Bu çalışma Çin Milli Anahtar Temel Araştırma Programı (No 2013CB127602) ve Çin Ulusal Bilim Vakfı (No 31321004) Yaratıcı Araştırma Grupları için Bilim Fonu tarafından desteklenmiştir.

HaDV2 içermeyen Pamuk Yeşilkurt Colony 1. İnşaat <ol><li> Arka pamuk kurdu larvası 14 saat aydınlık / 10 saat karanlık ve% 60 bağıl nem ile, 25 ± 1 ° C &#39;de kontrollü bir büyüme odası veya bir yapay iklim bölmesine bir suni diyetin 32 (H. armigera). </li><li> İyi havalandırma sağlamak için bir yumurtlama alt-tabaka olarak hizmet etmek üzere gazlı bez ile kaplı çift başına plastik bir kafes (10 cm yükseklik, çapı 5 cm) kullanılarak yeni eclosed kelebeklerin tek çifti çiftleşme Aid. virüssüz bir koloni elde olasılığını arttırmak için, tek-çift çiftleşmesinden en az 30 çiftleri kullanmaktadır. % 10 şeker ve% 2 Vitamin çözeltisi 32 ile besleme yetişkin kelebekleri bir pamuk ile ıslatılmış ve her gün doldurulan. </li><li> kadın yetişkin yaklaşık 2 days pamuk gazlı bez üzerine sonrası çiftleşme yumurtalarını gibi, günlük gazlı bez değiştirin. Toplayın ve aynı büyüme odasında gazlı içeren yumurta (ya da yapay iklim cham korumakber) yumurta kapak kadar yetişkin güveler olarak. </li><li> Hemen bir birey ile, yeni 24-kuyu plakalarına yumurtadan yeni çıkmış larvaların aktarmak başına iyi. </li><li> Beş gün önce yumurtlama tarihinden sonra, üst pervane toplamak ve sıvı azot içinde muhafaza edin. NOT: 5 gün ilk yumurtlama tarihinden sonra güveler Toplama anne toplama noktasında diri olmasını sağlar ve bu nedenle DNA ekstraksiyon doğruluğuna ölü pervane kullanmanın olası etkilerini önler. </li><li> üreticinin talimatlarına göre bir DNA ekstraksiyon kiti kullanılarak bu örneklerden elde edilen genomik DNA izole edin. <ol><li> primerler aktin F / aktin R formülüne sahip aktin geninin bir 574-bp fragmanı amplifiye (aktin F: 5-CATCTACGAGGGTTACGC-3 ve aktin R: 5-CATCTGTTGGAAGGTGGA-3). Polimeraz zincir reaksiyonu (PCR), standart protokollere göre, agaroz jel elektroforezi kullanılarak ürünler Visualise; aktin geninin başarılı amplifikasyon DNA, iyi kalitede olmasını sağlar. </li><li> t değerlendirinspesifik primerler ile PCR kullanılarak ana kelebeklerdeki HaDV2 arasında o varlığı: DVVPF (GGATTGGCCTGGGAAATGAC) ve DVVPR (CGTTGTTTTTATATCCGAGG) 31. </li></ol></li><li> Temiz bir çifti en az beş nesildir bu tek HaDV2-bulaşmamış üreme çifti gelen, arka yavrular tespit ve HaDV2 içermeyen kolonisinin (NONINF-soy) olarak muhafaza edildikten sonra; HaDV2 enfekte koloni INF-suşu olarak tanımlanmıştır. </li><li> NONINF-gerginlik içinde HaDV2 enfeksiyon durumunu doğrulamak için (ve bilinen bakteri veya ana gelişimi üzerine virüslerin etkisini dışlamak için), sekiz rastgele seçilen larvalar bireylerde HaDV2, Wolbachia ve H&#39;.armıgrer Nukleopolihedrovirüs&#39;ün (HaNPV) için enfeksiyon durumunu değerlendirmek (: HaNPV için HaDV2, NPVF / NPVR için DVVPF / DVVPR ve Wolbachia 31 için 81F / 691R, 33 özel primerlerle) PCR kullanılarak NONINF-suşu. NOT: Bazı virüsler geç olabileceği bilinmektedirnt bir PCR bazlı teknik kullanılarak saptanamayan hatta seviyesi ile enfekte olmuş bir konakçıya, içinde. NGS teknolojileri hiçbir viral diziler genomik DNA örnekleri mevcut olduğunu teyit etmek için kullanılabilir. </li></ol> HaDV2 içeren sıvı Akışkanların 2. Hazırlık NOT: Biz HaDV2 virüs parçacıklarının teşebbüs arıtma enfeksiyon yetilerini ve aktivitesini 31 engellediğini göstermiştir; Bu nedenle, aşağıdaki protokol HaDV2 enfekte bireylerin filtreleyerek Enfektif HaDV2 çözeltisi elde etmek için gerçekleştirilir. <ol><li> tek tek yetişkin pervane toplayın ve hemen sıvı nitrojen içinde depolayın. </li><li> Tamamen steril bir havan ve havan tokmağı kullanarak sıvı azot altında toplanan bireysel pervane öğütün. Temiz bir 1.5-mL tüp yaklaşık 10 ug enkaz aktarın. yeni bir tüpe kalan artıkları aktarın ve hemen -80 ° C&#39;de saklayın. </li><li> enkaz ug 10 DNA ekstrakte edin, follokanat üreticisi tarafından sağlanan protokolleri. güve DNA izole edildikten sonra adım 1.6 de tarif edildiği gibi, bir protokol kullanılarak HaDV2 kontrol edin. </li><li> adım 2.3 &#39;de elde edilen sonuçlara göre, iki gruba kalan artıkları bölün: HaDV2-pozitif ve HaDV2-negatif, bunların enfeksiyon durumuna bağlı olarak değişecektir. Fosfat tamponlu tuzlu su ile 1 ml ekleyin (PBS; 137 mM NaCI, 2.7 mM KCI, 8 mM Na2 HPO 4 ve 1.5 mM KH2 PO4; pH 7,5), her bir birey için tamamen geri kalan larva artıkları çözülmesi için. </li><li> Santrifüj, 4 ° C&#39;de 15 dakika boyunca 6500 x g&#39;de (adım 2.4 den) homojenat. 