Bu çalışma, Ulusal Ruh Sağlığı Enstitüsü'nden (R00MH103531 ve R01MH116901'den J.A.'ya), Ulusal Genel Tıp Enstitüsü'nden (T32GM007635'ten S.R.'ye) doktora öncesi eğitim Hibesi ve Lyda Hill Gilliam İleri Çalışma Bursu (GT11021'den S.R.'a) tarafından desteklendi. Mikroskopla ilgili yardımları için Dr. Kevin Woolfrey'e, epifluoresan mikroskopunun kullanımı için Dr. K Ulrich Bayer'e ve LRRTM2 plazmidi için Thomas Südhof'a (Stanford Üniversitesi) teşekkür ederiz.

1. Hücre kültürü ve transfeksiyon
<ol><li>DMEM, 1x (Dulbecco'nun Eagle's Medium Modifikasyonu) ile 4,5 g/L glikoz, L-glutamin ve sodyum piruvat ve %10 FBS ile desteklenmiş HEK hücre ortamı yapın. Steril filtre.</li>
	<li>Toplama tahlilleri için predetermin uygun ligandlar ve reseptörler. NOT: Bu çalışmada Neurexin3α SS4+/- ve bilinen ligandlarından biri olan LRRTM2 kullanılmıştır. Ligandlar ve ilgi reseptörleri pcDNA3.1'deki cDNA'lardan ifade edildi. Neurexin3α'yı pcDNA3.112'yeyerleştirmek için bir Gibson montajı kullanıldı. Neurexin3α F/R: TTTAAACTTAAGCTTGGTACCGAGCTCGGATCCGCCACCATGAGCTTTACCCTCCACTC/ GAGCGGCCGCCACTGTGCTGGATCTGCAGAATTCTTACATAATACTCCTTGTCCTT.</li>
	<li>HEK293T hücrelerini hazırlayın.<ol>
<li>HEK293T hücrelerini tek bir T-75 şişesinde izdiah etmek için büyütün.</li>
		<li>Birleştiğinde, 2 mL tripsin kullanın ve 2 dakika boyunca 37 °C inkübatöre yerleştirin. Hücreleri yeniden çıkarmak için şişeye 6 mL HEK ortamı ekleyin ve 8 mL'nin tamamını 15 mL konik bir tüpe aktarın.</li>
		<li>5 dakika boyunca 500 x g'da pelet ve toplam 8 mL için HEK hücre medyasında yeniden dirildi.</li>
		<li>Hücreleri sayın ve 6 kuyulu bir plakanın her kuyusuna 735.000 hücre ekleyin. HEK hücre ortamı kullanarak her kuyu için son ses seviyesini 2 mL'ye ayarlayın.</li>
		<li>37 °C inkübatöre yerleştirin ve hücrelerin bir gecede veya% 50-60 izdiah edene kadar büyümesine izin verin.</li>
	</ol></li>
	<li>Kalsiyum fosfat yöntemini kullanarak HEK293T hücrelerini transfect13.<ol>
<li>Well-1'i 3 μg faiz proteini ile transfect ve 1 μg floresan protein (3 μg pcDNA3.1-Neurexin3αWT SS4- ve 1 μg mCherry) ile birlikte transfect.</li>
		<li>1.4.1 adımında olduğu gibi well-2'ye transfect. ancak mutasyona uğramış ilgi proteini ile (pcDNA3.1-Neurexin3αA687T SS4-).</li>
		<li>3 μg faizli ligand ile well-3'ü transfect ve 1 μg başka bir floresan protein (3 μg pcDNA3.1 LRRTM2 ve 1 μg GFP).</li>
		<li>Negatif kontroller olarak hizmet etmek için kuyu-4 ve kuyu-5'i transfect: 1 μg GFP ile well-4 ve 1 μg mCherry ile well-5.</li>
		<li>Ek koşullar veya kontroller (Neurexin3αWT/A687T SS4+) gerekiyorsa başka bir plaka hazırlayın (adım 1.4.1-1.4.4'te olduğu gibi). NOT: Transfeksiyon verimliliği, bir epifluoresans mikroskobu altında transeksiyondan 24 saat sonra analiz edilir ve transektife edildikleri floresan proteini ifade eden hücre sayısı olarak ölçülür. Daha aerodinamik bir yaklaşım, HEK hücrelerinin floresan bir protein ve ilgi alanı için bicistronic vektör kodlaması ile transfectionını içerecektir ve ko-transfection üzerinde şiddetle tavsiye edilir. Bu çalışmada alfa Neurexins ~4.3 kb'dir ve ko-transfeksiyon gerektiren bir bicistronik sistem kullanılarak düşük floresan yoğunluğu gözlenmiştir.</li>
	</ol></li>
	<li>Transfection'dan 48 saat sonra, toplama için hücreleri toplar.<ol>
<li>PBS ile her kuyuya iki kez yıkayın.</li>
		<li>Hücreden hücreye etkileşimleri nazikçe ayırmak ve plakayı 5 dakika boyunca 37 °C'de kuluçkaya yatırmak için her kuyuya PBS'de 1 mL 10 mM EDTA ekleyin. NOT: Çalışmada yapışma moleküllerinin potansiyel proteolitik bölünmesi nedeniyle 1.5.2. adım için tripsin önerilmez. Ayrıca, EDTA eklendikten sonra, hücreler artık ortam koşullarına maruz kalacağından, protokol tamamlanana kadar durdurulmayabilir.</li>
		<li>Hücreleri ayırmak için plakaya hafifçe dokunun ve her kuyuyu ayrı 15 mL konik tüpler halinde hasat edin.</li>
		<li>500 x g'da santrifüj konik tüpler ve 5 dakika oda sıcaklığında.</li>
	</ol></li>
	<li>Hücreler peletlenirken, her mikrosantrifüj tüpünün üstünü her koşulda etiketleyerek 6 kuluçka tüpü hazırlayın. NOT: GFP ve mCherry koşullarının her permütasyonu, tüm deneysel koşulları ve uygun kontrolleri kapsayacak şekilde kullanılmalıdır. Örneğin: 1. GFP/mCherry, 2. mCherry/LRRTM2-GFP 3. GFP/Neurexin3αWT SS4-—mCherry, 4. GFP/Neurexin3αA687T SS4- –mCherry, 5. Neurexin3αWT SS4-—mCherry/LRRTM2—GFP, 6. Neurexin3αA687T SS4- –mCherry/LRRTM2—GFP. Daha fazla koşul ve kontrole uyum sağlamak için ek tüpler yapın.</li>
