Name: a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)
Uploaded: 2018-04-11T14:00:00.000+00:00
Duration: 7 min 58 s
Description: Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

Alessandro Cellerino, Tyrone Genade, Anne Brunet, Sabrina Sharp, Mickie Powell, Simone Keil, Yumi Kim, Patrick Smith, Kai Mathar ve Valenzano laboratuvar tüm üyeleri Max Planck Enstitüsü, biyoloji yaşlanma için farklı yönleri için katkıda bulunduğunuz için teşekkür ediyoruz Geçerli killifish yetiştiriciliği protokolü ile yıl içinde.

<ol>
	<li>Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-canonical+aging+model+systems+and+why+we+need+them.">Non-canonical aging model systems and why we need them.</a> EMBO J. 36 (8), 959-963 (2017).</li><li>Harel, I., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish:+A+Model+for+Exploring+Vertebrate+Aging+and+Diseases+in+the+Fast+Lane.">The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane.</a> Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).</li><li>Smith, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+life+span+by+the+gut+microbiota+in+the+short-lived+African+turquoise+killifish.">Regulation of life span by the gut microbiota in the short-lived African turquoise killifish.</a> Elife. 6, (2017).</li><li>Cellerino, A., Valenzano, D. R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+the+bush+to+the+bench:+the+annual+Nothobranchius+fishes+as+a+new+model+system+in+biology.">From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology.</a> Biol Rev Camb Philos Soc. 91 (2), 511-533 (2016).</li><li>Kim, Y., Nam, H. G., Valenzano, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+short-lived+African+turquoise+killifish:+an+emerging+experimental+model+for+ageing.">The short-lived African turquoise killifish: an emerging experimental model for ageing.</a> Dis Model Mech. 9 (2), 115-129 (2016).</li><li>Blazek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repeated+intraspecific+divergence+in+life+span+and+aging+of+African+annual+fishes+along+an+aridity+gradient.">Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient.</a> Evolution. 71 (2), 386-402 (2017).</li><li>Terzibasi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large+differences+in+aging+phenotype+between+strains+of+the+short-lived+annual+fish+Nothobranchius+furzeri.">Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri.</a> PLoS One. 3 (12), e3866 (2008).</li><li>Kirschner, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+quantitative+trait+loci+controlling+lifespan+in+the+short-lived+fish+Nothobranchius+furzeri--a+new+vertebrate+model+for+age+research.">Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research.</a> Aging Cell. 11 (2), 252-261 (2012).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+loci+associated+with+tail+color+and+sex+determination+in+the+short-lived+fish+Nothobranchius+furzeri.">Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri.</a> Genetics. 183 (4), 1385-1395 (2009).</li><li>Reichwald, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+Sex+Chromosome+Evolution+and+Aging+from+the+Genome+of+a+Short-Lived+Fish.">Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish.</a> Cell. 163 (6), 1527-1538 (2015).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish+Genome+Provides+Insights+into+Evolution+and+Genetic+Architecture+of+Lifespan.">The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan.</a> Cell. 163 (6), 1539-1554 (2015).</li><li>Harel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+platform+for+rapid+exploration+of+aging+and+diseases+in+a+naturally+short-lived+vertebrate.">A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate.</a> Cell. 160 (5), 1013-1026 (2015).</li><li>Valenzano, D. R., Sharp, S., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon-Mediated+Transgenesis+in+the+Short-Lived+African+Killifish+Nothobranchius+furzeri,+a+Vertebrate+Model+for+Aging.">Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging.</a> G3. 1 (7), 531-538 (2011).</li><li>Harel, I., Valenzano, D. R., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genome+engineering+approaches+for+the+short-lived+African+turquoise+killifish.">Efficient genome engineering approaches for the short-lived African turquoise killifish.</a> Nat Protoc. 11 (10), 2010-2028 (2016).</li><li>Polacik, M., Blazek, R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laboratory+breeding+of+the+short-lived+annual+killifish+Nothobranchius+furzeri.">Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri.</a> Nat Protoc. 11 (8), 1396-1413 (2016).</li><li>Avdesh, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regular+care+and+maintenance+of+a+zebrafish+(Danio+rerio)+laboratory:+an+introduction.">Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction.</a> J Vis Exp. (69), e4196 (2012).</li></ol>

Tüm yazarlar hiçbir rakip mali ve mali olmayan ilgi bildirin.