0.22 um&#39;lik bir membran filtre ile sıvı süpernatant süzülür. süzüldü sıvıları (tüp başına 200 uL) toplayın ve hemen -80 ° C&#39;de saklayın. NOT: 0.22 um membran filtre istenmeyen partiküller, bakteriler ve mantarların en süzer. İlk olarak, 4 ° C&#39;de santrifüj ön soğutma. Tüm protokolleri gerçekleştirin involviBuz üzerinde filtrelenmiş sıvı çalışmasını ng kahverengi dönüm ve pıhtılaştırıcı gelen Homojenat önlemek için kullanılırlar. </li></ol> HaDV2 bulaşmış Pamuk Yeşilkurt Colony 3. İnşaat <ol><li> HaDV2 yatay iletim kabiliyetini <ol><li> Bir HaDV2 standart eğri oluşturun. <ol><li> novo primerleri ile HaDV2 virüsünün ölçümü için kullanılır:, ve sonda (GCCACCACTAGAGGACCCACCAGATG VP-prob):; (TGACAAGATCCAGCGTAGACATC VPR CTGGTGAGGCGATGGACATG VPF) primerleri içeren parçacığın yükseltilmesi (PF: GGACAATGCTGGTGAGGC; PR: AATCCTCTTTGTCCGTTATCTATG). Bir PCR makinesi 31, 40 döngü için 72 ° C&#39;de, 94 ° C&#39;de 30 s, 53 ° C&#39;de 30 saniye ve 60 saniye: Aşağıdaki programı kullanın. şablon DNA olarak 25 uL PCR reaksiyonu için genomik DNA HaDV2 genomunu içeren (aşama 2.3) 1 uL ekleyin. üreticinin protokollerine göre bir klonlama vektörüne genişletilmiş parçacık Clone. </li><li> kopya sayısı hesaplayınaşağıdaki denklem ile plazmid N Bir Avogadro sayısı (6.02 x 10 23 moleküller / mol) kopya / uL = (C x K A) / (n x M 10 9 ×); Cı mikrospektrofotometri kullanılarak ölçülebilir plazmid (ng / uL), kütle yoğunluğu olduğu; n, PCR ürünü (5.195 bp) içeren plasmidle uzunluğudur; ve M, çift sarmallı DNA (660 g / mol) arasında bir ortalama taban çiftinin molekül ağırlığıdır. </li><li> 1.5 x 10 9 konsantrasyonları ile, 1.5 mL mikrosantrifüj tüpleri içinde, 1.5 x 10 8, 1.5 x 10 7, 1.5 x 10 6, 1.5 x 10 5, 1.5 x 10 4 kopya sayısı altı 10-misli seri seyreltimler hazırlayın / mcL. </li><li> döngüsü tasarımda oluşturmak için özel primerler (VPF / VPR) ve bir sondayı (VP-prob), gerçek zamanlı kantitatif polimeraz zincir reaksiyonu (qPCR) gerçekleştirmekAdım 3.1.1.3 tarif plazmid shold (BT) değerleridir. üç bağımsız teknik çoğaltır gerçekleştirin ve sonraki hesaplamalar için onları ortalamasını alırız. </li><li> Yukarıdaki sonuçları kullanarak, ilgili ortalama CT değerleri için log 2-dönüştürülmüş HaDV2 konsantrasyonları ile bir standart eğri oluşturmak. </li></ol></li><li> Filtre edilmiş sıvı sıvılarda HaDV2 ölçmek. <ol><li> Pipet DNA ekstraksiyonu için HaDV2 içeren filtre edilmiş sıvı akışkan (aşama 2.6) bir 100-uL test örneği. </li><li> Sıvı akışkanlar için, CT değerleri elde edilir ve adım 3.1.1 standart eğri kullanılarak kopya sayısını hesaplamak için gerçek bir zaman qPCR kullanın. </li></ol></li><li> Farklı konsantrasyonlarda HaDV2 enfekte süzüldü sıvı oral enfeksiyon etkinliğini belirler. <ol><li> Aşağıdaki konsantrasyonlara HaDV2 içeren sıvı akışkan seyreltilir: 10 8, 10 7, 10 6, 10 5, 10 4, ve 0 kopya sayısı / ml. </li><li> Yapay di yayıldıve eşit katılaşmadan önce bir 9 cm çapında bir Petri tabağına. Eşit katı suni diyetin yüzeyine her bir konsantrasyonu için HaDV2-içeren filtre edilmiş sıvının (200 uL) yayıldı. Davlumbaz yapın. </li><li> bir Petri kabındaki HaDV2 içeren suni diyete 100 taze yumurtadan larva aktarın. Yavaşça beyaz bir kağıt tabakasına gazlı larvaların aktarmak için (yeni doğmuş larvaları da dahil olmak üzere), pamuk gazlı bez çal. nazikçe kağıdı yendi böylece kağıttan larva sıkma ipek ve &quot;balon&quot;. ipek dokunun ve Petri kabı larva taşımak için sterilize forseps kullanın. </li><li> 48 saat sonra, 24-çukurlu levhalara suni diyetin (oyuk başına bir birey) üzerinde larva aktarın. </li><li> Arka yetişkin aşamaya üzerindeki konsantrasyonlarda HaDV2 ile aşılanmış larva. </li><li> Yetişkin pervane toplamak DNA özü ve adım 1.5 de tarif edildiği gibi PCR kullanılarak HaDV2 algılar. Burada ortak bir% 100 HaDV2 enfeksiyon oranı elde: NOTHaDV2 enfekte koloni (INF-soyu) kurmak ve böylece 10 8 kopya sayısı / uL kullanılarak ve tton bollworms. </li></ol></li></ol></li><li> HaDV2 Dikey bulaşma yeteneği <ol><li> negatif: -; HaDV2 enfenksiyonu: NONINF ve INF-suşlarından seçin yetişkin güveler ♀- / ♂-, ♀ + / ♂-, ♀- / ♂ + ve ♀ + / ♂ + (+ tek çiftlerinin üretilmesi için, HaDV2 enfeksiyon). </li><li> virüssüz 24 oyuklu plakalara yukarıdaki çiftleri yavrular aktarma; Arka Üçüncü dönem larva. </li><li> Adım 1.5&#39;de tarif edildiği gibi, HaDV2 varlığını belirlemek için bir şablon olarak kullanmak için toplanan üçüncü instar larvaları DNA ekstrakte edilir. </li></ol></li></ol> HaDV2 4. Doku Dağılımı <ol><li> , Virüs ve bakterilerden kirlenmeyi önlemek% 75 etanol ile Forseps ve makas sterilize üç kez ve daha sonra, bir alkol lambanın alevinde ısıtmak için. NOT: Forseps sterilizatiokirlenme, n gereklidir. </li><li> bir analitik terazi kullanılarak dokuların depolamak için kullanılacak olan boş masura tartın. </li><li> yaklaşık olarak 5 dakika için, buz üzerinde INF-suşundan larva ve yetişkin pervane yerleştirin. </li><li> PBS tampon içeren temin bir petri kutusuna larva, yetişkin kadın ve yetişkin erkeklerde bir stereo mikroskop altında aşağıdaki dokuların teşrih. <ol><li> Larvaları, pipet hemolimf ve ön bağırsak, orta bağırsak, kalın barsak, yağ vücut incelemek ve Malpighian tübül (Şekil 1A) için. Hemen sıvı azot içinde tüplere her doku aktarın. <ol><li> Başa yakın bölümler arası zar ve son karın bölümü (Şekil 1A) içine sokulması, iki böcek pimleri (çapı 200 um, uzunluğu 20 mm) kullanılarak cystosepiment donmuş larvaları sabitleyin. </li><li> Larvalar Hemolimf dışarı akar, böylece larva posterior karın bölgesinde proleg kesin. Bir microp kullanılarak 10 saniye içinde larva hemolimf Pipetipette hemolimf esmerleşme ve koagülasyon önlemek için. Not: feniltiyoüre (50 ug / ml) melanization önlemek için hemolimf ile 1:20 hacim / hacim oranında karıştırılabilir. </li><li> bir makas kullanarak, kafasına son bölümler arası zar arasında değişen manikür bir kesi yapmak. iki forseps kullanılarak bir stereo mikroskop altında kalan dokuları teşrih; her bir doku için resim Şekil 1A&#39;da gösterilmiştir. </li><li> tek