	<li>10 mM CaCl 2 ve 10 mM MgCl 2 ile 37 °C'yeısıtılmış 500μL HEK ortamdaki süpernatant ve resuspend hücrelerini çıkarın. NOT: CaCl2 ve MgCl2'nin eklenmesi, yapışma moleküllerinin bağlamayı yeniden kurmasını sağlar ve yalnızca söz konusu hücrelerarası etkileşim ortakları yapışma için dalgıç katyonları gerektiriyorsa gereklidir.</li>
	<li>Her 15 mL konik tüpteki hücreleri bir hemositometre ve aliquot 200.000 hücre kullanarak, toplam 500 μL hacimde 1:1 karışım için adım 1.6.1'den uygun tüpe sayın. NOT: Saymak ve aliquot miktarları için koşul başına sadece 5 dakika sürmelidir.</li>
	<li>Tüpleri oda sıcaklığında yavaş bir tüp rotatorunda kuluçkaya yatırın.</li>
</ol>2. Görüntü alımı
<ol><li>Belirli numuneler için mikroskop alma parametrelerini optimize edin. Bu örnekte, görüntüler geniş alan mikroskopunda alınmıştır. 5x hava hedefi kullanın (NA: 0.15; WD: 20000 μm) analiz için yeterince büyük bir alan elde etmek için.</li>
	<li>1.8. adımda HEK hücrelerinin iki koşulunun karıştırılmasından hemen sonra taban çizgisi toplamayı değerlendirin. Bunlar artık 'sıfır zamanı' görüntüleri.<ol>
<li>Pipet 40 μL her örnek karışımın yüklü bir mikroskop slayt ve görüntü floresan altında hem 488 hem de 561 kanallarda.</li>
		<li>Örnek bırakma başına bir odak düzleminden üç farklı görüş alanı elde edin.</li>
	</ol>
</li>
	<li>'Time 60' görüntüsü olarak 60 dakikada son görüntüleri elde edin.<ol>
<li>60 dakikalık bir inkübasyondan sonra karışımın 'time 60' görüntüsünü elde etmek için, dönen tüplerden her durumun 40 μL'lik bir örneğini daha alın ve her numuneyi yüklü bir kaydırağa pipetleyin. Resim adım 2.2.2'deki gibi. NOT: Doygunluk gerçekleşene kadar hücre toplama her 15 dakikada bir kontrol edilmelidir. Toplamanın zamanlaması test edilen proteinlere bağlı olacaktır.</li>
	</ol>
</li>
</ol>3. ImageJ/Fiji Analizi
<ol><li>Fiji/ImageJ kullanarak toplamanın kapsamını ölçmek için analiz dosyalarını kaydedin.<ol>
<li>Sağlanan Ek kodlama dosyalarını bilgisayardaki imageJ makrolar klasörüne kaydedin.</li>
		<li>Sağlanan toplama makrosunu yükleyin (Eklentiler, Makrolar, Yükle ve "AggregationAssay.txt" dosyasını seçin).</li>
	</ol>
</li>
	<li>Eşikleri belirleyin.<ol>
<li>ImageJ'e 'sıfır zaman' .tif dosyası yükleyin ve kanalları bölün (Resim | Renk | Kanalları Böl). NOT: 'Sıfır süresi' görüntüsü, tüm deneme için eşik ve en küçük nokta boyutunu belirlemek için kullanılır.</li>
		<li>Her kanalı maskele (Eklentiler | Makrolar | AggregationAssay_MakeMask). Görüntüden Maske Yap penceresi görünecektir. Görüntü eşiğini belirle ve Histogram'dan Küme Paramlarını Belirle 'nin yanındaki onay kutuları tamam'ı tıklatın.</li>
		<li>Slayt çubuğunu kullanarak görüntünün eşiğini belirleyin, sayıyı slayt çubuğunun sağ kısmına kaydedin ve Tamam 'ıtıklatın.</li>
		<li>Küme Boyutu histogramı görünecektir. Histogramdan denemeye uygun bir küme boyutu seçin, bu sayıyı En Küçük Küme Boyutu: kutusuna yazın ve Tamam 'ıtıklatın. Bu boyutun altındaki kümeler çözümlenmez.</li>
	</ol>
</li>
	<li>Analizi çalıştır.<ol>
<li>ImageJ'de koşul 1'in 'time 60' görüntüsünü açın ve kanalları adım 3.2.1'deki gibi bölün.</li>
		<li>Her kanalı maskeleyin (Eklentiler, Makrolar, AggregationAssay_MakeMask). 3.2.3 ve adım 3.2.4'te belirlenen eşik ve boyutu kullanın. Görüntü eşiğini belirleme ve Histogram'dan Küme Paramlarını Belirleme'nin yanındaki kutuların seçimini kaldırın ve boyutu ve eşikleri uygun alanlara el ile yazın ve Tamam'ı tıklatın.</li>
		<li>Toplama dizinini hesaplama (Eklentiler | Makrolar | AggregationAssay_CalculateOverlap). Karşılaştırılacak maskelenmiş kanalları ve elde edilen dosyaların kaydedileceği dizini seçin.</li>
		<li>Her koşulda her 'zaman 60' görüntüsü için 3.3.1–3.3.3 adımlarını yineleyin. NOT: Toplama dizini, iki kanal alanının toplamına bölünen toplam çakışma alanı eksi örtüşme alanının 100 ile çarpışması olarak tanımlanır (Toplama indeksi = çakışma alanı/[kanal 1 alanı + kanal 2 alanı – örtüşme alanı] x 100). Bu normalleştirme, her iki maskedeki toplam pikselleri temsil eden iki maskelenmiş kanal arasında bir 'OR' işlemidir.</li>
	</ol>
</li>
</ol>

