Kırınım veri Güneydoğu bölgesel işbirliği Access ekibi (SER-CAT) 22-ID ve 22-BM beamlines, Gelişmiş foton kaynak (APS), Argonne Ulusal Laboratuvarı, toplanmıştır. SAXS veri FALCILAR beamline, önceden ışık kaynağı (ALS), Lawrence Berkeley Ulusal Laboratuvarı üzerinde toplandı. FALCI beamline onların yardımıyla uzak veri toplama ve işleme için personel teşekkür etmek istiyorum. Ulusal çevre sağlık Bilimler Enstitüsü (NIEHS) kütle spektrometresi araştırma ve destek grubu için protein etki alanı sınırları belirleme konusunda yardım için sana şükrediyoruz. Bu eser bize Ulusal Enstitüsü, sağlık Intramural araştırma programı tarafından desteklenen; ABD Ulusal Enstitüsü çevre sağlığı Bilimleri (NIEHS) (R. E. S. için Ziya ES103247) ve sağlık araştırması (CIHR, 146626 M.C.P için) Kanadalı Enstitüleri. APS kullanımı bize Enerji Bakanlığı, bilim Office, Office temel Enerji Bilimler altında Sözleşme No Filtresi tarafından desteklenen yapıldı. W-31-109-Eng-38. Kullanım gelişmiş ışık kaynağı (ALS) Yönetmen, bilim Office, Office temel Enerji Bilimler, Sözleşme No altında ABD Enerji Bakanlığı tarafından desteklenmiştir DE-AC02-05CH11231. Ek destek FALCILAR SAXS beamline Ulusal Sağlık Enstitüsü gelir için project MINOS (R01GM105404) ve bir yüksek-son araçları Grant S10OD018483. Biz de Andrea ay ve Dr Sara Andres Bu el yazması onların eleştirel okuma için teşekkür etmek istiyorum.

Yazarlar ifşa gerek yok.

Bu iletişim kuralını kullanan, rekombinant Nsa1 S. cerevisiae gelen yapısal çalışmaları için x-ışını kristalografisi ve SAXS tarafından oluşturuldu. Nsa1 çözümde su kuyusu-davranmak ve kristal yükseltgen kristalize. Bu kristaller en iyileştirme sırasında C-terminus Nsa1, proteaz düşmesine duyarlı keşfedilmiştir. Yüksek çözünürlüklü Ortorombik kristal formu sadece çoğaltılamaz C-terminal kesme türevleri Nsa1, büyük olasılıkla ile esnek C-terminus Nsa1, kristal ambalaj eng...