suret olarak birlikte üç kişi doku örnekleri karıştırın. </li><li> Diseksiyon sırasında hemolimf kalan dokuların kirlenmesini önlemek için, PBS içinde kesilmiş dokuları, üç kez yıkama tamponu. Daha sonra, yıkama için kullanılan PBS HaDV2 enfeksiyon durumunu test. Nihai yıkama tamponu HaDV2 içermeyen ise, doku hemolimf kontaminasyondan temiz olmalıdır. </li></ol></li><li> yetişkin kadın için, kafa (beyin), kaslar, yağ vücut, gut, Malpighian tübüller ve yumurtalık (teşrihPBS tamponu içinde bir stereo mikroskop altında Şekil 1B). Yetişkin erkek için, PBS tamponu içinde bir stereo mikroskop altında kafa (beyin), kaslar, yağ kütlesi, gut, Malpighian tübüller ve testisler (Şekil 1C) incelemek. Hemen sıvı azot içinde tüplere her doku aktarın. <ol><li> forseps ve makas kullanarak, yetişkin güveler kanatlarını çıkarıp ölçekler temizlemek için kalan vücudu üç kez yıkayın. </li><li> makas kullanarak kafa, göğüs kafesi ve karın ayırın. </li><li> Toraks iç iskelet çıkarın ve kas toplamak. </li><li> Forseps kullanarak, karın kütikül kaldırmak ve Şekiller 1B ve 1C, aşağıdaki diğer dokulara incelemek. </li><li> tek suret olarak birlikte üç kişi doku örnekleri karıştırın. PBS içinde kesilmiş dokuları, üç kez yıkama tamponu. </li></ol></li></ol></li><li> bunlar dondurulmuş olan zaman tüpler ve yukarıda dokuları tartılır ve m sağlamakfarklı dokuların eşek hemen hemen eşittir. Kütle (doku) = kütle (tüp / doku örneği) - kütle (tüp için) </li><li> bu dokulardan DNA ekstrakte edilir ve adım 3.1.2 tarif edildiği gibi, qPCR gerçekleştirmek. </li><li> Adım 3.1.1 oluşturulan standart bir eğri kullanılarak her bir doku mg başına kopya sayısını hesaplayın. DNA ekstraksiyonu için kullanılan doku miktarında herhangi bir farktan kaynaklanan örnek önyargı düzeltilmesi için birim kütle başına virüs titresi kullanın. </li><li> aşağıdaki gibi belirli dokularda HaDV2 yüzdesini hesaplayın: HaDV2 yüzdesini her bir doku için = HaDV2 test doku / (bütün dokularda mg&#39;ı başına kopya sayısı toplamı) mg&#39;ı başına kopya sayısı. </li></ol> 5. Biyolojik tayinler Test HaDV2 Etkisi Sunucu Kalkınma <ol><li> Talep en az 100 pupa ya da bir pamuk gazlı bez kaplı, 5 L&#39;lik, tel örgü kafese NONINF-suşundan türetilmiş yeni ortaya çıkan erişkin güveleri. 2 gün sonra, çiftleşmiş yetişkin dişiler pamuk gazlı bez üzerine yumurtalarını bırakmak için başlayacaktır. Toplayın ve bakımıyumurta içeren pamuk tülbent; Yumurtalar yaklaşık üç gün içinde yumurtadan olacaktır. </li><li> HaDV2 ile yeni doğmuş larvalarına aşılanması. <ol><li> INF-gerginlik kurmak için HaDV2 (10 8 kopya sayısı / ml) içeren suni diyetine NONINF-suşu yenidoğan larvalarını aktarın. </li><li> Benzer şekilde, kontrol grubu (NONINF-soyu) kurmak için HaDV2 içermeyen filtrelenmiş sıvı (aşama 2.4) ile kaplanmış suni diyete yeni doğmuş larva aktarın. Her bir tedavi (Şekil 2A), en az 240 larva içerir. Not: Larvalar NONINF- ve INF-bakteri oluşturmak için kullanılan aynı genetik arkaplana sağlanması, aynı zamanda, aynı ana kohort ve kapak türetilir. NONINF- ve INF-suşları gelişme senkron hızı (14 saat aydınlık / 10 saat karanlık ve% 60 bağıl nem ile, 25 ± 1 ° C &#39;de) aynı klima kabini içinde muhafaza emin olun; hızı, sıcaklık ve neme bağlı olarak değişebilir. Deliç Kulpnazikçe larvaları yedi. </li></ol></li><li> 48 saat sonra, 24-gözlü levhalar (oyuk başına bir tek) (Şekil 2B) tek tek larvalar aktarın. <ol><li> Sırayla sayı her her kuyuda larva ve günlük evre evre ve sağkalım durumunu kaydedin. </li><li> Yapay diyet bozulduğunda Yaklaşık 5 gün sonra, aynı anda taze yapay diyet (Şekil 2C) içeren yeni bir 24 plaka için bu kişileri aktarın. </li><li> 0.0001 g hassasiyetle için bir analitik terazi kullanılarak 11 sonrası yumurtadan 7. günde larvaların tartılır. Tartıldıktan sonra, tek tek 24-yuvalı plakaya larva döndürür. </li></ol></li><li> Dördüncü ecdysis sonrası beşinci instar için deri değiştirme sırasında (yaklaşık on gün kuluçkadan çıktıktan sonra), cam tüpler (10 cm yükseklik, 2 cm çapında) (Şekil 2D) Larvalar aktarmak; Beşinci instar larvaları da baş kapsülü (yaklaşık 2.6 mm) genişliği ile tespit edilebilir. NOT: bireyleri aktarınAynı zamanda cam tüpe her gün. <ol><li> Kod boya ya da kalem ile bir cam tüp ile orijinal referans numarası ile her larva. Günlük larva durumunu kaydetme; yaklaşık beş gün-pupa aşaması yaklaşık 11 gün sürer sonra cam tüplerde, larva pupa olacaktır. </li><li> cam tüp içinde her birey için pupa ve eclosion tarihini kaydedin. 3 günlük bir pupa kütlesini kaydedin. </li></ol></li><li> Eclosion sonra,% 10 sakaroz ve% 2 Vitamin çözeltisi (Şekil 2E) ile tek bir kafes içine, bir dişi ve bir erkek koydu. Her gün sukroz çözeltisi yenileyin. Her güve için ölüm tarihini kaydedin. </li><li> yumurta koyulur zaman, günlük pamuklu gazlı bez değiştirin. Hemen yumurtaların sayısını. yumurtadan iken bu yeni doğmuş yavrular sayın. </li><li> Her tedavi HaDV2 enfeksiyon durumunu onaylamak için biyoanalizlere sırasında, rastgele sekiz bireyleri seçin. Ticari tripsin reaktif kullanılarak, bu numunelerin toplam RNA ekstrakteÜreticinin protokolü takip. üreticinin protokolü takiben ilk iplikli cDNA sentezlemek ve virüsler başarıyla transkripsiyonu olup olmadığını test etmek için bir şablon olarak kullanabilirsiniz. </li></ol>