Biz laboratuvar embriyo koleksiyonu, kuluçka gibi yetişkin balık konut, dahil olmak üzere turkuaz killifish kültür için bir protokol tarif doğurmak ve besleme. Bizim iletişim kuralı özellikle yetişkin balık, özellikle deneysel araştırmalar yaşlanma ve yaşam süresi üzerinde duruldu araştırma laboratuvarları hedeflenmektedir. Turkuaz killifish bir çift Zebra balığı tesisi yükseltilebilir; Ancak, standart Zebra balığı bakımı16' dan killifish yetiştiriciliği önemli yönleri farklı. Bu ayarlamalar erken bir tuzlu su-karides sadece diyet bir diyet protein açısından zengin kan solucan gibi kuru ve sıvı kuluçka aşaması oluşan embriyo kuluçka belirli adımları ile takıma geçiş içerir.
İletişim kuralına kritik adımlar 8-30 ° C sıcaklık aralığında sevkiyat embriyo içerir. Yetiştirme durumunda, sıklık ve gıda kalitesi besleme verimlilik bağlıdır; Bu nedenle, embriyo verim (bakınız Bölüm 5.6) artırmak için tank doğurmak başına günde en az iki besleme önerilir. Embriyo beyazlatma sırasında embriyo kuluçka beyazlatma çözüm genişletmeniz değil. Bu yumurta koryon ve artan embriyo ölümleri hasara neden olabilir. Metilen mavisi ile embriyo kuluçka zaman kuluçka hazır kapak embriyo canlılığı önemli ölçüde azaltılmış olacak gibi 2 hafta daha uzun süre uzatmak değil. Turkuaz killifish kuluçkalık için Hümik asit solüsyonu düşük sıcaklık tarama artırır ve embriyoların çözüm Komple daldırma eşitlenmiş tarama sağlar. Fry gaz mesane doldurmak mümkün değil yüksek oranda kuluçka sonuçlarında sırasında yetersiz havalandırma ("göbek-kaymak" fenotip, bkz: Notlar bölümünde 5.1).
Sınırlama-in doğurmak için protokol hangi pozlar sorunlar için filtrasyon sistemleri Merkezi ve alternatif yöntemlerle gelecekte değiştirilmesi gerektiğini kum substrate kullanımını içerir. Olası alternatifler tankları damızlık Zebra balığı kullanımı olabilir. Embriyo ağartma büyük fiziksel-kimyasal değişiklikler değiştirilmiş koryon fizyolojisi ve başarı kuluçkalık neden olabilir yumurta koryon neden olabilir. Embriyo sürekli maruz kalma Metilen mavisi yetişkin balık fizyolojisi uzun vadeli değişiklikler neden olabilir. Hayatta kalma kohort çalışmaları için bireysel tankları yetişkin balık yetiştirme balık davranış ve sağlık olumsuz yönde etkileyebilir. Ancak, grup konut hayatta kalma kohort çalışmaları için sıkı sosyal hiyerarşileri için önde gelen sosyal hakimiyet ve erkek bölgede kurulması nedeniyle önemli karıştırıcı faktörlerin ekler. Bu nedenle, yalıtım sağkalım Etütleri erkek balık makul bir uzlaşma olduğuna karar. Beslenme laboratuvar killifish kolonileri un kontrollü kaynaklardan gelen canlı gıda ile dış contaminations için bir risk parazitler ve potansiyel patojenik mikrobiyal topluluklar ekleyin. Gelecekte, bir geçici steril balık besleme geliştirilmelidir.
Bu iletişim kuralı için gelecekteki iyileştirmeler hala 3-4 hafta içinde cinsel olgunlaşma tamamlamak için yol bir kontrollü, Sigara-live diyet ele alınacak. Özet olarak, bizim iletişim kuralı turkuaz killifish laboratuvar için geniş bilimsel bir topluluk kültür erişilebilirlik sunmaktadır.

Hızlı yaşam döngüsü ve kısa yaşam süresi göz önüne alındığında, turkuaz killifish Biyoloji1,2,3' te bir umut verici yeni model organizma olarak hızla büyüyor. Bu tür benzersiz bir yaşam döngüsü embriyonik diapause, hızlı cinsel olgunlaşma ve bir genişletilmiş post-reproductive hayat sahne4,5oluşan bir teleost için karakterizedir. Son iş bu tür Biyoloji hem tutsak hem de vahşi6,7elucidating için katkıda bulunmuştur. Turkuaz killifish live mevsimlik taze su organları oluşturan Zimbabve ve Mozambik Afrika savana yağışlı sezon sırasında. Kuru sezonunda embriyo su diapause denilen bir stres dayanıklı hayat sahne sayesinde yokluğunda kuru çamur içinde hayatta kalmak.
Genetik haritalar bu tür için oluşturulan8,9edilmiş ve son zamanlarda onların genom sıralı ve monte10,11oldu. Birkaç doğuştan laboratuvar balık suşları geliştirdik ve transgenesis ve CRISPR/Cas9 yolu ile düzenleme genom elde edilebilir içinde bu tür, turkuaz killifish rekabetçi laboratuvar omurgalı model organizma teşvik fiili haline gelmiştir 12,13,14.
Her ne kadar bu tür15için yayımlanmış bir laboratuvar protokol, mevcut protokolünde biz özellikle yaşlanma ve hayatta kalma araştırmak Etüdleri amaçlayan deneysel laboratuvar kuralları kapsamlı bir listesi geliştirmek. Mevcut Protokolü araştırmacılar Zebra balığı ve medaka yetiştiriciliği ile zaten tanıdık turkuaz killifish çiftçiliği anahtar ayarlamalar en az sayıda benimseyerek usta olmak için sağlar. Aynı zamanda, araştırmacılar balık yetiştiriciliği gerekli araçları ile deneyiminiz olmadan gelişen bir turkuaz killifish koloni yükseltmek için bu iletişim kuralı sağlar.