Ribozom mRNA tüm canlı hücrelerdeki protein dönüştürerek httpd'ye temel rolü gerçekleştirmek büyük Ribonükleoprotein makinelerdir. Ribozom ribozom biyongenezi1,2,3,4olarak adlandırdığı karmaşık bir süreç içinde üretilen iki altbirimden oluşur. Ökaryotik ribozom derleme gerekli ribozomal derleme faktörler2,3,5yüzlerce yardımıyla dayanır. Nsa1 (Nop7 ilişkili 1) özellikle büyük ribozomal altbirimde6üretimi için gerekli olan bir ökaryotik ribozom derleme bir faktördür ve WD yineleme olarak bilinen 74 (WDR74) daha yüksek organizmaların7içeren. WDR74 fareler8blastosist oluşumu için gerekli olduğu gösterilmiştir ve WDR74 düzenleyici sık kanser hücreleri9' mutasyona uğramış. Ancak, işlev ve Nsa1/WDR74 kesin mekanizmaları ribozom derlemesinde hala büyük ölçüde bilinmeyen vardır. Nsa1/WDR74 rolü ökaryotik ribozom olgunlaşma sırasında ortaya çıkarmak başlamak için birden çok yapısal analiz, x-ışını kristalografisi ve küçük açı X-ray saçılma (SAXS)10gibi yapıldı.
X-ışını kristalografisi, Nükleer manyetik rezonans (NMR) spektroskopisi, elektron mikroskobu ve SAXS makromoleküllerin yapısı eğitim için tüm önemli teknikler vardır. Boyut, şekil, kullanılabilirliğini ve kararlılığını belirli bir makromolekül en iyi olacak Yapısal Biyoloji yöntemi uygun oluştururlar etkiler, ancak bir çok teknik bir sözde "melez" yaklaşımla birleştirerek haline geliyor bir giderek daha faydalı aracı11. Özellikle x-ışını kristalografisi ve SAXS yapısal oluştururlar12tespiti için güçlü ve tamamlayıcı yöntemler vardır.
Kristalografi ribozom gibi büyük hücresel makine küçük moleküller arasında değişen yüksek çözünürlüklü atomik yapıları sağlar ve proteinleri ve diğer biyolojik fonksiyonların anlamada çok sayıda devrimler yol açmıştır oluştururlar13. Ayrıca, uyuşturucu yapısı tabanlı tasarım hesaplama yöntemleri, ilaç bulma ve geliştirme14için kritik bir boyut ekleme tarafından Moleküler yerleştirme için kristal yapıları gücünü. Onun geniş uygulanabilirliği rağmen esnek ve düzensiz kristal ambalaj engel veya elektron yoğunluğu eşlemeleri tamamlanmamış olabilir beri kristalografisi, ya da düşük kaliteli değerlendirmek için zorlu sistemlerdir. Tersine, SAXS çözüm tabanlı ve düşük çözünürlüklü yapısal yaklaşım düzensiz döngüler ve termini özünde düzensiz proteinler12,15,16' kadar esnek sistemleri açıklayan yeteneğine sahip olduğunu. Parçacık boyutları12geniş bir yelpazesi ile uyumlu olduğunu düşünürsek, SAXS sinerjik kristalografisi yapısal çalışmaları tarafından ele alınması biyolojik sorular aralığı genişletmek için çalışabilirsiniz.
Bir fonksiyonel ama esnek C-hangi x-ışını kristalografisi yöntemleri için müsait değildir terminus ardından iyi yapılandırılmış bir WD40 etki alanı içerdiği için Nsa1 bir melez yapısal yaklaşım için uygundur. Klonlama, ifade ve arıtma S. cerevisiae Nsa1 x-ışını kristalografisi tarafından hibrid yapısal tayini için ve SAXS için bir protokol aşağıdadır. Bu iletişim kuralı bir arada düzenli ve düzensiz bölgeler oluşmaktadır diğer proteinler yapılarının çalışmaya adapte edilebilir.