<ol>
	<li>Tang, P., Chiu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metagenomics+for+the+discovery+of+novel+human+viruses.">Metagenomics for the discovery of novel human viruses.</a> Future Microbiol. 5, 177-189 (2010).</li><li>Rosario, K., Breitbart, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+the+viral+world+through+metagenomics.">Exploring the viral world through metagenomics.</a> Curr. Opin. Virol. 1, 289-297 (2011).</li><li>Hugenholtz, P., Tyson, G. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbiology+-+metagenomics.">Microbiology - metagenomics.</a> Nature. 455, 481-483 (2008).</li><li>Kristensen, D. M., Mushegian, A. R., Dolja, V. V., Koonin, E. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+dimensions+of+the+virus+world+discovered+through+metagenomics.">New dimensions of the virus world discovered through metagenomics.</a> Trends Microbiol. 18, 11-19 (2010).</li><li>Kleiner, M., Hooper, L. V., Duerkop, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+methods+to+purify+virus-like+particles+for+metagenomic+sequencing+of+intestinal+viromes.">Evaluation of methods to purify virus-like particles for metagenomic sequencing of intestinal viromes.</a> BMC Genomics. 16, 7 (2015).</li><li>Ho, T., Tzanetakis, I. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+virus+detection+and+discovery+pipeline+using+next+generation+sequencing.">Development of a virus detection and discovery pipeline using next generation sequencing.</a> Virology. 471, 54-60 (2014).</li><li>Marx, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Can+you+sequence+ecology?+Metagenomics+of+adaptive+diversification.">Can you sequence ecology? Metagenomics of adaptive diversification.</a> PLoS Biol. 11, e1001487 (2013).</li><li>Radford, A. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+next-generation+sequencing+technologies+in+virology.">Application of next-generation sequencing technologies in virology.</a> J. Gen. Virol. 93, 1853-1868 (2012).</li><li>Liu, S. J., Chen, Y. T., Bonning, B. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+virus+discovery+in+insects.">RNA virus discovery in insects.</a> Curr. Opin. Insect Sci. 8, 54-61 (2015).</li><li>Mokili, J. L., Rohwer, F., Dutilh, B. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metagenomics+and+future+perspectives+in+virus+discovery.">Metagenomics and future perspectives in virus discovery.</a> Curr. Opin. Virol. 2, 63-77 (2012).</li><li>Liu, S. J., Vijayendran, D., Bonning, B. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next+generation+sequencing+technologies+for+insect+virus+discovery.">Next generation sequencing technologies for insect virus discovery.</a> Viruses-Basel. 3, 1849-1869 (2011).</li><li>Cook, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+virus+discovery+and+genome+reconstruction+from+field+RNA+samples+reveals+highly+divergent+viruses+in+Dipteran+hosts.">Novel virus discovery and genome reconstruction from field RNA samples reveals highly divergent viruses in Dipteran hosts.</a> PLoS ONE. 8, e80720 (2013).</li><li>Webster, C. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+discovery,+distribution,+and+evolution+of+viruses+associated+with+Drosophila+melanogaster.">The discovery, distribution, and evolution of viruses associated with Drosophila melanogaster.</a> PLoS Biol. 13, e1002210 (2015).</li><li>Granberg, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metagenomic+detection+of+viral+pathogens+in+spanish+honeybees:+co-infection+by+aphid+lethal+paralysis,+israel+acute+paralysis+and+lake+sinai+viruses.">Metagenomic detection of viral pathogens in spanish honeybees: co-infection by aphid lethal paralysis, israel acute paralysis and lake sinai viruses.</a> PLoS ONE. 8, e57459 (2013).</li><li>Runckel, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+analysis+of+the+honey+bee+microbiome+reveals+four+novel+viruses+and+seasonal+prevalence+of+known+viruses,+Nosema,+and+Crithidia.">Temporal analysis of the honey bee microbiome reveals four novel viruses and seasonal prevalence of known viruses, Nosema, and Crithidia.</a> PLoS ONE. 6, 20656 (2011).</li><li>Cox-Foster, D. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+metagenomic+survey+of+microbes+in+honey+bee+colony+collapse+disorder.">A metagenomic survey of microbes in honey bee colony collapse disorder.</a> Science. 318, 283-287 (2007).</li><li>Chandler, J. A., Liu, R. M., Bennett, S. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+shotgun+metagenomic+sequencing+of+northern+California+(USA)+mosquitoes+uncovers+viruses,+bacteria,+and+fungi.">RNA shotgun metagenomic sequencing of northern California (USA) mosquitoes uncovers viruses, bacteria, and fungi.</a> Front. Microbiol. 6, 185 (2015).</li><li>Shi, C. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+metagenomic+survey+of+viral+abundance+and+diversity+in+mosquitoes+from+Hubei+province.">A metagenomic survey of viral abundance and diversity in mosquitoes from Hubei province.</a> PLoS ONE. 10, e0129845 (2015).</li><li>Nouri, S., Salem, N., Nigg, J. C., Falk, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diverse+array+of+new+viral+sequences+identified+in+worldwide+populations+of+the+Asian+citrus+psyllid+(Diaphorina+citri)+using+viral+metagenomics.">Diverse array of new viral sequences identified in worldwide populations of the Asian citrus psyllid (Diaphorina citri) using viral metagenomics.</a> J. Virol. 90, 2434-2445 (2016).</li><li>Dayaram, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+diverse+circular+single-stranded+DNA+viruses+in+adult+dragonflies+and+damselflies+(Insecta+Odonata)+of+Arizona+and+Oklahoma,+USA.">Identification of diverse circular single-stranded DNA viruses in adult dragonflies and damselflies (Insecta Odonata) of Arizona and Oklahoma, USA.</a> Infect. Genet. Evol. 30, 278-287 (2015).</li><li>Jakubowska, A. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+occurrence+of+covert+infections+with+small+RNA+viruses+in+the+lepidopteran+Spodoptera+exigua.">Simultaneous occurrence of covert infections with small RNA viruses in the lepidopteran Spodoptera exigua.