<table><tbody><tr><td>Probe calibration buffer solution pH=7.0</td><td>Roth</td><td>A518.1</td><td>1L buffer solution pH=7.0 to calibrate water system pH-electrode</td></tr><tr><td>Probe calibration buffer solution pH=4.0</td><td>Roth</td><td>P712.1</td><td>1L buffer solution pH=4.0 to calibrate water system pH-electrode</td></tr><tr><td>Conductivity standard</td><td>VWR</td><td>83607.260</td><td>500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode</td></tr><tr><td>Easy Strips Test 6in1</td><td>JBL</td><td>2533900</td><td>Test strips for determination chlorine values of system water</td></tr><tr><td>Ammonia Test</td><td>JBL</td><td>2536500</td><td>Test to determine ammonia content of system water</td></tr><tr><td>Red Sea Salt</td><td>Red Sea</td><td></td><td>22 kg bucket</td></tr><tr><td>Sodium hydrogen carbonate</td><td>VWR</td><td>27780.360</td><td></td></tr><tr><td>Humic acid</td><td>Sigma- Aldrich</td><td>53680-50G</td><td></td></tr><tr><td>New HUFA Artemia enrichment</td><td>ZM Systems UK</td><td></td><td>75g bottle</td></tr><tr><td>Methylene blue</td><td>Roth</td><td>AE64.1</td><td></td></tr><tr><td>Hydrogen peroxide solution</td><td>Sigma- Aldrich</td><td>31642-1L</td><td>30% (w/w)</td></tr><tr><td>Coconut fiber</td><td>Dragon</td><td>ZCS010</td><td></td></tr><tr><td>Whatman paper</td><td>GE healthcare</td><td>3030-690</td><td></td></tr><tr><td>Ethanol pure</td><td>VWR</td><td>20821.467</td><td>100%</td></tr><tr><td>Silica sand</td><td>local pet shop</td><td></td><td></td></tr><tr><td>Artemia Eggs Premium Grade</td><td>Sanders</td><td></td><td></td></tr><tr><td>Bloodworm</td><td>local distributor</td><td></td><td>Poseidon Aquakultur Germany</td></tr><tr><td>dNTPs solution mix</td><td>Biolabs</td><td>N04472</td><td>10mM</td></tr><tr><td>Taq DNA polymerase</td><td>Invitrogen</td><td>18038-042</td><td>5U/uL</td></tr><tr><td>PCR 10x Buffer</td><td>Invitrogen</td><td>18038-042</td><td></td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Invitrogen</td><td>18038-042</td><td>50mM</td></tr><tr><td>NaOH</td><td>Sigma- Aldrich</td><td>S8045-500g</td><td>50mM</td></tr><tr><td>Tris-HCl, pH=8.0 solution</td><td>Sigma- Aldrich</td><td>T2694-1L</td><td>1M</td></tr><tr><td>HCl 37%</td><td>Sigma- Aldrich</td><td>H1758-500mL</td><td></td></tr><tr><td>Fish tanks</td><td>Aquaneering</td><td></td><td>volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids</td></tr><tr><td>Orbital shaker</td><td>VWR</td><td>89032-100</td><td>model 5000</td></tr><tr><td>Microbiological incubator</td><td>Thermo Scientific, Heratherm</td><td>50125882</td><td>model IMC18; for storage embryos in the liquid phase, set to t=27-28&amp;deg;C</td></tr><tr><td>Cooling Incubator</td><td>Binder</td><td>9020-0209</td><td>model KT115; for storage embryos in the solid phase, set to t=27-28&amp;deg;C</td></tr><tr><td>Hatching incubator</td><td>Thermo Scientific, Heratherm</td><td>51028114</td><td>model OGS180; for embryos hatching, set to t=27-28&amp;deg;C</td></tr><tr><td>Stereomicroscope</td><td>Leica</td><td></td><td>model M80</td></tr><tr><td>Breeding sand/hatching boxes</td><td>Roth</td><td>1598.1</td><td>1000mL</td></tr><tr><td>Petri dish</td><td>Sarstedt</td><td>82.1473</td><td>92x16mm</td></tr><tr><td>50 mL Conical tube</td><td>Sarstedt</td><td>62.547.254</td><td></td></tr><tr><td>15 mL Conical tube</td><td>Sarstedt</td><td>62.554.002</td><td></td></tr><tr><td>Disposable Plastic Pasteur pipette</td><td>Roth</td><td>EA71.1</td><td>2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter</td></tr><tr><td>Serological pipette</td><td>Sarstedt</td><td>86.1689.001</td><td>50mL</td></tr><tr><td>Syringe</td><td>Henke Sass Wolf</td><td>4100-000V0</td><td>10mL</td></tr><tr><td>Metal strainer</td><td></td><td></td><td>fineness &amp;lt;1mm; for embryos collection</td></tr><tr><td>Tweezers</td><td>Dumont</td><td>0508-5/45-PO</td><td>type5/45; for embryos transfer</td></tr><tr><td>25 L Brine shrimp hatcher</td><td>Aquaneering</td><td>ZHBS25</td><td>main hatcher</td></tr><tr><td>500 mL Brine shrimp hatcher</td><td>JBL</td><td>6106100</td><td>model Artemio 1; backup hatcher</td></tr><tr><td>Narrow-mesh fish nets</td><td>JBL</td><td></td><td></td></tr><tr><td>Sand beaker</td><td>VWR</td><td>BURK7102-5000</td><td>5000mL</td></tr><tr><td>Brine shrimp separation beaker</td><td>VWR</td><td>BURK7102-2000</td><td>2000mL</td></tr><tr><td>Plastic zipper bag</td><td>Roth</td><td>P279.2</td><td>for dead fish storage</td></tr><tr><td>Pipetboy</td><td>Integra</td><td>155000</td><td>model Pipetboy acu2</td></tr><tr><td>Parafilm</td><td>P-Lab</td><td>P701605</td><td></td></tr><tr><td>Air tubing</td><td>www.zajac.de</td><td>AQ380</td><td>4-6 mm diameter</td></tr><tr><td>1 L Glass bottle</td><td>VWR</td><td>215-1595</td><td></td></tr><tr><td>2 L Glass bottle</td><td>VWR</td><td>215-1596</td><td></td></tr><tr><td>500 mL Squeeze bottle</td><td>Roth</td><td>K665.1</td><td>for fish feeding with brine shrimp</td></tr><tr><td>120-&amp;#956;m brine shrimp strainer</td><td>Florida Aqua Farms</td><td>BB-PC2</td><td>for brine shrimp/bloodworm collection</td></tr><tr><td>Finish filter socks</td><td>Aquaneering</td><td>MFVB025C</td><td>25-&amp;#956;m</td></tr><tr><td>Central filtration fish housing system</td><td></td><td></td><td>Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz</td></tr></tbody></table>

