein regulating several processes during virus replication. NC is in fact a chaperone destabilizing the secondary structures of RNA and DNA and facilitating their annealing. The inactivation of NC is a new approach and an interesting target for anti-HIV therapy. The Nucleocapsid Annealing-Mediated Electrophoresis (NAME) assay was developed to identify molecules able to inhibit the melting and annealing of RNA and DNA folded in thermodynamically stable tridimensional conformations, such as hairpin structures of TAR and cTAR elements of HIV, by the nucleocapsid protein of HIV-1. The new assay employs either the recombinant or the synthetic protein, and oligonucleotides without the need of their previous labeling. The analysis of the results is achieved by standard polyacrylamide gel electrophoresis (PAGE) followed by conventional nucleic acid staining. The protocol reported in this work describes how to perform the NAME assay with the full-length protein or its truncated version lacking the basic N-terminal domain, both competent as nucleic acids chaperones, and how to assess the inhibition of NC chaperone activity by a threading intercalator. Moreover, NAME can be performed in two different modes, useful to obtain indications on the putative mechanism of action of the identified NC inhibitors.

Nucleocapsid Annealing-Mediated Electrophoresis NAME Assay Allows the Rapid Identification of HIV-1 Nucleocapsid Inhibitors

This protocol describes NAME, an assay that allows the rapid identification of molecules able to inhibit in vitro the chaperone activities of HIV-1 nucleocapsid protein.

RNA or DNA folded in stable tridimensional folding are interesting targets in the development of antitumor or antiviral drugs. In the case of HIV-1, viral ...

Highly Sensitive Assay for Measurement of Arenavirus-cell Attachment

Arenaviruses are a family of enveloped RNA viruses that cause severe human disease. The first step in the arenavirus life cycle is attachment of viral particles to host cells. While virus-cell attachment can be measured through the use of virions labeled with biotin, radioactive isotopes, or fluorescent dyes, these approaches typically require high multiplicities of infection (MOI) to enable detection of bound virus. We describe a quantitative (q)RT-PCR-based assay that measures Junin virus strain Candid 1 attachment via quantitation of virion-packaged viral genomic RNA. This assay has several advantages including its extreme sensitivity and ability to measure attachment over a large dynamic range of MOIs without the need to purify or label input virus. Importantly, this approach can be easily tailored for use with other viruses through the use of virus-specific qRT-PCR reagents. Further, this assay can be modified to permit measurement of particle endocytosis and genome uncoating. In conclusion, we describe a simple, yet robust assay for highly sensitive measurement of arenavirus-cell attachment.

The first step in the arenavirus life cycle is attachment of viral particles to host cells. We report a quantitative (q)RT-PCR-based assay for ultrasensitive detection and quantitation of arenavirus attachment events.

Arenaviruses are a family of enveloped RNA viruses that cause severe human disease. The first step in the arenavirus life cycle is attachment of viral ...

In Vitro Disassembly of Influenza A Virus Capsids by Gradient Centrifugation

Acid-triggered molecular processes closely control cell entry of many viruses that enter through the endocytic system. In the case of influenza A virus (IAV), virus fusion with the endosomal membrane as well as the subsequent disassembly of the viral capsid, called uncoating, is governed by the ionic conditions inside endocytic vesicles. The early steps in the virus life cycle are hard to study because endosomes cannot be directly accessed experimentally, creating the need for an in vitro approach. Here, we describe a method based on velocity gradient centrifugation of purified virions through a two-layer glycerol gradient, which enables analysis of the IAV core and its stability. The gradient contains a non-ionic detergent (NP-40) in its lower layer to remove the viral membrane by solubilization as the virus sediments toward the bottom. At neutral pH, viral cores are pelleted as stable structures. The major core components, matrix protein (M1) and the viral ribonucleoproteins (vRNPs), can be clearly identified in the pellet fraction by SDS-PAGE. Decreasing the pH to 6.0 or lower in the bottom layer selectively removes M1 from the pellet followed by release of vRNPs at more acidic conditions. Viral protein bands on Coomassie-stained gels can be subjected to densitometric quantification to monitor intermediate states of IAV disassembly. Besides pH, other factors that influence viral core stability can be assessed, such as salt concentration and putative viral uncoating factors, simply by modifying the detergent-containing glycerol layer accordingly. Taken together, the presented technique allows highly reproducible and quantitative analysis of viral uncoating in vitro. It can be applied to other enveloped viruses that undergo complex uncoating processes.