</a> J.Invert. Pathol. 121, 56-63 (2014).</li><li>Roossinck, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Move+over,+Bacteria!+Viruses+make+their+mark+as+mutualistic+microbial+symbionts.">Move over, Bacteria! Viruses make their mark as mutualistic microbial symbionts.</a> J. Virol. 89, 6532-6535 (2015).</li><li>Ryabov, E. V., Keane, G., Naish, N., Evered, C., Winstanley, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Densovirus+induces+winged+morphs+in+asexual+clones+of+the+rosy+apple+aphid,+Dysaphis+plantaginea.">Densovirus induces winged morphs in asexual clones of the rosy apple aphid, Dysaphis plantaginea.</a> Proc. Natl. Acad. Sci. USA. 106, 8465-8470 (2009).</li><li>Roossinck, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+good+viruses:+viral+mutualistic+symbioses.">The good viruses: viral mutualistic symbioses.</a> Nat. Rev. Microbiol. 9, 99-108 (2011).</li><li>Venkataraman, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure+of+seneca+valley+virus-001:+an+oncolytic+picornavirus+representing+a+new+genus.">Structure of seneca valley virus-001: an oncolytic picornavirus representing a new genus.</a> Structure. 16, 1555-1561 (2008).</li><li>Deterding, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hepatitis+a+virus+infection+suppresses+hepatitis+c+virus+replication+and+may+lead+to+clearance+of+hcv.">Hepatitis a virus infection suppresses hepatitis c virus replication and may lead to clearance of hcv.</a> J. Hepatol. 45, 770-778 (2007).</li><li>Barton, E. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Herpesvirus+latency+confers+symbiotic+protection+from+bacterial+infection.">Herpesvirus latency confers symbiotic protection from bacterial infection.</a> Nature. 447, 326-329 (2007).</li><li>Ponferrada, V. G., Mauck, B. S., Wooley, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+envelope+glycoprotein+of+human+endogenous+retrovirus+herv-w+induces+cellular+resistance+to+spleen+necrosis+virus.">The envelope glycoprotein of human endogenous retrovirus herv-w induces cellular resistance to spleen necrosis virus.</a> Arch. Virol. 148, 659-675 (2003).</li><li>M&#225;rquez, L. M., Redman, R. S., Rodriguez, R. J., Roossinck, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+virus+in+a+fungus+in+a+plant:+three-way+symbiosis+required+for+thermal+tolerance.">A virus in a fungus in a plant: three-way symbiosis required for thermal tolerance.</a> Science. 315, 513-515 (2007).</li><li>Xu, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+genome+sequence+of+a+monosense+densovirus+infecting+the+cotton+bollworm,+Helicoverpa+armigera.">Complete genome sequence of a monosense densovirus infecting the cotton bollworm, Helicoverpa armigera.</a> J. Virol. 86, 10909-10909 (2012).</li><li>Xu, P. J., Liu, Y. Q., Graham, R. I., Wilson, K., Wu, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Densovirus+is+a+mutualistic+symbiont+of+a+global+crop+pest+(Helicoverpa+armigera)+and+protects+against+a+baculovirus+and+Bt+biopesticide.">Densovirus is a mutualistic symbiont of a global crop pest (Helicoverpa armigera) and protects against a baculovirus and Bt biopesticide.</a> PLoS Pathog. 10, e1004490 (2014).</li><li>Liang, G. M., Tan, W. J., Guo, Y. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improvement+in+the+technique+of+arti&#64257;cial+rearing+cotton+bollworm.">An improvement in the technique of arti&#64257;cial rearing cotton bollworm.</a> Plant Protec. 25, 15-17 (1999).</li><li>Zhou, W. G., Rousset, F., O'Neill, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phylogeny+and+PCR-based+classification+of+Wolbachia+strains+using+wsp+gene+sequences.">Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences.</a> P. Roy. Soc. B-Biol. Sci. 265, 509-515 (1998).</li><li>Mondet, F., de Miranda, J. R., Kretzschmar, A., Le Conte, Y., Mercer, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+front+line:+quantitative+virus+dynamics+in+honeybee+(Apis+mellifera+L.)+colonies+along+a+new+expansion+front+of+the+parasite+Varroa+destructor.">On the front line: quantitative virus dynamics in honeybee (Apis mellifera L.) colonies along a new expansion front of the parasite Varroa destructor.</a> PLoS Pathog. 10, e1004323 (2014).</li><li>Chen, Y. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Israeli+acute+paralysis+virus:+epidemiology,+pathogenesis+and+implications+for+honey+bee+health.">Israeli acute paralysis virus: epidemiology, pathogenesis and implications for honey bee health.</a> PLoS Pathog. 10, e1004261 (2014).</li><li>Hunter, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+field+application+of+RNAi+technology+reducing+israeli+acute+paralysis+virus+disease+in+honey+bees+(Apis+mellifera,+Hymenoptera:+Apidae).">Large-scale field application of RNAi technology reducing israeli acute paralysis virus disease in honey bees (Apis mellifera, Hymenoptera: Apidae).</a> PLoS Pathog. 6, e1001160 (2010).</li><li>Halstead, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dengue+virus+-+mosquito+interactions.">Dengue virus - mosquito interactions.</a> Annu. Rev. Entomol. 53, 273-291 (2008).</li><li>Whitfield, A. E., Falk, B. W., Rotenberg, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insect+vector-mediated+transmission+of+plant+viruses.">Insect vector-mediated transmission of plant viruses.</a> Virology. 479-480, 278-289 (2015).</li><li>Moscardi, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessment+of+the+application+of+baculoviruses+for+control+of+Lepidoptera.">Assessment of the application of baculoviruses for control of Lepidoptera.</a> Annu. Rev. Entomol. 44, 257-289 (1999).</li><li>Szelei, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Susceptibility+of+North-American+and+European+crickets+to+Acheta+domesticus+densovirus+(AdDNV)+and+associated+epizootics.">Susceptibility of North-American and European crickets to Acheta domesticus densovirus (AdDNV) and associated epizootics.</a> J. Invert. Pathol. 106, 394-399 (2011).</li></ol>