a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)

Deneysel amaçlar için kullanılan modeli laboratuvar balık yetiştiriciliği uygulamaları geliştirme modeli sistemleri, Zebra balığı ve medaka gibi başvuru balık kurulması büyük ölçüde yararlanmıştır. Son yıllarda ortaya çıkan bir balık-turkuaz killifish (Nothobranchius furzeri) – alanları araştırma grupları Biyoloji yaşlanma ve ekoloji, giderek artan sayıda tarafından kabul edilmiştir. Esir bir yaşam süresi 4-8 ay ile bu tür shortest-lived omurgalılar esaret kaldırdı ve yaşlanma oranı ve yaşam beklentisi değişikliklere yol açabilir testinde – kısa bir süre – deneysel müdahaleler bilimsel topluluk sağlar. Embriyonik diapause tarafından karakterize bu tür benzersiz Biyoloji verilen patlayıcı cinsel olgunlaşma, işaretlenmiş morfolojik ve davranış cinsel dimorfizm - ve onların nispeten kısa yetişkin yaşam süresi - özel yetiştirme uygulamaları içinde acil vardır isteğe bağlı. Bu iletişim kuralı en iyi turkuaz killifish laboratuvar Bakımı, etkinleştirme bu tür güçlü laboratuvar hayvan modeli olarak benimsemeye bilimsel topluluk izin anahtar yetiştirme önlemleri kümesini raporlar.