<table><tbody><tr><td>&lt;strong&gt;Molecular Cloning of Nsa1&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>pMBP2 parallel vector</td><td>Sheffield et al, Protein Expression and Purification 15, 34-39 (1999)</td><td></td><td>We used a modified version of pMBP2 which included an N-terminal His-tag (pHMBP)</td></tr><tr><td>S. cerevisiae genomic DNA</td><td>ATCC</td><td>204508D-5</td><td></td></tr><tr><td>&lt;strong&gt;Primers for cloning Nsa1&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>SC_Nsa1_FLFw</td><td>IDT</td><td></td><td>CGC CAA AGG CCT&lt;br/&gt; ATGAGGTTACTAGTCAGCTGTGT&lt;br/&gt; GGATAG</td></tr><tr><td>SC_Nsa1_FLRv</td><td>IDT</td><td></td><td>AATGCAGCGGCCGCTCAAATTTT&lt;br/&gt; GCTTTTCTTACTGGCTTTAGAAGC&lt;br/&gt; AGC</td></tr><tr><td>SC_Nsa1_DeltaCFw</td><td>IDT</td><td></td><td>GGGCGCCATGGGATCCATGAGG&lt;br/&gt; TTACTAGTCAGCTGTGTGG</td></tr><tr><td>SC_Nsa1_DeltaCRv</td><td>IDT</td><td></td><td>GATTCGAAAGCGGCCGCTTAAAC&lt;br/&gt; CTTCCTTTTTTGCTTCCC</td></tr><tr><td>&lt;strong&gt;Recombinant Protein Production and Purification of Nsa1&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Escherichia coli BL21 (DE3) Star Cells</td><td>Invitrogen</td><td>C601003</td><td></td></tr><tr><td>pMBP- NSA1 and various truncations</td><td>Lo et al., 2017</td><td></td><td></td></tr><tr><td>Selenomethionine</td><td>Molecular Dimensions</td><td>MD12-503B</td><td></td></tr><tr><td>IPTG, Dioxane-Free</td><td>Promega</td><td>V3953</td><td></td></tr><tr><td>EDTA Free Protease Inhibitor Cocktail</td><td>Sigma-Aldrich</td><td>4693159001</td><td></td></tr><tr><td>Sodium Chloride</td><td>Caledon Laboratory Chemicals</td><td>7560-1-80</td><td></td></tr><tr><td>Magnesium Chloride hexahydrate</td><td>Sigma-Aldrich</td><td>M2670</td><td></td></tr><tr><td>Tris Buffer, 1 M pH7.5</td><td>KD Medical</td><td>RGF-3340</td><td></td></tr><tr><td>Glycerol</td><td>Invitrogen</td><td>15514-029</td><td></td></tr><tr><td>beta-mercaptoethanol</td><td>Sigma</td><td>M6250</td><td></td></tr><tr><td>1M Imidazole, pH 8.0</td><td>Teknova</td><td>I6980-06</td><td></td></tr><tr><td>Talon Affinity Resin</td><td>Clonetech</td><td>635503</td><td></td></tr><tr><td>Amicon Ultra 15 mL Centrifugal Filter (MWCO 10K)</td><td>Millipore</td><td>UFC901024</td><td></td></tr><tr><td>HiLoad 16/600 Superdex 200 Prep Grade Gel Filtration Column</td><td>GE-Healthcare</td><td>28989335</td><td></td></tr><tr><td>TEV Protease</td><td>Prepared by NIEHS Protein Expression Core</td><td>Expression plasmid provided by NCI (Tropea et al. Methods Mol Biology, 2009)</td><td></td></tr><tr><td>4-15% Mini-PROTEAN TGX Precast Protein Gels</td><td>BioRad</td><td>456-8056</td><td></td></tr><tr><td>&lt;strong&gt;Crystallization, Proteolytic Screening&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Crystal Screen</td><td>Hampton Research</td><td>HR2-110</td><td></td></tr><tr><td>Crystal Screen 2</td><td>Hampton Research</td><td>HR2-112</td><td></td></tr><tr><td>Salt Rx</td><td>Hampton Research</td><td>HR2-136</td><td></td></tr><tr><td>Index Screen</td><td>Hampton Research</td><td>HR2-144</td><td></td></tr><tr><td>PEG/Ion Screen</td><td>Hampton Research</td><td>HR2-139</td><td></td></tr><tr><td>JCSG+</td><td>Molecular Dimensions</td><td>MD1-37</td><td></td></tr><tr><td>Wizard Precipitant Synergy</td><td>Molecular Dimensions</td><td>MD15-PS-T</td><td></td></tr><tr><td>Swissci 96-well 3-drop UVP sitting drop plates</td><td>TTP Labtech</td><td>4150-05823</td><td></td></tr><tr><td>3inch Wide Crystal Clear Sealing Tape</td><td>Hampton Research</td><td>HR4-506</td><td></td></tr><tr><td>Proti-Ace Kit</td><td>Hampton Research</td><td>HR2-429</td><td></td></tr><tr><td>PEG 1500</td><td>Molecular Dimensions</td><td>MD2-100-6</td><td></td></tr><tr><td>PEG 400</td><td>Molecular Dimensions</td><td>MD2-100-3</td><td></td></tr><tr><td>HEPES/sodium hydroxide pH 7.5</td><td>Molecular Dimensions</td><td>MD2-011-</td><td></td></tr><tr><td>Sodium Citrate tribasic</td><td>Molecular Dimensions</td><td>MD2-100-127</td><td></td></tr><tr><td>22 mm x 0.22 mm Siliconized Coverslides</td><td>Hampton Research</td><td>HR3-231</td><td></td></tr><tr><td>24 Well Plates with sealant (VDX Plate with Sealant)</td><td>Hampton Research</td><td>HR3-172</td><td></td></tr><tr><td>18 mM Mounted Nylon Loops (0.05 mm to 0.5 mM)</td><td>Hampton Research</td><td>HR4-945, HR4-947, HR4-970, HR4-971</td><td></td></tr><tr><td>Seed Bead Kit</td><td>Hampton Research</td><td>HR2-320</td><td></td></tr><tr><td>Magnetic Crystal Caps</td><td>Hampton Research</td><td>HR4-779</td><td></td></tr><tr><td>Magnetic Cryo Wand</td><td>Hampton Research</td><td>HR4-729</td><td></td></tr><tr><td>Cryogenic Foam Dewar</td><td>Hampton Research</td><td>HR4-673</td><td></td></tr><tr><td>Crystal Puck System</td><td>MiTeGen</td><td>M-CP-111-021</td><td></td></tr><tr><td>Full Skirt 96 well Clear Plate</td><td>VWR</td><td>10011-228</td><td></td></tr><tr><td>AxyMat Sealing Mat</td><td>VWR</td><td>10011-130</td><td></td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>UVEX-m</td><td>JAN Scientific, Inc.</td><td></td><td></td></tr><tr><td>Nanodrop Lite Spectrophotometer</td><td>Thermo-Fisher</td><td></td><td></td></tr><tr><td>Mosquito Robot</td><td>TTP Labtech</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Software/Websites&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>HKL2000</td><td>Otwinoski and Minor, 1997</td><td></td><td></td></tr><tr><td>Phenix</td><td>Adams et al., 2010</td><td></td><td></td></tr><tr><td>Coot</td><td>Emsley et al., 2010</td><td></td><td></td></tr><tr><td>ATSAS</td><td>Petoukhov et al., 2012</td><td></td><td>https://www.embl-hamburg.de/biosaxs/atsas-online/</td></tr><tr><td>Scatter</td><td>Rambo and Tainer, 2013</td><td></td><td></td></tr><tr><td>Pymol</td><td>The PyMOL Molecular Graphics System, Version 1.8 Schr&amp;ouml;dinger, LLC.</td><td></td><td></td></tr><tr><td>BUNCH</td><td>Petoukhov and Svergun, 2005</td><td></td><td></td></tr><tr><td>CRYSOL</td><td>Svergun et al, 1995</td><td></td><td></td></tr><tr><td>PRIMUS</td><td>Konarev et al, 2003</td><td></td><td></td></tr><tr><td>EOM</td><td>Tria et al, 2015</td><td></td><td></td></tr></tbody></table>