Yazarlar hiçbir rakip mali çıkarları olduğunu beyan ederim.

Son birkaç on yılda, böcek-virüs etkileşimlerine çoğu çalışma bal arısı sağlığı 34, 35, 36, insan hastalığının 37 vektörler üzerine odaklanmıştır, bitki 38 virüsleri, ve biyolojik kontrol ajanları 39 gibi büyük bir potansiyele sahip bazı böcek patojenik virüsleri. Biraz dikkat, özellikle lepidopteran haşerelere de, böcekle...

Son birkaç on yıl içinde, örneğin yeni nesil sıralama olarak dizileme teknolojisinin gelişmesi (NGS), bir çok yeni bir DNA ve RNA virüsleri, özellikle patojenik olmayan virüs değil, aynı zamanda, daha önce bilinen virüsler, 1, 2, 3 yeni izolat keşfini kolaylaştırmıştır 4, 5, 6, 7, 8, 9, 10, 11, 12. Model organizma Drosophila melanogaster olarak, 20&#39;den fazla yeni kısmi virüs genomları metagenomic teknikleri 13 kullanılarak tespit edilmiştir. yeni virüsler de dahil olmak üzere pek çok viral diziler, aynı zamanda, örneğin bal arıları, m gibi başka böceklere tanımlanmıştırosquitoes, Asya narenciye psyllid, böcekler, ve birden fazla lepidopteran türler 14, 15, 16, 17, 18, 19, 20, 21. Gelecekte, daha yeni virüsler bu gelişmiş teknolojileri kullanarak böceklerin keşfedilen olacağını beklenebilir; dolayısıyla, virüs konak etkileşimin anlayışımız, 9 buna göre 6 değişebilir. Birçok yeni virüsler Mutualistik ortakları ziyade sıkı patojenler 22 olarak tanımlanan ediliyor çünkü Örneğin, virüs konak etkileşimleri, önceden düşünüldüğünden daha karmaşık olduğu kabul edilir. Örneğin, Dysaphis plantaginea içinde Mutualistik densovirüs DplDNV kanatlı Morf indükler ve<html> virüs 23 yanı sıra konağın dağılımı kolaylaştırmak, hareketlilik artar. Ayrıca, Mutualistik virüsler memeli sağlık, kuraklık ve bitkilerin soğuk toleransı ve bakteriyel enfeksiyonların 24 etkisine ilişkin olarak tarif edilmiştir. Seneca vadi virüsü-001 nöroendokrin kanseri 25 sahiptir, tümör hücrelerine karşı seçici sitotoksisiteye aracılık gösterilmiştir. Hepatit A virüsü enfeksiyonları hepatit C virüsü replikasyonunu baskılamak ve hepatit C 26 kurtarma yol açabilir. Herpesvirüs gecikme bakteriyel enfeksiyon 27 simbiyotik koruma sağlamaktadır. Insan endojen retrovirüs HERV-W zarf glikoproteini dalak nekroz virüsü 28 hücresel direnç indükler. bir mantar endofit gelen Curvularia termal tolerans virüsü (CThTV) bu mantar ve tropikal panik çim arasındaki Mutualistik etkileşiminde yer alanref &quot;&gt; 29. Dolayısıyla, yeni bulunan virüsler ve onların ana arasındaki etkileşimlerin bilgisi onların biyoloji ve yönetimi konusunda yeni bakış açıları oluşturmak gerekir. Ancak, yeni virüsler, akut enfeksiyon tipik belirgin belirtisi sergileyen özellikle gizli virüsler, nadiren var been araştırdık ve biz olan ev sahipleri yeni bulunan virüslerin etkilerini araştırmak için bir boru hattı ve protokoller gerekir. Daha önce, pamuk kılıfı kurdu yeşil kurt içinde yaygınlığını yeni monosense densovirüs yeşil kurt densovirüs (HaDV2) bildirilmiştir ve HaDV2 ve pamuk kılıfı kurdu 30, 31 arasında bir Mutualistik ilişkinin kanıtları sundular. Bu yazıda ayrıntılı olarak HaDV2 ve pamuk kurdu konak arasındaki etkileşimi incelemek için laboratuvar protokol anlatacağız. Burada sunulan protokol de r inceleyerek araştırmacıların son derece alakalı olabilirÖzellikle lepidopteran haşerelere de, diğer oral bulaşan virüslerin ole.