Medyan sağkalım GRZ zorlanma (örneğin şekil 4A) haftada 12-18 arasında değişen turkuaz killifish uygun hayvancılık sonuç. Medyan sağkalım varyasyonları frekans beslenme ve sıcaklık koşullarında konut rejime bağlıdır. Zavallı yetiştiriciliği hayatta kalma eğriler sunmak sonuçlarında erken mortalite ve birkaç dönüm noktaları (şekil 4B) tarafından karakterize yaşam boyunca zaman, tekrarlayan, ani damla arttı.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57073/57073fig1.jpg"> Şekil 1: temsilcisi embriyonik gelişim dönemleri ile ilgili kuluçka substrat. (A) taze embriyolar, metilen mavisi çözüm kuluçka 28 ° C'de inkübe toplanan (B) embriyo katı ortamına aktarılması hazır ya kağıt veya Hindistan cevizi lif filtre. (C) embriyo yumurtadan için tipik altın süsen görüntüleme hazır. Ölçek çubuğu 1 mm. için eşit olan <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57073/57073fig2.jpg"> Şekil 2: turkuaz killifish sonrası gelişim çıkım dönemlerinde. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57073/57073fig3.jpg"> Şekil 3: temsilcisi balık ID etiket 3üncü itibaren balık için. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig3large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57073/57073fig4.jpg"> Şekil 4: 70 erkek turkuaz killifish için temsilcisi sağkalım eğrisi. (A) turkuaz killifish laboratuvar kaldırdı için tipik bir hayatta kalma eğrisi. Hayatta kalma eğrileri karşılaştırılması (B) elde edilen balık en uygun yetiştirme koşullarında (siyah) kaldırdı ve zavallı yetiştiriciliği (kırmızı ve mavi). Kesikli kırmızı yatay çizgi % 50 hayatta kalma, ortalama yaşam süresi (x ekseni üzerinde belirtilir), kesişen yaşam eğrisi gösterir. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig4large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>KİMLİĞİ</td>
			<td colspan="2">İleri astar</td>
			<td colspan="2">Ters astar</td>
			<td>Boyut aralığı (bp)</td>
		</tr>
<tr>
<td>* NfuSU0007</td>
			<td colspan="2">GGCTAAGCCTTGCTGACAGA</td>
			<td colspan="2">CAGGGAGCTGAAAACCTCAG</td>
			<td>166 - 214</td>
		</tr>
<tr>
<td>* NfuSU0010</td>
			<td colspan="2">CGCAGTCTGATCAAATCGTGT</td>
			<td colspan="2">TGTTTGAAGGTTCACATTCATTATC</td>
			<td>220 - 272</td>
		</tr>
<tr>
<td>NfuSU0016</td>
			<td colspan="2">CATGGCTAAACCGTGATGAA</td>
			<td colspan="2">GAAGGACGCCAGCTATGAAG</td>
			<td>209 - 240</td>
		</tr>
<tr>
<td>NfuSU0022</td>
			<td colspan="2">AACACAGCTCTCGTAAGGAGGTA</td>
			<td colspan="2">TTCAGACTTGTCTTACTACCATGTTT</td>
			<td>198 - 238</td>
		</tr>
<tr>
<td>NfuSU0027</td>
			<td colspan="2">TCCAGCTGAATCGGTAATGA</td>
			<td colspan="2">AAACTCGAGGGTGCAATCTG</td>
			<td>164 - 226</td>
		</tr>
<tr>
<td>NfuSU0049</td>
			<td colspan="2">CTGGACAAAGTGCCAATCAC</td>
			<td colspan="2">CTCCCACAGTCCCAAAACAT</td>
			<td>196 - 197</td>
		</tr>
<tr>
<td>NfuSU0050</td>
			<td colspan="2">CCAGAATGAACAATACTCAGATCAA</td>
			<td colspan="2">GCAGCTTAGTTTAATGATATCACAATG</td>
			<td>252 - 295</td>
		</tr>
<tr>
<td>NfuSU0060</td>
			<td colspan="2">CTAGCCACTCCCCTGGTTTA</td>
			<td colspan="2">CCGTCACGATGTGCTGATAC</td>
			<td>216 - 248</td>
		</tr>
<tr>
<td>NfuFLI0030</td>
			<td colspan="2">CAGAAGCTAAAGGCCAGACG</td>
			<td colspan="2">GGGAAACAATAGGGAACCAC</td>
			<td>174 - 205</td>
		</tr>
<tr>
<td>* NfuFLI0091</td>
			<td colspan="2">ACGCTGACTCTACCCAGTC</td>
			<td colspan="2">CTGCCTGCTACTGACAATG</td>
			<td>355 - 373</td>
		</tr>
<tr>
<td colspan="6">* - belirlenmesi işaretleri seks</td>
		</tr>
</tbody></table>Tablo 1: Genotipleme astar zorlanma tanımlama için.

Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

Laboratuvar muhafazasını turkuaz ev ve verimli bir şekilde standart Zebra balığı özellikleri için kullanılan aynı altyapı istihdam Merkezi su filtrasyon sistemi, bireysel balık binlerce yükseltmek killifish ölçeklendirilecektir. Burada verimli killifish bakım izin standart yordamların listesini ayrıntılı.