<ol>
	<li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroligins+and+neurexins+link+synaptic+function+to+cognitive+disease.">Neuroligins and neurexins link synaptic function to cognitive disease.</a> Nature. 455 (7215), 903-911 (2008).</li><li>Lakey, J. H., Raggett, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+protein-protein+interactions.">Measuring protein-protein interactions.</a> Current Opinion in Structural Biology. 8 (1), 119-123 (1998).</li><li>Aoto, J., Martinelli, D. C., Malenka, R. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Presynaptic+neurexin-3+alternative+splicing+trans-synaptically+controls+postsynaptic+AMPA+receptor+trafficking.">Presynaptic neurexin-3 alternative splicing trans-synaptically controls postsynaptic AMPA receptor trafficking.</a> Cell. 154 (1), 75-88 (2013).</li><li>Aoto, J., F&#246;ldy, C., Ilcus, S. M. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+circuit-dependent+functions+of+presynaptic+neurexin-3+at+GABAergic+and+glutamatergic+synapses.">Distinct circuit-dependent functions of presynaptic neurexin-3 at GABAergic and glutamatergic synapses.</a> Nature Neuroscience. 18 (7), 997-1007 (2015).</li><li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+Neurexin+Complexes:+A+Molecular+Code+for+the+Logic+of+Neural+Circuits.">Synaptic Neurexin Complexes: A Molecular Code for the Logic of Neural Circuits.</a> Cell. 171 (4), 745-769 (2017).</li><li>Dai, J., Aoto, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+Splicing+of+Presynaptic+Neurexins+Differentially+Controls+Postsynaptic+NMDA+and+AMPA+Receptor+Responses.">Alternative Splicing of Presynaptic Neurexins Differentially Controls Postsynaptic NMDA and AMPA Receptor Responses.</a> Neuron. 102 (5), 993-1008 (2019).</li><li>Restrepo, S., Langer, N. J., Nelson, K. A., Aoto, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+a+Neurexin-3&#945;+Human+Mutation+in+Mouse+Neurons+Identifies+a+Novel+Role+in+the+Regulation+of+Transsynaptic+Signaling+and+Neurotransmitter+Release+at+Excitatory+Synapses.">Modeling a Neurexin-3&#945; Human Mutation in Mouse Neurons Identifies a Novel Role in the Regulation of Transsynaptic Signaling and Neurotransmitter Release at Excitatory Synapses.</a> The Journal of Neuroscience. 39 (46), 9065-9082 (2019).</li><li>Ko, J., Fuccillo, M. V., Malenka, R. C., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Functions+as+a+Neurexin+Ligand+in+Promoting+Excitatory+Synapse+Formation.">LRRTM2 Functions as a Neurexin Ligand in Promoting Excitatory Synapse Formation.</a> Neuron. 64 (6), 791-798 (2009).</li><li>de Wit, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Interacts+with+Neurexin1+and+Regulates+Excitatory+Synapse+Formation.">LRRTM2 Interacts with Neurexin1 and Regulates Excitatory Synapse Formation.</a> Neuron. 64 (6), 799-806 (2009).</li><li>Linhoff, M. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Unbiased+Expression+Screen+for+Synaptogenic+Proteins+Identifies+the+LRRTM+Protein+Family+as+Synaptic+Organizers.">An Unbiased Expression Screen for Synaptogenic Proteins Identifies the LRRTM Protein Family as Synaptic Organizers.</a> Neuron. 61 (5), 734-749 (2009).</li><li>Siddiqui, T. J., Pancaroglu, R., Kang, Y., Rooyakkers, A., Craig, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTMs+and+Neuroligins+Bind+Neurexins+with+a+Differential+Code+to+Cooperate+in+Glutamate+Synapse+Development.">LRRTMs and Neuroligins Bind Neurexins with a Differential Code to Cooperate in Glutamate Synapse Development.</a> Journal of Neuroscience. 30 (22), 7495-7506 (2010).</li><li>Gibson, D. G., Young, L., Chuang, R. -. Y., Venter, J. C., Hutchison, C. A., Smith, H. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nature Methods. 6 (5), 343-345 (2009).</li><li>Bacchetti, S., Graham, F. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfer+of+the+gene+for+thymidine+kinase+to+thymidine+kinase-deficient+human+cells+by+purified+herpes+simplex+viral+DNA.">Transfer of the gene for thymidine kinase to thymidine kinase-deficient human cells by purified herpes simplex viral DNA.</a> Proceedings of the National Academy of Sciences of the United States of America. 74 (4), 1590-1594 (1977).</li><li>Cerchiari, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+strategy+for+tissue+self-organization+that+is+robust+to+cellular+heterogeneity+and+plasticity.">A strategy for tissue self-organization that is robust to cellular heterogeneity and plasticity.</a> Proceedings of the National Academy of Sciences of the United States of America. 112 (7), 2287-2292 (2015).</li><li>Burdick, M. M., McCarty, O. J. T., Jadhav, S., Konstantopoulos, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+inflammation+and+cancer+metastasis.">Cell-cell interactions in inflammation and cancer metastasis.</a> IEEE Engineering in Medicine and Biology Magazine. 20 (3), 86-91 (2001).</li><li>Fox, D. A., Gizinski, A., Morgan, R., Lundy, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+rheumatoid+arthritis+synovium.">Cell-cell interactions in rheumatoid arthritis synovium.</a> Rheumatic Diseases Clinics of North America. 36 (2), 311-323 (2010).</li><li>Yamagata, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+insights+into+modulation+and+selectivity+of+transsynaptic+neurexin-LRRTM+interaction.">Structural insights into modulation and selectivity of transsynaptic neurexin-LRRTM interaction.</a> Nature Communications. 9 (1), 3964 (2018).</li><li>Nguyen, T., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binding+properties+of+neuroligin+1+and+neurexin+1beta+reveal+function+as+heterophilic+cell+adhesion+molecules.">Binding properties of neuroligin 1 and neurexin 1beta reveal function as heterophilic cell adhesion molecules.</a> The Journal of Biological Chemistry. 272 (41), 26032-26039 (1997).</li><li>Boucard, A. A., Ko, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Affinity+Neurexin+Binding+to+Cell+Adhesion+G-protein-coupled+Receptor+CIRL1/Latrophilin-1+Produces+an+Intercellular+Adhesion+Complex.">High Affinity Neurexin Binding to Cell Adhesion G-protein-coupled Receptor CIRL1/Latrophilin-1 Produces an Intercellular Adhesion Complex.</a> Journal of Biological Chemistry. 287 (12), 9399-9413 (2012).</li></ol>

Yazarların açıklayacak bir şeyi yok.

Hücre yapışması sırasında transta meydana gelen protein-protein etkileşimlerinin parçalanması, olgunlaşma ve yeniden şekillendirme sırasında sinapsların oluşumu, işlevi ve bakımı da dahil olmak üzere temel hücresel süreçlerin altında bulunan moleküler mekanizmaların daha iyi anlaşılmasına neden olabilir. Hücreden hücreye etkileşimlerin etkileri nörobiyolojinin ötesine genişler ve sinyal transdüksiyonunda, hücre göçünde ve doku gelişiminde daha geniş rollere sahiptir<sup class="xre...