<table><tbody><tr><td>24-well plate</td><td>Corning</td><td>07-200-740</td><td>Multiple suppliers available.</td></tr><tr><td>DNA extraction kit</td><td>TIANGEN</td><td>DP304-03</td><td>Multiple suppliers available.</td></tr><tr><td>thermal cycler</td><td>Veriti; Applied Biosystems</td><td>4375786</td><td></td></tr><tr><td>PBS</td><td>Corning</td><td>21-040-CV</td><td></td></tr><tr><td>0.22 &amp;micro;m membrane filter</td><td>Millipore</td><td>SLGS025NB</td><td></td></tr><tr><td>pEASY-T Cloning Vector</td><td>TransGen, Beijing, China</td><td>CT301-02</td><td></td></tr><tr><td>Tweezers</td><td>IDEAL-TEK</td><td>2.SA</td><td></td></tr><tr><td>Premix Ex Taq (Probe qPCR)</td><td>Takara</td><td>RR390A</td><td></td></tr><tr><td>Probes</td><td>Invitrogen</td><td>Custom order</td><td></td></tr><tr><td>Primers</td><td>Invitrogen</td><td>Custom order</td><td></td></tr><tr><td>microspectrophotometry NanoDrop 2000c&amp;nbsp;</td><td>Thermo scientific&amp;nbsp;</td><td>not available</td><td></td></tr><tr><td>7500 Real-Time PCR system</td><td>Applied Biosystems</td><td>not available</td><td></td></tr><tr><td>stereomicroscope SZX-16</td><td>Olympus</td><td>not available</td><td></td></tr><tr><td>sucrose</td><td></td><td></td><td>Multiple suppliers available.</td></tr><tr><td>vitamin complex</td><td></td><td></td><td>Multiple suppliers available.</td></tr></tbody></table>

protocols for investigating the host-tissue distribution, transmission-mode, and effect on the host fitness of a densovirus in the cotton bollworm

Birçok yeni virüsler yeni nesil dizileme teknolojileri kullanarak hayvan konakçılarda keşfedildi. Daha önce, bir lepidopteran türlerde, bir Mutualistik virüsü, yeşil kurt densovirüs (HaDV2) bildirilen, pamuk kurdu, yeşil kurt (Hubner). Burada, şu anda kendi ana bilgisayarda HaDV2 etkisini incelemek için kullanılan protokolleri açıklar. İlk olarak, tek bir üreme çifti bir HaDV2 içermeyen pamuk kurdu kolonisi kurmak. Bir HaDV2 enfekte diğer enfekte olmamış: Daha sonra, ağız yoluyla, aynı genetik arkaplana sahip iki koloniler elde etmek için filtre edilmiş sıvının HaDV2 içeren bazı yeni doğmuş larva yavruları inoküle. HaDV2 konak doku dağılımı ve transmisyon verimi belirlemek için protokoller gibi bir protokolü, sunulan HaDV2 enfekte olmuş ve -uninfected bireyler arasında hayat tablosu parametreleri (örneğin, larva, pupa ve yetişkin dönemleri ve doğurganlığı) karşılaştırmak. Bu protokoller, woULD ayrıca haşere, özellikle lepidopteran ana diğer oral yolla bulaşan virüsler etkilerinin araştırılması için uygun olmaktadır.