Laboratuvar konut, turkuaz Killifish (Nothobranchius furzeri) için bir iletişim kuralı

The development of husbandry practices in non-model laboratory fish used for experimental purposes has greatly benefited from the establishment of ...

a-protocol-for-laboratory-housing-turquoise-killifish-nothobranchius

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri)

16.8K Görüntüleme.  Max Planck Institute for the Biology of Ageing. Laboratuvar muhafazasını turkuaz ev ve verimli bir şekilde standart Zebra balığı özellikleri için kullanılan aynı altyapı istihdam Merkezi su filtrasyon sistemi, bireysel balık binlerce yükseltmek killifish ölçeklendirilecektir. Burada verimli killifish bakım izin standart yordamların listesini ayrıntılı.

Video: A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

A Flow-through Exposure System for Evaluating Suspended Sediments Effects on Aquatic Life

This paper describes the Fish Larvae and Egg Exposure System (FLEES). The flow-through exposure system is used to investigate the effects of suspended sediment on various aquatic species and life stages in the laboratory by using pumps and automating delivery of sediment and water to simulate suspension of sediment. FLEES data are used to develop exposure-response curves between the effects on aquatic organisms and suspended sediment concentrations at the desired exposure duration. The effects data are used to evaluate management practices used to reduce the interactions between aquatic organisms and anthropogenic causes of suspended sediments. The FLEES is capable of generating total suspended solids (TSS) concentrations as low as 30 to as high as 800 mg/L, making this system an ideal choice for evaluating the effects of TSS resulting from many activities including simulating low ambient levels of TSS to evaluating sources of suspended sediments from dredging operations, vessel traffic, freshets, and storms.

A robust and flexible flow-through exposure system designed to maintain sediment in suspension is presented. The system is used to investigate the effects of suspended sediment on various aquatic species and life stages in the laboratory.

Sucul Life Asma değerlendirmek Sedimanlar Etkileri için Flow-through Pozlama Sistemi

This paper describes the Fish Larvae and Egg Exposure System (FLEES). The flow-through exposure system is used to investigate the effects of suspended ...

Çevre

Protocol for Acute and Chronic Ecotoxicity Testing of the Turquoise Killifish Nothobranchius furzeri

The killifish Nothobranchius furzeri is an emerging model organism in the field of ecotoxicology and its applicability in acute and chronic ecotoxicity testing has been demonstrated. Overall, the sensitivity of the species to toxic compounds is in the range with, or higher than, that of other model species.
This work describes protocols for acute, chronic, and multigenerational bioassays of single and combined stressor effects on N. furzeri. Due to its short maturation time and life-cycle, this vertebrate model allows the study of endpoints such as maturation time and fecundity within four months. Transgenerational full life-cycle exposure trials can be performed in as little as 8 months. Since this species produces eggs that are drought-resistant and remain viable for years, the on-site culture of the species is not needed but individuals can be recruited when required. The protocols are designed to measure life-history traits (mortality, growth, fecundity, weight) and critical thermal maximum.

Protocol for Acute and Chronic Ecotoxicity Testing of the Turquoise Killifish Nothobranchius furzeri

In this work, we describe an acute, chronic and multigenerational bioassay to study the effects of single and combined stressors on the Turquoise killifish Nothobranchius furzeri. This protocol is designed to study life-history traits (mortality, growth, fecundity, weight) and critical thermal maximum.

Akut ve kronik Ecotoxicity test turkuaz Killifish Nothobranchius furzeri için iletişim kuralı

The killifish Nothobranchius furzeri is an emerging model organism in the field of ecotoxicology and its applicability in acute and chronic ecotoxicity ...

Raising the Mexican Tetra Astyanax mexicanus for Analysis of Post-larval Phenotypes and Whole-mount Immunohistochemistry

River and cave-adapted populations of Astyanax mexicanus show differences in morphology, physiology, and behavior. Research focused on comparing adult forms has revealed the genetic basis of some of these differences. Less is known about how the populations differ at post-larval stages (at the onset of feeding). Such studies may provide insight into how cavefish survive through adulthood in their natural environment. Methods for comparing post-larval development in the laboratory require standardized aquaculture and feeding regimes. Here we describe how to raise fish on a diet of nutrient-rich rotifers in non-recirculating water for up to two-weeks post fertilization. We demonstrate how to collect post-larval fish from this nursery system and perform whole-mount immunostaining. Immunostaining is an attractive alternative to transgene expression analysis for investigating development and gene function in A. mexicanus. The nursery method can also be used as a standard protocol for establishing density-matched populations for growth into adults.

Raising the Mexican Tetra Astyanax mexicanus for Analysis of Post-larval Phenotypes and Whole-mount Immunohistochemistry

In this protocol, we demonstrate how to breed Astyanax mexicanus adults, raise the larvae, and perform whole-mount immunohistochemistry on post-larval fish to compare the phenotypes of surface and cave morphotypes.