combining x-ray crystallography with small angle x-ray scattering to model unstructured regions of nsa1 from s. cerevisiae

Saccharomyces cerevisiae (S. cerevisiae) elde ribozom derleme faktörü Nsa1 tam uzunlukta yapısını belirlenmesi zor nedeniyle düzensiz ve proteaz değişken C-terminus protein. Bu el yazması x-ışını kristalografisi ve SAXS göre yapısal analiz için S. cerevisiae üzerinden rekombinant Nsa1 arındırmak için yöntemleri açıklar. X-ışını kristalografisi Nsa1 iyi N-terminal WD40 etki alanı yapısını çözmek için kullanılmıştır ve sonra SAXS Nsa1, C-terminus yapısında çözüm çözmek için kullanıldı. Çözüm saçılma veriler çözüm tam uzunlukta Nsa1 üzerinden toplanmıştır. Teorik saçılma genlikleri WD40 etki alanı yüksek çözünürlüklü kristal yapısı hesaplanan ve C-terminus Nsa1, katı vücut ve ab initio modelleme bir arada ortaya koydu. Bu melez yaklaşımla tüm protein dördüncül yapısının yeniden. Burada sunulan yöntemleri genel olarak yapılandırılmış ve yapılandırılmamış etki alanları karışımından oluşan diğer proteinlerin hibrid yapısal kararlılık için uygulanabilir olmalıdır.

Nsa1 S. cerevisiae genomik DNA'güçlendirilmiş ve ardından MBP ve TEV proteaz site bir N-terminal 6 x-histidin benzeşme etiketi içeren bir vektör içine subcloned PCR yapıldı. Nsa1 E. coli BL21(DE3) hücrelere dönüştü ve yüksek verim protein ifade aşağıdaki IPTG ile indüksiyon ve 25 ° c gece (şekil 1A) büyüme elde edilmiştir. Nsa1 benzeşme saf üzerinde immobilize kobalt benzeşme reçine, MBP bölünme TEV proteaz ile...

Watch this Scientific Journal Video about Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae at JoVE.com

Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

Bu yöntem klonlama, ifade ve yapısal tayini için rekombinant Nsa1 arınma x-ışını kristalografisi ve küçük açı X-ray saçılma (SAXS) tarafından açıklar ve diğer proteinlerin hibrid yapısal analiz için geçerlidir her ikisi de içeren düzenli ve düzensiz etki alanları.