Sinaptik yapışma molekülleri tarafından kolaylaştırılan sinaptik etkileşimler, sinapsların gelişimi, organizasyonu, spesifikasyonu, bakımı ve işlevi ve sinir ağlarının üretimi için temeldir. Bu transsynaptik hücre yapışma moleküllerinin tanımlanması hızla artmaktadır; bu nedenle, bağlayıcı ortakları tanımlamak ve bu yeni yapışma moleküllerinin birbirleriyle nasıl etkileşime girdiğini anlamak temel olarak önemlidir. Ek olarak, genom dizilimi, yaygın olarak çok sayıda nörogelişimsel, nöropsikiyatrik ve bağımlılık bozukluğu ile bağlantılı olan bu yapışma moleküllerinin çoğunda mutasyonlar tanımlamıştır1. Sinaptik hücre yapışma moleküllerini kodlayan genlerdeki mutasyonlar trans etkileşimlerini zararlı bir şekilde değiştirebilir ve sinaps oluşumunda ve bakımında patofizyolojik değişikliklere katkıda bulunabilir.
İzotermal kalorimetre, dairesel dikroizm, yüzey plazmon rezonansı2 gibi protein-protein etkileşimlerini nicel olarak değerlendirmek için birden fazla tahlil mevcuttur ve doğada nicel olmasına rağmen, birkaç sınırlamaları vardır. İlk olarak, bazen uzun ve sıkıcı saflaştırma adımları gerektiren rekombinant protein gerektirirler. İkincisi, sofistike özel ekipman ve teknik uzmanlık gerektirirler. Üçüncüsü, doğal olarak bir membran in vivo'ya bağlı proteinler arasında hem cis hem de trans etkileşimlerine izin verdikleri için bağlamanın kapsamını abartabilirler. Burada sadece trans etkileşimlerini test eden basit ve nispeten hızlı bir test öneriyoruz.
Saflaştırılmış protein testleriyle ilişkili komplikasyonların çoğunu atlatmak için, azaltılmış heterolog hücre sisteminde trans etkileşimlerini yeniden sağlayan hücre bazlı bir protein etkileşimi testini optimize ettik. Bu test daha önce hücrelerarası etkileşimleri incelemek için çeşitli şekillerde kullanılmıştır. Bu yaklaşımda aday hücre yapışma molekülleri HEK293T hücrelerine aktarılır. Fizyolojik koşullarda, HEK293T hücreleri kendi kendine toplama sergilemez, bu da onları bu test için örnek modeller haline getirir. Bununla birlikte, reseptör ve ligand ifade eden HEK hücrelerinin bireysel popülasyonları birleştirildiğinde, reseptörün bağlanması ve ligand HEK hücrelerinin toplanmasına zorlar. Bu toplama sadece trans etkileşimleri tarafından aracılık edilir ve genellikle onlarca dakika içinde gözlemlenebilir. Bu yöntemde protein saflaştırma adımlarına gerek yoktur ve yöntemin verimliliği, kognate yapışma moleküllerini ifade eden HEK hücrelerinin popülasyonlarının birleştirildiği ve sadece on dakika sonra görüntülandığı paradigmasına dayanır. Ek olarak, bu yöntem nispeten ucuzdur, çünkü ne antikorlar ne de pahalı ekipmanlar gereklidir. Verilerin eldei için gerekli olan tek ekipman standart bir floresan mikroskoptur. Bu hücre bazlı testin ek bir avantajı, hastalıkla ilgili nokta mutasyonlarının trans etkileşimleri üzerindeki etkisini hızlı bir şekilde tarama yeteneğidir. Bu, ilgi çekici proteinin mutant varyantlarının cDNA'ları ile HEK hücrelerinin transfecting ile gerçekleştirilerek gerçekleştirilebilir.
Bu protokolde, derin zihinsel engellilik ve epilepsi tanısı alan bir hastada tanımlanan Neurexin3α'daki (Neurexin3αA687T)bir yanlış beyin mutasyonu,lösin bakımından zengin tekrarlayan transmembran protein 2 (LRRTM2) ile trans etkileşimlerini değiştirip değiştirmediğini araştırdığımız bir örnek sunuyoruz. Neurexin3α, evrimsel olarak korunmuş presinaptik hücre yapışma molekülleri ailesinin bir üyesidir ve son çalışmalar sinaps3, 4,5,6,7'debirden fazla rol belirlemiş olsa da, bu molekül ve neüroksin ailesinin tüm üyelerine ilişkin sinaptik anlayışımız eksik kalır. LRRTM2, sinaps oluşumu ve bakımı 8,9,10'akatılan uyarıcı bir postynaptik hücre yapıştırma proteinidir. Daha da önemlisi, LRRTM2 sadece splice bölgesi 4 alternatif eksondan (SS4-) yoksun neurexin izoformları ile etkileşime girer, ancak splice bölgesi 4 alternatif ekson (SS4 +) içeren neurexin izoformları ile etkileşime girmez. Neurexin3α'da tanımlanan insan missense mutasyonu (A687T), evrimsel olarak korunan ve tüm alfa neurexins7arasında korunan, unstudied hücre dışı bir bölgede bulunur. Bu iki molekül arasındaki etkileşimkurulduğundan 8,9,11, şu soruyu ortaya attık: Neurexin3α SS4- to LRRTM2'nin bağlanma kabiliyeti bir A687T nokta mutasyonu ile mi değiştirildi? Bu tahlil, A687T nokta mutasyonunun beklenmedik bir şekilde Neurexin3α'nın toplanmasını LRRTM2'ye artırdığını ve nokta mutasyonunun bulunduğu hücre dışı bölgenin transsinaptik etkileşimlere aracılık etmede rol oynadığını ortaya koydu.