Meksika Tetra Astyanax mexicanus analiz Post-larval fenotipleri ve bütün Dağı immünhistokimya için yetiştirme

River and cave-adapted populations of Astyanax mexicanus show differences in morphology, physiology, and behavior. Research focused on comparing adult ...

Genetik

A Standardized Protocol for Preference Testing to Assess Fish Welfare

Animal welfare assessment techniques try to take into consideration the specific needs and wants of the animal in question. Providing enrichment (the addition of physical objects or conspecifics in the housing environment) is often a way to give captive animals the opportunity to choose who or what they interact with and how they spend their time. A fundamental component of the aquatic environment that is often overlooked in captivity, however, is the ability for the animal to choose to engage in physical exercise. For many animals, including fish, exercise is an important aspect of their life history, and is known to have many health benefits, including positive changes in the brain and behavior. Here we present a method for assessing habitat preferences in captive animals. The protocol could easily be adapted to look at a variety of environmental factors (e.g., gravel versus sand as a substrate, plastic plants versus live plants, low flow versus high flow of water) in different aquatic species, or for use with terrestrial species. Statistical assessment of preference is carried out using Jacob&#39;s preference index, which ranks the habitats from -1 (avoidance) to +1 (most preferred). With this information, it can be determined what the animal wants from a welfare perspective, including their preferred location.

A fundamental aspect of assessing the welfare of animals in captivity is to ask whether the animals have what they want. Here, we present a protocol to determine housing preference in the zebrafish (Danio rerio) with respect to the presence/absence of environmental enrichment and access to flowing of water.

Balık Refahını Değerlendirmek Için Tercih Testi için StandartLaştırılmış Protokol

Animal welfare assessment techniques try to take into consideration the specific needs and wants of the animal in question. Providing enrichment (the ...

Davranış

Examination of Host Phenotypes in Gambusia affinis Following Antibiotic Treatment

The commonality of antibiotic usage in medicine means that understanding the resulting consequences to the host is vital. Antibiotics often decrease host microbiome community diversity and alter the microbial community composition. Many diseases such as antibiotic-associated enterocolitis, inflammatory bowel disease, and metabolic disorders have been linked to a disrupted microbiota. The complex interplay between host, microbiome, and antibiotics needs a tractable model for studying host-microbiome interactions. Our freshwater vertebrate fish serves as a useful model for investigating the universal aspects of mucosal microbiome structure and function as well as analyzing consequential host effects from altering the microbial community. Methods include host challenges such as infection by a known fish pathogen, exposure to fecal or soil microbes, osmotic stress, nitrate toxicity, growth analysis, and measurement of gut motility. These techniques demonstrate a flexible and useful model system for rapid determination of host phenotypes.

Examination of Host Phenotypes in Gambusia affinis Following Antibiotic Treatment

This study involves methods to reveal effects on a model fish host following alteration of the skin and gut microbiome communities&#160;composition by an antibiotic.

Ana fenotipleri incelenmesi halinde<em&gt; Gambusia affinis</em&gt; Takiben Antibiyotik Tedavisi

The commonality of antibiotic usage in medicine means that understanding the resulting consequences to the host is vital. Antibiotics often decrease host ...

İmmünoloji ve Enfeksiyon

GF Zebra Balığı Modellerinin Optimize Edilmesi: Üretim, Bakım ve Mikrobiyal Çalışmalar

Generation, Maintenance, and Identification of Germ-Free Zebrafish Models from Larvae to Juvenile Stages

Zebrafish serve as valuable models for research on growth, immunity, and gut microbiota due to their genomic similarities with mammals, transparent embryos developed in a relatively clean chorion environment, and extremely rapid development of larvae compared to rodent models. Germ-free (GF) zebrafish (Danio rerio) are crucial for evaluating pollutant toxicity and establishing human-like disease models related to microbial functions. In comparison to conventionally raised (CR) models (fish in common husbandry), GF zebrafish allow for more accurate manipulation of the host microbiota, aiding in determining the causal relationship between microorganisms and hosts. Consequently, they play a critical role in advancing our understanding of these relationships. However, GF zebrafish models are typically generated and researched during the early life stages (from embryos to larvae) due to limitations in immune function and nutrient absorption. This study optimizes the generation, maintenance, and identification of early GF zebrafish models without feeding and with long-term feeding using GF food (such as Artemia sp., brine shrimp). Throughout the process, daily sampling and culture were performed and identified through multiple detections, including plates and 16S rRNA sequencing. The aseptic rate, survival, and developmental indexes of GF zebrafish were recorded to ensure the quality and quantity of the generated models. Importantly, this study provides details on bacterial isolation and infection techniques for GF fish, enabling the efficient creation of GF fish models from larvae to juvenile stages with GF food support. By applying these procedures in biomedical research, scientists can better understand the relationships between intestinal bacterial functions and host health.