X-ışını kristalografisi Nsa1 S. Cerevisiae üzerinden yapılandırılmamış bölgelerinde modellemek için küçük açı X-Ray saçılma ile birleştirerek

Determination of the full-length structure of ribosome assembly factor Nsa1 from Saccharomyces cerevisiae (S. cerevisiae) is challenging because of the ...

combining-x-ray-crystallography-with-small-angle-x-ray-scattering-to

Universidad de Cartagena UDEC

Research

JoVE Journal

Biochemistry

Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

9.8K Görüntüleme.  National Institutes of Health. Bu yöntem klonlama, ifade ve yapısal tayini için rekombinant Nsa1 arınma x-ışını kristalografisi ve küçük açı X-ray saçılma (SAXS) tarafından açıklar ve diğer proteinlerin hibrid yapısal analiz için geçerlidir her ikisi de içeren düzenli ve düzensiz etki alanları.

Video: Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

Online Size-exclusion and Ion-exchange Chromatography on a SAXS Beamline

Biological small angle X-ray scattering (BioSAXS) is a powerful technique in molecular and structural biology used to determine solution structure, particle size and shape, and surface-to-volume ratio of macromolecules. The technique is applicable to a very wide variety of solution conditions spanning a broad range of concentrations, pH values, ionic strengths, temperatures, additives, etc., but the sample is required to be monodisperse. This caveat led to the implementation of liquid chromatography systems on SAXS beamlines. Here, we describe the upstream integration of size-exclusion (SEC) and ion-exchange chromatography (IEC) on a beamline, different methods for optimal background subtraction, and data reduction. As an example, we describe how we use SEC- and IEC-SAXS on a fragment of the essential vaccinia virus protein D5, consisting of a D5N helicase domain. We determine its overall shape and molecular weight, showing the hexameric structure of the protein.

The determination of the solution structure of a protein by small angle X-ray scattering (SAXS) requires monodisperse samples. Here, we present two possibilities to ensure minimal delays between sample preparation and data acquisition: online size-exclusion chromatography (SEC) and online ion-exchange chromatography (IEC).

Bir SAXS beamline Online Boyut dışlama ve İyon değişim Kromatografi

Biological small angle X-ray scattering (BioSAXS) is a powerful technique in molecular and structural biology used to determine solution structure, ...

Biyokimya

Combining Wet and Dry Lab Techniques to Guide the Crystallization of Large Coiled-coil Containing Proteins

Obtaining crystals for structure determination can be a difficult and time consuming proposition for any protein. Coiled-coil proteins and domains are found throughout nature, however, because of their physical properties and tendency to aggregate, they are traditionally viewed as being especially difficult to crystallize. Here, we utilize a variety of quick and simple techniques designed to identify a series of possible domain boundaries for a given coiled-coil protein, and then quickly characterize the behavior of these proteins in solution. With the addition of a strongly fluorescent tag (mRuby2), protein characterization is simple and straightforward. The target protein can be readily visualized under normal lighting and can be quantified with the use of an appropriate imager. The goal is to quickly identify candidates that can be removed from the crystallization pipeline because they are unlikely to succeed, affording more time for the best candidates and fewer funds expended on proteins that do not produce crystals. This process can be iterated to incorporate information gained from initial screening efforts, can be adapted for high-throughput expression and purification procedures, and is augmented by robotic screening for crystallization.

We describe a framework incorporating straightforward biochemical and computational analysis to guide the characterization and crystallization of large coiled-coil domains. This framework can be adapted for globular proteins or extended to incorporate a variety of high-throughput techniques.

Islak ve kuru Lab Teknikleri birleştiren Büyük Spiral-coil İçeren Proteinler kristalleşmesini Kılavuzu

Obtaining crystals for structure determination can be a difficult and time consuming proposition for any protein. Coiled-coil proteins and domains are ...

Atomic Scale Structural Studies of Macromolecular Assemblies by Solid-state Nuclear Magnetic Resonance Spectroscopy

Supramolecular protein assemblies play fundamental roles in biological processes ranging from host-pathogen interaction, viral infection to the propagation of neurodegenerative disorders. Such assemblies consist in multiple protein subunits organized in a non-covalent way to form large macromolecular objects that can execute a variety of cellular functions or cause detrimental consequences. Atomic insights into the assembly mechanisms and the functioning of those macromolecular assemblies remain often scarce since their inherent insolubility and non-crystallinity often drastically reduces the quality of the data obtained from most techniques used in structural biology, such as X-ray crystallography and solution Nuclear Magnetic Resonance (NMR). We here present magic-angle spinning solid-state NMR spectroscopy (SSNMR) as a powerful method to investigate structures of macromolecular assemblies at atomic resolution. SSNMR can reveal atomic details on the assembled complex without size and solubility limitations. The protocol presented here describes the essential steps from the production of 13C/15N isotope-labeled macromolecular protein assemblies to the acquisition of standard SSNMR spectra and their analysis and interpretation. As an example, we show the pipeline of a SSNMR structural analysis of a filamentous protein assembly.