<table><tbody><tr><td>1.5 mL disposable microtubes with snap caps</td><td>VWR</td><td>89000-028</td><td>Incubation of mixed population of HEK cells</td></tr><tr><td>1000 mL Rapid&amp;mdash;Flow Filter Unit, 0.2 um aPES membrane</td><td>Thermo Fisher</td><td>567-0020</td><td>Sterilization of HEK media</td></tr><tr><td>15 mL SpectraTube centrifuge tubes</td><td>Ward&amp;rsquo;s Science</td><td>470224-998</td><td>Harvesting HEK cells</td></tr><tr><td>6 well sterile tissue culture plates</td><td>VWR</td><td>100062-892</td><td>culturing HEK cells</td></tr><tr><td>Calcium Chloride</td><td>Sigma</td><td>223506-500G</td><td>Calcium phosphate transfection, HEK cell resuspension</td></tr><tr><td>Centrifuge- Sorvall Legend RT</td><td>Kendro Laboratory Products</td><td>75004377</td><td>Harvesting HEK cells</td></tr><tr><td>CO2 cell incubator</td><td>Thermo Scientific</td><td>HERACELL 150i</td><td>Incubation of HEK cells during growth</td></tr><tr><td>DMEM, 1x (Dulbecco&#039;s Modification of Eagle&#039;s Medium) with 4.5 g/L glucose, L-glutamine &amp;amp; sodium pyruvate</td><td>Corning</td><td>10-013-CV</td><td>HEK cell maintenance</td></tr><tr><td>Dulbecco&amp;rsquo;s Phosphate Buffered Saline PBS (1X)</td><td>Gibco</td><td>14190-144</td><td>Passaging/harvesting HEK cell</td></tr><tr><td>Ethylenediaminetetraacetic acid</td><td>Sigma</td><td>ED-500G</td><td>Harvesting HEK cells</td></tr><tr><td>Falcon Vented culture flasks, 75cm&lt;sup&gt;2&lt;/sup&gt; growth area</td><td>Corning</td><td>9381M26</td><td>Culturing HEK cells</td></tr><tr><td>Fetal Bovine Serum</td><td>Sigma</td><td>17L184</td><td>HEK cell maintenance</td></tr><tr><td>HEK293T cells</td><td>ATCC</td><td></td><td>Model system</td></tr><tr><td>ImageJ</td><td>NIH</td><td>V: 2.0.0-rc-69/1.52p</td><td>Image analysis</td></tr><tr><td>Magnesium Chloride hexahydrate</td><td>Sigma</td><td>M9272-500G</td><td>HEK cell resuspension</td></tr><tr><td>Sodium phosphate dibasic anhydrous</td><td>Fisher BioReagents</td><td>BP332-500</td><td>Calcium phosphate transfection</td></tr><tr><td>Trypsin 0.25% (1X) Solution</td><td>GE Healthcare Life Sciences</td><td>SH30042.01</td><td>Passaging HEK cells</td></tr><tr><td>Tube rotator</td><td></td><td></td><td>Incubation of mixed population of HEK cells</td></tr><tr><td>UltraClear Microscope slides. White Frosted, Positive Charged</td><td>Denville Scientific Inc.</td><td>M1021</td><td>Image acquisition</td></tr><tr><td>Wide-field microscope</td><td>Zeiss</td><td>Axio Vert 200M</td><td>Image acquisition</td></tr></tbody></table>

measuring transcellular interactions through protein aggregation in a heterologous cell system

Hücresel arayüzlerdeki protein etkileşimleri, doku gelişimi ve kanserin ilerlemesinden sinaps oluşumu ve bakımına kadar çok sayıda biyolojik sonucu belirler. Bu temel etkileşimlerin çoğu transta gerçekleşir ve tipik olarak membran bağlantılı bağlama çiftlerini ifade eden hücreler arasındaki heterofilik veya homofilik etkileşimler tarafından indüklenir. Hastalıkla ilgili mutasyonların bu temel protein etkileşimlerini nasıl bozduğunun aydınlatıcı olması, sayısız hücre biyolojisi alanı hakkında fikir verebilir. Birçok protein-protein etkileşim tahlilleri tipik olarak cis ve trans etkileşimleri arasında ayrım yapmaz, bu da potansiyel olarak in vivo olarak meydana gelen ve protein ve / veya özel izleme ekipmanının emek yoğun saflaştırılmasını içeren bağlama kapsamının aşırı tahmin edilmesine yol açar. Burada, uzun protein saflaştırmalarına veya özel ekipmanlara ihtiyaç duymadan sadece trans etkileşimlerin gözlemlenmesine ve ölçülmesine izin veren optimize edilmiş basit bir protokol sunuyoruz. HEK hücre toplama tahlili, her biri membran bağlı konyak ligandlarını ifade eden iki bağımsız HEK hücresi popülasyonunun karıştırılmasıdır. Kısa bir kuluçka süresinden sonra, örnekler görüntülenir ve elde edilen agregalar ölçülür.

A687T mutasyonu Neurexin3α SS4'ü artırır- LRRTM2 7'ye bağlanma Bilinen iki sinaptik proteinin hücreler arası etkileşimlerinin, zihinsel engelli ve epilepsili bir hastada bulunan bir nokta mutasyonunun ortaya girmesinden nasıl etkilendiğini araştırmak için yukarıdaki HEK hücre toplama testini kullandık (Şekil 1). Hücreler bölüm 1'e göre trans enfekte olmuş ve protokolün 1. ve 2. bölümlerine göre görüntüleme için hazırlanmıştır. ...

Watch this Scientific Journal Video about Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System at JoVE.com

Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Burada, floresan mikroskopisi kullanarak heterolog bir hücre sisteminde transta ligand-reseptör etkileşimlerini hızlı ve yarı niteliksel olarak ölçmek için optimize edilmiş bir protokol sunuyoruz.

Heterolog Hücre Sisteminde Protein Toplama Yoluyla Hücrelerarası Etkileşimlerin Ölçülmesi

Protein interactions at cellular interfaces dictate a multitude of biological outcomes ranging from tissue development and cancer progression to synapse ...

measuring-transcellular-interactions-through-protein-aggregation

Universidad de Cartagena UDEC

Research

JoVE Journal

Neuroscience

3.4K Görüntüleme.  University of Colorado Denver School of Medicine. Burada, floresan mikroskopisi kullanarak heterolog bir hücre sisteminde transta ligand-reseptör etkileşimlerini hızlı ve yarı niteliksel olarak ölçmek için optimize edilmiş bir protokol sunuyoruz.