In Vitro Disassembly of Influenza A Virus Capsids by Gradient Centrifugation

Disassembly of influenza A virus cores during virus entry into host cells is a multistep process. We describe an in vitro method to analyze the early stages of viral uncoating. In this approach, velocity gradient centrifugation is used to biochemically dissect the steps that initiate uncoating under defined conditions.

Acid-triggered molecular processes closely control cell entry of many viruses that enter through the endocytic system. In the case of influenza A virus ...

Production of Adeno-Associated Virus Vectors in Cell Stacks for Preclinical Studies in Large Animal Models

Adeno-associated virus (AAV) vectors are among the most clinically advanced gene therapy vectors, with three AAV gene therapies approved for humans. Clinical advancement of novel applications for AAV involves transitioning from small animal models, such as mice, to larger animal models, including dogs, sheep, and nonhuman primates. One of the limitations of administering AAV to larger animals is the requirement for large quantities of high-titer virus. While suspension cell culture is a scalable method for AAV vector production, few research labs have the equipment (e.g., bioreactors) or know how to produce AAV in this manner. Moreover, AAV titers are often significantly lower when produced in suspension HEK 293 cells as compared to adherent HEK293 cells. Described here is a method for producing large quantities of high-titer AAV using cell stacks. A detailed protocol for titering AAV as well as methods for validating vector purity are also described. Finally, representative results of AAV-mediated transgene expression in a sheep model are presented. This optimized protocol for large-scale production of AAV vectors in adherent cells will enable molecular biology laboratories to advance the testing of their novel AAV therapies in larger animal models.

Here we provide a detailed procedure for large-scale production of research-grade AAV vectors using adherent HEK 293 cells grown in cell stacks and affinity chromatography purification. This protocol consistently yields &#62;1 x 1013 vector genomes/mL, providing vector quantities appropriate for large animal studies.

Adeno-associated virus (AAV) vectors are among the most clinically advanced gene therapy vectors, with three AAV gene therapies approved for humans. ...

Plaquing of Herpes Simplex Viruses

There are numerous published protocols for plaquing viruses, including references within primary literature for methodology. However, plaquing viruses can be difficult to perform, requiring focus on its specifications and refinement. It is an incredibly challenging method for new students to master, mainly because it requires meticulous attention to the most minute details. This demonstration of plaquing herpes simplex viruses should help those who have struggled with visualizing the method, especially its nuances, over the years. While this manuscript is based on the same principles of standard plaquing methodology, it differs in that it contains a detailed description of (1) how best to handle host cells to avoid disruption during the process, (2) a more useful viscous medium than agarose to limit the diffusion of virions, and (3) a simple fixation and staining procedure that produces reliably reproducible results. Furthermore, the accompanying video helps demonstrate the finer distinctions in the process, which are frequently missed when instructing others on conducting plaque assays.

Plaquing is a routine method used to quantify live viruses in a population. Though plaquing is frequently taught in various microbiology curricula with bacteria and bacteriophages, plaquing of mammalian viruses is more complex and time-consuming. This protocol describes the procedures that function reliably for regular work with herpes simplex viruses.

There are numerous published protocols for plaquing viruses, including references within primary literature for methodology. However, plaquing viruses can ...

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Summary

Explore More Videos

Chapters in this video

Preparation of Viral DNA from Nucleocapsids

In vitro Uncoating of HIV-1 Cores

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

Isolation and Genome Analysis of Single Virions using 'Single Virus Genomics'

Method for Measurement of Viral Fusion Kinetics at the Single Particle Level

Nucleocapsid Annealing-Mediated Electrophoresis (NAME) Assay Allows the Rapid Identification of HIV-1 Nucleocapsid Inhibitors

Highly Sensitive Assay for Measurement of Arenavirus-cell Attachment

In Vitro Disassembly of Influenza A Virus Capsids by Gradient Centrifugation

Production of Adeno-Associated Virus Vectors in Cell Stacks for Preclinical Studies in Large Animal Models

Plaquing of Herpes Simplex Viruses