Structures of supramolecular protein assemblies at atomic resolution are of high relevance because of their crucial roles in a variety of biological phenomena. Herein, we present a protocol to perform high-resolution structural studies on insoluble and non-crystalline macromolecular protein assemblies by magic-angle spinning solid-state nuclear magnetic resonance spectroscopy (MAS SSNMR).

Atomik yapısal çalışmaların makromoleküllerin meclisleri tarafından katı hal Nükleer manyetik rezonans spektroskopisi

Supramolecular protein assemblies play fundamental roles in biological processes ranging from host-pathogen interaction, viral infection to the ...

Microcrystallography of Protein Crystals and In Cellulo Diffraction

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in their largest dimension, which used to represent a challenge. We present two alternative workflows for the structure determination of protein microcrystals by X-ray crystallography with a particular focus on crystals grown in vivo. The microcrystals are either extracted from cells by sonication and purified by differential centrifugation, or analyzed in cellulo after cell sorting by flow cytometry of crystal-containing cells. Optionally, purified crystals or crystal-containing cells are soaked in heavy atom solutions for experimental phasing. These samples are then prepared for diffraction experiments in a similar way by application onto a micromesh support and flash cooling in liquid nitrogen. We briefly describe and compare serial diffraction experiments of isolated microcrystals and crystal-containing cells using a microfocus synchrotron beamline to produce datasets suitable for phasing, model building and refinement.
These workflows are exemplified with crystals of the Bombyx mori cypovirus 1 (BmCPV1) polyhedrin produced by infection of insect cells with a recombinant baculovirus. In this case study, in cellulo analysis is more efficient than analysis of purified crystals and yields a structure in ~8 days from expression to refinement.

Microcrystallography of Protein Crystals and In Cellulo Diffraction

A protocol is presented for X-ray crystallography using protein microcrystals. Two examples analyzing in vivo-grown microcrystals after purification or in cellulo are compared.

Protein Kristallerinin Mikrokristalografisi ve<em&gt; Selülozda</emKırınım

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in ...

Biochemical and Structural Characterization of the Carbohydrate Transport Substrate-binding-protein SP0092

Development of new antimicrobials and vaccines for Streptococcus pneumoniae (pneumococcus) are necessary to halt the rapid rise in multiple resistant strains. Carbohydrate substrate binding proteins (SBPs) represent viable targets for the development of protein-based vaccines and new antimicrobials because of their extracellular localization and the centrality of carbohydrate import for pneumococcal metabolism, respectively. Described here is a rationalized integrated protocol to carry out a comprehensive characterization of SP0092, which can be extended to other carbohydrate SBPs from the pneumococcus and other bacteria. This procedure can aid the structure-based design of inhibitors for this class of proteins. Presented in the first part of this manuscript are protocols for biochemical analysis by thermal shift assay, multi angle light scattering (MALS), and size exclusion chromatography (SEC), which optimize the stability and homogeneity of the sample directed to crystallization trials and so enhance the probability of success. The second part of this procedure describes the characterization of the SBP crystals using a tunable wavelength anomalous diffraction synchrotron beamline, and data collection protocols for measuring data that can be used to resolve the crystallized protein structure.

A streamlined protocol for performing an extensive biochemical and structural characterization of a carbohydrate substrate binding protein from Streptococcus pneumoniae is presented.

Karbonhidrat taşıma substrat-bağlayıcı-protein SP0092 biyokimyasal ve yapısal karakterizasyonu

Development of new antimicrobials and vaccines for Streptococcus pneumoniae (pneumococcus) are necessary to halt the rapid rise in multiple resistant ...