Video: Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Extracellular Protein Microarray Technology for High Throughput Detection of Low Affinity Receptor-Ligand Interactions

Secreted factors, membrane-tethered receptors, and their interacting partners are main regulators of cellular communication and initiation of signaling cascades during homeostasis and disease, and as such represent prime therapeutic targets. Despite their relevance, these interaction networks remain significantly underrepresented in current databases; therefore, most extracellular proteins have no documented binding partner. This discrepancy is primarily due to the challenges associated with the study of the extracellular proteins, including expression of functional proteins, and the weak, low affinity, protein interactions often established between cell surface receptors. The purpose of this method is to describe the printing of a library of extracellular proteins in a microarray format for screening of protein-protein interactions. To enable detection of weak interactions, a method based on multimerization of the query protein under study is described. Coupled to this microbead-based multimerization approach for increased multivalency, the protein microarray allows robust detection of transient protein-protein interactions in high throughput. This method offers a rapid and low sample consuming-approach for identification of new interactions applicable to any extracellular protein. Protein microarray printing and screening protocol are described. This technology will be useful for investigators seeking a robust method for discovery of protein interactions in the extracellular space.

Here, we present a protocol to screen extracellular protein microarrays for identification of novel receptor-ligand interactions in high throughput. We also describe a method to enhance detection of transient protein-protein interactions by using protein-microbead complexes.

Hücre dışı Protein Mikroarray teknoloji yüksek işlem hacmi düşük benzeşme reseptör-Ligand etkileşimleri algılanması için

Secreted factors, membrane-tethered receptors, and their interacting partners are main regulators of cellular communication and initiation of signaling ...

Biyokimya

A Fluorescence Fluctuation Spectroscopy Assay of Protein-Protein Interactions at Cell-Cell Contacts

A variety of biological processes involves cell-cell interactions, typically mediated by proteins that interact at the interface between neighboring cells. Of interest, only few assays are capable of specifically probing such interactions directly in living cells. Here, we present an assay to measure the binding of proteins expressed at the surfaces of neighboring cells, at cell-cell contacts. This assay consists of two steps: mixing of cells expressing the proteins of interest fused to different fluorescent proteins, followed by fluorescence fluctuation spectroscopy measurements at cell-cell contacts using a confocal laser scanning microscope. We demonstrate the feasibility of this assay in a biologically relevant context by measuring the interactions of the amyloid precursor-like protein 1 (APLP1) across cell-cell junctions. We provide detailed protocols on the data acquisition using fluorescence-based techniques (scanning fluorescence cross-correlation spectroscopy, cross-correlation number and brightness analysis) and the required instrument calibrations. Further, we discuss critical steps in the data analysis and how to identify and correct external, spurious signal variations, such as those due to photobleaching or cell movement.
In general, the presented assay is applicable to any homo- or heterotypic protein-protein interaction at cell-cell contacts, between cells of the same or different types and can be implemented on a commercial confocal laser scanning microscope. An important requirement is the stability of the system, which needs to be sufficient to probe diffusive dynamics of the proteins of interest over several minutes.

This protocol describes a fluorescence fluctuation spectroscopy-based approach to investigate interactions among proteins mediating cell-cell interactions, i.e. proteins localized in cell junctions, directly in living cells. We provide detailed guidelines on instrument calibration, data acquisition and analysis, including corrections to possible artefact sources.

Bir floresan dalgalanma spektroskopisi tahlil Protein-Protein etkileşimlerinin hücre-hücre kişiler

A variety of biological processes involves cell-cell interactions, typically mediated by proteins that interact at the interface between neighboring ...

Bead Aggregation Assays for the Characterization of Putative Cell Adhesion Molecules

Cell-cell adhesion is fundamental to multicellular life and is mediated by a diverse array of cell surface proteins. However, the adhesive interactions for many of these proteins are poorly understood. Here we present a simple, rapid method for characterizing the adhesive properties of putative homophilic cell adhesion molecules. Cultured HEK293 cells are transfected with DNA plasmid encoding a secreted, epitope-tagged ectodomain of a cell surface protein. Using functionalized beads specific for the epitope tag, the soluble, secreted fusion protein is captured from the culture medium. The coated beads can then be used directly in bead aggregation assays or in fluorescent bead sorting assays to test for homophilic adhesion. If desired, mutagenesis can then be used to elucidate the specific amino acids or domains required for adhesion. This assay requires only small amounts of expressed protein, does not require the production of stable cell lines, and can be accomplished in 4 days.

Here we present a simple, rapid method for characterizing the intrinsic adhesive properties of putative cell adhesion molecules. The secreted, epitope-tagged ectodomain of a cell adhesion molecule is captured from the culture medium on small, uniform functionalized beads. These beads can then be used immediately in simple bead aggregation assays.

Putatif Hücre yapışma molekülleri Karakterizasyonu için Boncuk Toplama Tahliller

Cell-cell adhesion is fundamental to multicellular life and is mediated by a diverse array of cell surface proteins. However, the adhesive interactions ...

Biyomühendislik

Monitoring Protein Aggregation Kinetics In Vivo using Automated Inclusion Counting in Caenorhabditis elegans

Protein aggregation into insoluble inclusions is a hallmark of a variety of human diseases, many of which are age-related. The nematode Caenorhabditis elegans is a well-established model organism that has been widely used in the field to study protein aggregation and toxicity. Its optical transparency enables the direct visualization of protein aggregation by fluorescence microscopy. Moreover, the fast reproductive cycle and short lifespan make the nematode a suitable model to screen for genes and molecules that modulate this process.
However, the quantification of aggregate load in living animals is poorly standardized, typically performed by manual inclusion counting under a fluorescence dissection microscope at a single time point. This approach can result in high variability between observers and limits the understanding of the aggregation process. In contrast, amyloid-like protein aggregation in vitro is routinely monitored by thioflavin T fluorescence in a highly quantitative and time-resolved fashion.
Here, an analogous method is presented for the unbiased analysis of aggregation kinetics in living C. elegans, using a high-throughput confocal microscope combined with custom-made image analysis and data fitting. The applicability of this method is demonstrated by monitoring inclusion formation of a fluorescently labeled polyglutamine (polyQ) protein in the body wall muscle cells. The image analysis workflow allows the determination of the numbers of inclusions at different timepoints, which are fitted to a mathematical model based on independent nucleation events in individual muscle cells. The method described here may prove useful to assess the effects of proteostasis factors and potential therapeutics for protein aggregation diseases in a living animal in a robust and quantitative manner.