Yazar Spotlight: Mikrobiyota-Konak İlişkisi Çalışmaları için Mikropsuz Zebra Balığı Oluşturma

This protocol outlines the primary steps for obtaining germ-free (GF) fish embryos and maintaining them from larvae until the juvenile stage, including sampling and detecting their sterile status. The use of GF models with infection is important for understanding the role of microbes in host health.

Larvalardan Gençlik Dönemlerine Kadar Mikropsuz Zebra Balığı Modellerinin Üretimi, Bakımı ve Tanımlanması

Zebrafish serve as valuable models for research on growth, immunity, and gut microbiota due to their genomic similarities with mammals, transparent ...

Gelişim Biyolojisi

Construction of an Affordable and Easy-to-Build Zebrafish Facility

In vivo biomedical research is pivotal to translate in vitro findings into clinical advances. Small academic institutions with limited resources find it virtually impossible to build and maintain typical rodent facilities for research. Zebrafish research has been demonstrated to be a valuable alternative for in vivo research in pharmacology, physiology, development and genetic studies. This article demonstrates that a functional zebrafish facility can be built in an easy and affordable manner. We demonstrate that such a facility could be built in about one working day with minimal tools and expertise. The cost of the 27 1.8 L fish tank zebrafish facility constructed in this study was approximately $1,500. We estimate that the maintenance of an initial working 150 fish colony for 3 months is $1,000. This project involved students, who were introduced to aquaculturing of zebrafish for research proposes.

A Zebrafish facility suitable for breeding and in vivo research is built in an easy and affordable manner. Maintenance is minimal. This facility is ideal for student involvement and independent research.

Bir Ekonomik ve Kolay oluşturun Zebra balığı Tesisi İnşaatı

In vivo biomedical research is pivotal to translate in vitro findings into clinical advances. Small academic institutions with limited resources find it ...

Biyoloji

Gentle Isolation of Nuclei from the Brain Tissue of Adult African Turquoise Killifish, a Naturally Short-Lived Model for Aging Research

Studying brain aging at single-cell resolution in vertebrate systems remains challenging due to cost, time, and technical constraints. Here, we demonstrate a protocol to generate single-nucleus RNA sequencing (snRNA-seq) libraries from the brains of the naturally short-lived vertebrate African turquoise killifish Nothobranchius furzeri. The African turquoise killifish has a lifespan of 4-6 months and can be housed in a cost-effective manner, thus reducing cost and time barriers to study vertebrate brain aging. However, tailored protocols are needed to isolate nuclei of sufficient quality for downstream single-cell experiments from the brain of young and aged fish. Here, we demonstrate an empirically optimized protocol for the isolation of high-quality nuclei from the brain of adult African turquoise killifish, a critical step in the generation of high-quality single nuclei omic libraries. Furthermore, we show that the steps to reduce contaminating background RNA are important to clearly distinguish cell types. In summary, this protocol demonstrates the feasibility of studying brain aging in non-traditional vertebrate model organisms.

Here we present a protocol to isolate nuclei from the brains of the short-lived vertebrate model Nothobranchius furzeri for downstream applications such as single-nucleus RNA sequencing or single-nucleus assay for transposase-accessible chromatin with sequencing (ATAC-seq).

Laboratuvar konut, turkuaz Killifish (Nothobranchius furzeri) için bir iletişim kuralı

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler

Sucul Life Asma değerlendirmek Sedimanlar Etkileri için Flow-through Pozlama Sistemi

Akut ve kronik Ecotoxicity test turkuaz Killifish Nothobranchius furzeri için iletişim kuralı

Meksika Tetra Astyanax mexicanus analiz Post-larval fenotipleri ve bütün Dağı immünhistokimya için yetiştirme

Balık Refahını Değerlendirmek Için Tercih Testi için StandartLaştırılmış Protokol

Ana fenotipleri incelenmesi halinde

Larvalardan Gençlik Dönemlerine Kadar Mikropsuz Zebra Balığı Modellerinin Üretimi, Bakımı ve Tanımlanması

Larvalardan Gençlik Dönemlerine Kadar Mikropsuz Zebra Balığı Modellerinin Üretimi, Bakımı ve Tanımlanması

Larvalardan Gençlik Dönemlerine Kadar Mikropsuz Zebra Balığı Modellerinin Üretimi, Bakımı ve Tanımlanması

Bir Ekonomik ve Kolay oluşturun Zebra balığı Tesisi İnşaatı

Yetişkin Afrika Turkuaz Killifish'in Beyin Dokusundan Çekirdeklerin Nazik İzolasyonu, Yaşlanma Araştırmaları için Doğal Kısa Ömürlü Bir Model