Small and Wide Angle X-Ray Scattering Studies of Biological Macromolecules in Solution

In this paper, Small and Wide Angle X-ray Scattering (SWAXS) analysis of macromolecules is demonstrated through experimentation. SWAXS is a technique where X-rays are elastically scattered by an inhomogeneous sample in the nm-range at small angles (typically 0.1 - 5&deg;) and wide angles (typically &gt; 5&deg;). This technique provides information about the shape, size, and distribution of macromolecules, characteristic distances of partially ordered materials, pore sizes, and surface-to-volume ratio. Small Angle X-ray Scattering (SAXS) is capable of delivering structural information of macromolecules between 1 and 200 nm, whereas Wide Angle X-ray Scattering (WAXS) can resolve even smaller Bragg spacing of samples between 0.33 nm and 0.49 nm based on the specific system setup and detector. The spacing is determined from Bragg's law and is dependent on the wavelength and incident angle.
In a SWAXS experiment, the materials can be solid or liquid and may contain solid, liquid or gaseous domains (so-called particles) of the same or another material in any combination. SWAXS applications are very broad and include colloids of all types: metals, composites, cement, oil, polymers, plastics, proteins, foods, and pharmaceuticals. For solid samples, the thickness is limited to approximately 5 mm.
Usage of a lab-based SWAXS instrument is detailed in this paper. With the available software (e.g., GNOM-ATSAS 2.3 package by D. Svergun EMBL-Hamburg and EasySWAXS software) for the SWAXS system, an experiment can be conducted to determine certain parameters of interest for the given sample. One example of a biological macromolecule experiment is the analysis of 2 wt% lysozyme in a water-based aqueous buffer which can be chosen and prepared through numerous methods. The preparation of the sample follows the guidelines below in the Preparation of the Sample section. Through SWAXS experimentation, important structural parameters of lysozyme, e.g. the radius of gyration, can be analyzed.

The demonstration of the small and wide angle X-ray scattering (SWAXS) procedure has become instrumental in the study of biological macromolecules. Through the use of the instrumentation and procedures of specific angle methods and preparation, the experimental data from the SWAXS displays the atomic and nano-scale characterization of macromolecules.

Çözüm Biyolojik Makromoleküllerin Küçük ve Geniş Açı X-Ray Saçılma Çalışmaları

In this paper, Small and Wide Angle X-ray Scattering (SWAXS) analysis of macromolecules is demonstrated through experimentation. SWAXS is a technique ...

Biyomühendislik

Contrast-Matching Detergent in Small-Angle Neutron Scattering Experiments for Membrane Protein Structural Analysis and Ab Initio Modeling

The biological small-angle neutron scattering instrument at the High-Flux Isotope Reactor of Oak Ridge National Laboratory is dedicated to the investigation of biological materials, biofuel processing, and bio-inspired materials covering nanometer to micrometer length scales. The methods presented here for investigating physical properties (i.e., size and shape) of membrane proteins (here, MmIAP, an intramembrane aspartyl protease from Methanoculleus marisnigri) in solutions of micelle-forming detergents are well-suited for this small-angle neutron scattering instrument, among others. Other biophysical characterization techniques are hindered by their inability to address the detergent contributions in a protein-detergent complex structure. Additionally, access to the Bio-Deuteration Lab provides unique capabilities for preparing large-scale cultivations and expressing deuterium-labeled proteins for enhanced scattering signal from the protein. While this technique does not provide structural details at high-resolution, the structural knowledge gap for membrane proteins contains many addressable areas of research without requiring near-atomic resolution. For example, these areas include determination of oligomeric states, complex formation, conformational changes during perturbation, and folding/unfolding events. These investigations can be readily accomplished through applications of this method.

Contrast-Matching Detergent in Small-Angle Neutron Scattering Experiments for Membrane Protein Structural Analysis and Ab Initio Modeling

This protocol demonstrates how to obtain a low-resolution ab initio model and structural details of a detergent-solubilized membrane protein in solution using small-angle neutron scattering with contrast-matching of the detergent.

Kontrast eşleştirme deterjan küçük açı Nötron saçılma deneylerde membran proteini yapısal analiz ve Ab Initio modelleme

The biological small-angle neutron scattering instrument at the High-Flux Isotope Reactor of Oak Ridge National Laboratory is dedicated to the ...