Monitoring Protein Aggregation Kinetics In Vivo using Automated Inclusion Counting in Caenorhabditis elegans

Here, a method is presented for the analysis of protein aggregation kinetics in the nematode Caenorhabditis elegans. Animals from an age-synchronized population are imaged at different time points, followed by semiautomated inclusion counting in CellProfiler and fitting to a mathematical model in AmyloFit.

Caenorhabditis elegans'ta Otomatik Inklüzyon Sayımı Kullanarak Protein Agregasyon Kinetiğinin In Vivo'da İzlenmesi

Protein aggregation into insoluble inclusions is a hallmark of a variety of human diseases, many of which are age-related. The nematode Caenorhabditis ...

Pulldown Assay Coupled with Co-Expression in Bacteria Cells as a Time-Efficient Tool for Testing Challenging Protein-Protein Interactions

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble effectively in vitro. Such complexes may require co-translational assembly and the presence of molecular chaperones; either they form stable oligomers which cannot dissociate and re-associate in vitro or are unstable without a binding partner. To overcome these problems, it is possible to use a method based on the bacterial co-expression of differentially tagged proteins using a set of compatible vectors followed by the conventional pulldown techniques. The workflow is more time-efficient compared to traditional pulldown because it lacks the time-consuming steps of separate purification of interacting proteins and their following incubation. Another advantage is a higher reproducibility due to a significantly smaller number of steps and a shorter period of time in which proteins that exist within the in vitro environment are exposed to proteolysis and oxidation. The method was successfully applied for studying a number of protein-protein interactions when other in vitro techniques were found to be unsuitable. The method can be used for batch testing protein-protein interactions. Representative results are shown for studies of interactions between BTB domain and intrinsically disordered proteins, and of heterodimers of zinc-finger-associated domains.

Here, we describe a method for the bacterial co-expression of differentially tagged proteins using a set of compatible vectors, followed by the conventional pulldown techniques to study protein complexes that cannot assemble in vitro.

Pulldown Testi, Zorlu Protein-Protein Etkileşimlerini Test Etmek İçin Zaman Verimli Bir Araç Olarak Bakteri Hücrelerinde Ko-Ekspresyon ile Birleştiğinde

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble ...

4D Imaging of Protein Aggregation in Live Cells

One of the key tasks of any living cell is maintaining the proper folding of newly synthesized proteins in the face of ever-changing environmental conditions and an intracellular environment that is tightly packed, sticky, and hazardous to protein stability1. The ability to dynamically balance protein production, folding and degradation demands highly-specialized quality control machinery, whose absolute necessity is observed best when it malfunctions. Diseases such as ALS, Alzheimer's, Parkinson's, and certain forms of Cystic Fibrosis have a direct link to protein folding quality control components2, and therefore future therapeutic development requires a basic understanding of underlying processes. Our experimental challenge is to understand how cells integrate damage signals and mount responses that are tailored to diverse circumstances.
The primary reason why protein misfolding represents an existential threat to the cell is the propensity of incorrectly folded proteins to aggregate, thus causing a global perturbation of the crowded and delicate intracellular folding environment1. The folding health, or "proteostasis," of the cellular proteome is maintained, even under the duress of aging, stress and oxidative damage, by the coordinated action of different mechanistic units in an elaborate quality control system3,4. A specialized machinery of molecular chaperones can bind non-native polypeptides and promote their folding into the native state1, target them for degradation by the ubiquitin-proteasome system5, or direct them to protective aggregation inclusions6-9.
In eukaryotes, the cytosolic aggregation quality control load is partitioned between two compartments8-10: the juxtanuclear quality control compartment (JUNQ) and the insoluble protein deposit (IPOD) (Figure 1 - model). Proteins that are ubiquitinated by the protein folding quality control machinery are delivered to the JUNQ, where they are processed for degradation by the proteasome. Misfolded proteins that are not ubiquitinated are diverted to the IPOD, where they are actively aggregated in a protective compartment.
Up until this point, the methodological paradigm of live-cell fluorescence microscopy has largely been to label proteins and track their locations in the cell at specific time-points and usually in two dimensions. As new technologies have begun to grant experimenters unprecedented access to the submicron scale in living cells, the dynamic architecture of the cytosol has come into view as a challenging new frontier for experimental characterization. We present a method for rapidly monitoring the 3D spatial distributions of multiple fluorescently labeled proteins in the yeast cytosol over time. 3D timelapse (4D imaging) is not merely a technical challenge; rather, it also facilitates a dramatic shift in the conceptual framework used to analyze cellular structure.
We utilize a cytosolic folding sensor protein in live yeast to visualize distinct fates for misfolded proteins in cellular aggregation quality control, using rapid 4D fluorescent imaging. The temperature sensitive mutant of the Ubc9 protein10-12 (Ubc9ts) is extremely effective both as a sensor of cellular proteostasis, and a physiological model for tracking aggregation quality control. As with most ts proteins, Ubc9ts is fully folded and functional at permissive temperatures due to active cellular chaperones. Above 30 &deg;C, or when the cell faces misfolding stress, Ubc9ts misfolds and follows the fate of a native globular protein that has been misfolded due to mutation, heat denaturation, or oxidative damage. By fusing it to GFP or other fluorophores, it can be tracked in 3D as it forms Stress Foci, or is directed to JUNQ or IPOD.

Cellular viability depends on timely and efficient management of protein misfolding. Here we describe a method for visualizing the different potential fates of a misfolded protein: refolding, degradation, or sequestration in inclusions. We demonstrate the use of a folding sensor, Ubc9ts, for monitoring proteostasis and aggregation quality control in live cells using 4D microscopy.

Canlı Hücrelerde Protein Aggregation 4D Görüntüleme

One of the key tasks of any living cell is maintaining the proper folding of newly synthesized proteins in the face of ever-changing environmental ...

Biyoloji

Genetic and Biochemical Approaches for In Vivo and In Vitro Assessment of Protein Oligomerization: The Ryanodine Receptor Case Study

Oligomerization is often a structural requirement for proteins to accomplish their specific cellular function. For instance, tetramerization of the ryanodine receptor (RyR) is necessary for the formation of a functional Ca2+ release channel pore. Here, we describe detailed protocols for the assessment of protein self-association, including yeast two-hybrid (Y2H), co-immunoprecipitation (co-IP) and chemical cross-linking assays. In the Y2H system, protein self-interaction is detected by &#946;-galactosidase assay in yeast co-expressing GAL4 bait and target fusions of the test protein. Protein self-interaction is further assessed by co-IP using HA- and cMyc-tagged fusions of the test protein co-expressed in mammalian HEK293 cells. The precise stoichiometry of the protein homo-oligomer is examined by cross-linking and SDS-PAGE analysis following expression in HEK293 cells. Using these different but complementary techniques, we have consistently observed the self-association of the RyR N-terminal domain and demonstrated its intrinsic ability to form tetramers. These methods can be applied to protein-protein interaction and homo-oligomerization studies of other mammalian integral membrane proteins.

Genetic and Biochemical Approaches for In Vivo and In Vitro Assessment of Protein Oligomerization: The Ryanodine Receptor Case Study

Oligomerization of the ryanodine receptor, a homo-tetrameric ion channel mediating Ca2+ release from intracellular stores, is critical for skeletal and cardiac muscle contraction. Here, we present complementary in vivo and in vitro methods to detect protein self-association and determine homo-oligomer stoichiometry.

Genetik ve biyokimyasal Yaklaşımlar<em&gt; İn Vivo</em&gt; ve<em&gt; İn Vitro</em&gt; Protein oligomerization Değerlendirilmesi: Riyanodin Reseptör Vaka Çalışması

Oligomerization is often a structural requirement for proteins to accomplish their specific cellular function. For instance, tetramerization of the ...

In Situ Monitoring of Transiently Formed Molecular Chaperone Assemblies in Bacteria, Yeast, and Human Cells

J-domain proteins (JDPs) form the largest and the most diverse co-chaperone family in eukaryotic cells. Recent findings show that specific members of the JDP family could form transient heterocomplexes in eukaryotes to fine-tune substrate selection for the 70 kDa heat shock protein (Hsp70) chaperone-based protein disaggregases. The JDP complexes target acute/chronic stress induced aggregated proteins and presumably help assemble the disaggregases by recruiting multiple Hsp70s to the surface of protein aggregates. The extent of the protein quality control (PQC) network formed by these physically interacting JDPs remains largely uncharacterized in vivo. Here, we describe a microscopy-based in situ protein interaction assay named the proximity ligation assay (PLA), which is able to robustly capture&#160;these transiently formed chaperone complexes in distinct cellular compartments of eukaryotic cells. Our work expands the employment of PLA from human cells to yeast (Saccharomyces cerevisiae) and bacteria (Escherichia coli), thus rendering an important tool to monitor the dynamics of transiently formed protein assemblies in both prokaryotic and eukaryotic cells.

Cognate J-domain proteins cooperate with the Hsp70 chaperone to assist in a myriad of biological processes ranging from protein folding to degradation. Here, we describe an in situ proximity ligation assay, which allows the monitoring of these transiently formed chaperone machineries in bacterial, yeast and human cells.

Bakteri, Maya ve İnsan Hücrelerinde Geçici Olarak Oluşan Moleküler Şaperon Meclislerinin Yerinde İzlenmesinde

J-domain proteins (JDPs) form the largest and the most diverse co-chaperone family in eukaryotic cells. Recent findings show that specific members of the ...

Protein Etkileşimlerinin Canlı Hücre Tek Moleküllü Görüntüleme Tabanlı Miktar Tayini

Single-Molecule Measurement of Protein Interaction Dynamics Within Biomolecular Condensates

Biomolecular condensates formed via liquid-liquid phase separation (LLPS) have been considered critical in cellular organization and an increasing number of cellular functions. Characterizing LLPS in live cells is also important because aberrant condensation has been linked to numerous diseases, including cancers and neurodegenerative disorders. LLPS is often driven by selective, transient, and multivalent interactions between intrinsically disordered proteins. Of great interest are the interaction dynamics of proteins participating in LLPS, which are well-summarized by measurements of their binding residence time (RT), that is, the amount of time they spend bound within condensates. Here, we present a method based on live-cell single-molecule imaging that allows us to measure the mean RT of a specific protein within condensates. We simultaneously visualize individual protein molecules and the condensates with which they associate, use single-particle tracking (SPT) to plot single-molecule trajectories, and then fit the trajectories to a model of protein-droplet binding to extract the mean RT of the protein. Finally, we show representative results where this single-molecule imaging method was applied to compare the mean RTs of a protein at its LLPS condensates when fused and unfused to an oligomerizing domain. This protocol is broadly applicable to measuring the interaction dynamics of any protein that participates in LLPS.

Yazar Spotlight: Canlı İnsan Hücrelerinde Protein-Kondensat Dinamiklerinin Değerlendirilmesi

Many intrinsically disordered proteins have been shown to participate in the formation of highly dynamic biomolecular condensates, a behavior important for numerous cellular processes. Here, we present a single-molecule imaging-based method for quantifying the dynamics by which proteins interact with each other in biomolecular condensates in live cells.

Biyomoleküler Kondensatlarda Protein Etkileşim Dinamiğinin Tek Moleküllü Ölçümü

Biomolecular condensates formed via liquid-liquid phase separation (LLPS) have been considered critical in cellular organization and an increasing number ...

Heterolog Hücre Sisteminde Protein Toplama Yoluyla Hücrelerarası Etkileşimlerin Ölçülmesi

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler

Hücre dışı Protein Mikroarray teknoloji yüksek işlem hacmi düşük benzeşme reseptör-Ligand etkileşimleri algılanması için

Bir floresan dalgalanma spektroskopisi tahlil Protein-Protein etkileşimlerinin hücre-hücre kişiler

Putatif Hücre yapışma molekülleri Karakterizasyonu için Boncuk Toplama Tahliller

Caenorhabditis elegans'ta Otomatik Inklüzyon Sayımı Kullanarak Protein Agregasyon Kinetiğinin In Vivo'da İzlenmesi

Pulldown Testi, Zorlu Protein-Protein Etkileşimlerini Test Etmek İçin Zaman Verimli Bir Araç Olarak Bakteri Hücrelerinde Ko-Ekspresyon ile Birleştiğinde

Canlı Hücrelerde Protein Aggregation 4D Görüntüleme

Genetik ve biyokimyasal Yaklaşımlar

Bakteri, Maya ve İnsan Hücrelerinde Geçici Olarak Oluşan Moleküler Şaperon Meclislerinin Yerinde İzlenmesinde

Biyomoleküler Kondensatlarda Protein Etkileşim Dinamiğinin Tek Moleküllü Ölçümü

Biyomoleküler Kondensatlarda Protein Etkileşim Dinamiğinin Tek Moleküllü Ölçümü