Structural Studies of Macromolecules in Solution using Small Angle X-Ray Scattering

Protein-protein interactions involving proteins with multiple globular domains present technical challenges for determining how such complexes form and how the domains are oriented/positioned. Here, a protocol with the potential for elucidating which specific domains mediate interactions in multicomponent system through ab initio modeling is described. A method for calculating solution structures of macromolecules and their assemblies is provided that involves integrating data from small angle X-ray scattering (SAXS), chromatography, and atomic resolution structures together in a hybrid approach. A specific example is that of the complex of full-length nidogen-1, which assembles extracellular matrix proteins and forms an extended, curved nanostructure. One of its globular domains attaches to laminin &#947;-1, which structures the basement membrane. This provides a basis for determining accurate structures of flexible multidomain protein complexes and is enabled by synchrotron sources coupled with automation robotics and size exclusion chromatography systems. This combination allows rapid analysis in which multiple oligomeric states are separated just prior to SAXS data collection. The analysis yields information on the radius of gyration, particle dimension, molecular shape and interdomain pairing. The protocol for generating 3D models of complexes by fitting high-resolution structures of the component proteins is also given.

Here, we present how Small Angle X-Ray Scattering (SAXS) can be utilized to obtain information on low-resolution envelopes representing the macromolecular structures. When used in conjunction with high-resolution structural techniques such as X-Ray Crystallography and Nuclear Magnetic Resonance, SAXS can provide detailed insights into multidomain proteins and macromolecular complexes in-solution.

Küçük açı x-ışını saçılması kullanarak çözüm yapısal oluştururlar çalışmaları

Protein-protein interactions involving proteins with multiple globular domains present technical challenges for determining how such complexes form and ...

Structure Solution of the Fluorescent Protein Cerulean Using MeshAndCollect

X-ray crystallography is the major technique used to obtain high resolution information concerning the 3-dimensional structures of biological macromolecules. Until recently, a major requirement has been the availability of relatively large, well diffracting crystals, which are often challenging to obtain. However, the advent of serial crystallography and a renaissance in multi-crystal data collection methods has meant that the availability of large crystals need no longer be a limiting factor. Here, we illustrate the use of the automated MeshAndCollect protocol, which first identifies the positions of many small crystals mounted on the same sample holder and then directs the collection from the crystals of a series of partial diffraction data sets for subsequent merging and use in structure determination. MeshAndCollect can be applied to any type of micro-crystals, even if weakly diffracting. As an example, we present here the use of the technique to solve the crystal structure of the Cyan Fluorescent Protein (CFP) Cerulean.

We present the use of the MeshAndCollect protocol to obtain a complete diffraction data set, for use in subsequent structure determination, composed of partial diffraction data sets collected from many small crystals of the fluorescent protein Cerulean.

MeshAndCollect kullanarak floresan Protein Cerulean yapı çözümü

X-ray crystallography is the major technique used to obtain high resolution information concerning the 3-dimensional structures of biological ...

Analysis of SEC-SAXS data via EFA deconvolution and Scatter

BioSAXS is a popular technique used in molecular and structural biology to determine the solution structure, particle size and shape, surface-to-volume ratio and conformational changes of macromolecules and macromolecular complexes. A high quality SAXS dataset for structural modeling must be from monodisperse, homogeneous samples and this is often only reached by a combination of inline chromatography and immediate SAXS measurement. Most commonly, size-exclusion chromatography is used to separate samples and exclude contaminants and aggregations from the particle of interest allowing SAXS measurements to be made from a well-resolved chromatographic peak of a single protein species. Still, in some cases, even inline purification is not a guarantee of monodisperse samples, either because multiple components are too close to each other in size or changes in shape induced through binding alter perceived elution time. In these cases, it may be possible to deconvolute the SAXS data of a mixture to obtain the idealized SAXS curves of individual components. Here, we show how this is achieved and the practical analysis of SEC-SAXS data is performed on ideal and difficult samples. Specifically, we show the SEC-SAXS analysis of the vaccinia E9 DNA polymerase exonuclease minus mutant.

SEC-BioSAXS measurements of biological macromolecules are a standard approach for determining solution structure of macromolecules and their complexes. Here, we analyze SEC-BioSAXS data from two types of commonly encountered SEC traces&#8212;chromatograms with fully resolved and partially resolved peaks. We demonstrate the analysis and deconvolution using scatter and BioXTAS RAW.

EFA deconvolution ve Scatter ile SEC-SAXS verilerinin analizi

BioSAXS is a popular technique used in molecular and structural biology to determine the solution structure, particle size and shape, surface-to-volume ...