HaDV2 içermeyen (Şekil 3A) olan ebeveynlerden dölleri NONINF-suşu olarak yetiştirilir. Başarıyla DNA şablonları kaliteli (Şekil 3B) olduğunu öne süren, aynı DNA şablonları kullanılarak, aktin geni amplifiye edilmiştir. Buna ek olarak, rasgele seçilen sekiz dölleri de HaDV2 (Şekil 3C), HaNPV (Şekil 3D), ve Wolbachia (Şekil 3E) serbest edildi. Yine, aktin g...

Watch this Scientific Journal Video about Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm at JoVE.com

Pamuk Kurdundaki Densovirüsün Konakçı Doku Dağıtımı, İletim Modu ve Konakçı Uygunluğu Üzerindeki Etkisinin Araştırılmasına Yönelik Protokoller | Biyoloji | Video

Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm

Burada, bir lepidopteran tür içindeki bir densovirüs konakçı fitness konak doku dağılımı, iletim modunu ve etkisi, pamuk kurtları araştırmak için bir protokol mevcut. Bu protokol aynı zamanda diğer oral bulaşan virüsler ve bunların haşere arasındaki etkileşimi incelemek için kullanılabilir.

Pamuk Yeşilkurt bir densovirüs Host Fitness Host doku Dağılımı, İletim-modunu ve Etkisi incelenmesi için Protokoller

Many novel viruses have been discovered in animal hosts using next-generation sequencing technologies. Previously, we reported a mutualistic virus, ...

protocols-for-investigating-host-tissue-distribution-transmission

Universidad de Cartagena UDEC

Research

Education

JoVE Journal

JoVE Core

Biology

Immunology and Infection

Genetics

Viruses

SCIENTISTS IN ACTION

8.4K Görüntüleme.  Chinese Academy of Agricultural Sciences.  Burada, bir lepidopteran tür içindeki bir densovirüs konakçı fitness konak doku dağılımı, iletim modunu ve etkisi, pamuk kurtları araştırmak için bir protokol mevcut. Bu protokol aynı zamanda diğer oral bulaşan virüsler ve bunların haşere arasındaki etkileşimi incelemek için kullanılabilir. 

Video: Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm

Protocol for Dengue Infections in Mosquitoes (A. aegypti) and Infection Phenotype Determination

The purpose of this procedure is to infect the Aedes mosquito with dengue virus in a laboratory condition and examine the infection level and dynamic of the virus in the mosquito tissues. This protocol is routinely used for studying mosquito-virus interactions, especially for identification of novel host factors that are able to determine vector competence. The entire experiment must be conducted in a BSL2 laboratory. Similar to Plasmodium falciparum infections, proper attire including gloves and lab coat must be worn at all times. After the experiment, all the materials that came in contact with the virus need to be treated with 75% ethanol and bleached before proceeding with normal washing. All other materials need to be autoclaved before discarding them.

Protocol for Dengue Infections in Mosquitoes A. aegypti and Infection Phenotype Determination

Once a gene is identified as potentially refractory for the dengue virus, it must be evaluated for it's role in preventing viral infections within the mosquito. This protocol illustrates how the extent of dengue infections of mosquitoes can be assayed. The techniques for growing up the virus in culture, membrane feeding mosquitoes human blood, and assaying viral titers in the mosquito midgut are demonstrated.

Dang Enfeksiyonlar Sivrisinekler (A. aegypti) ve Enfeksiyon Fenotip belirlenmesi için protokol

The purpose of this procedure is to infect the Aedes mosquito with dengue virus in a laboratory condition and examine the infection level and dynamic of ...

Biyoloji

Remote Sensing Evaluation of Two-spotted Spider Mite Damage on Greenhouse Cotton

The objective of this study was to evaluate a ground-based multispectral optical sensor as a remote sensing tool to assess foliar damage caused by the two-spotted spider mite (TSSM), Tetranychus urticae Koch, on greenhouse grown cotton. TSSM is a polyphagous pest which occurs on a variety of field and horticultural crops. It often becomes an early season pest of cotton in damaging proportions as opposed to being a late season innocuous pest in the mid-southern United States. Evaluation of acaricides is important for maintaining the efficacy of and preventing resistance to the currently available arsenal of chemicals and newly developed control agents. Enumeration of spider mites for efficacy evaluations is laborious and time consuming. Therefore, subjective visual damage rating is commonly used to assess density of spider mites. The NDVI (Normalized Difference Vegetation Index) is the most widely used statistic to describe the spectral reflectance characteristics of vegetation canopy to assess plant stress and health consequent to spider mite infestations. Results demonstrated that a multispectral optical sensor is an effective tool in distinguishing varying levels of infestation caused by T. urticae on early season cotton. This remote sensing technique may be used in lieu of a visual rating to evaluate insecticide treatments.

This manuscript describes a multispectral optical sensor that effectively detected damage to early season cotton artificially infested with varying densities of the two-spotted spider mite populations.

Sera Pamuk İki benekli Örümcek akarı Hasarın Uzaktan Algılama Değerlendirilmesi

The objective of this study was to evaluate a ground-based multispectral optical sensor as a remote sensing tool to assess foliar damage caused by the ...

Çevre

Methodology for Developing Life Tables for Sessile Insects in the Field Using the Whitefly, Bemisia tabaci, in Cotton As a Model System

Life tables provide a means of measuring the schedules of birth and death from populations over time. They also can be used to quantify the sources and rates of mortality in populations, which has a variety of applications in ecology, including agricultural ecosystems. Horizontal, or cohort-based, life tables provide for the most direct and accurate method of quantifying vital population rates because they follow a group of individuals in a population from birth to death. Here, protocols are presented for conducting and analyzing cohort-based life tables in the field that takes advantage of the sessile nature of the immature life stages of a global insect pest, Bemisia tabaci. Individual insects are located on the underside of cotton leaves and are marked by drawing a small circle around the insect with a non-toxic pen. This insect can then be observed repeatedly over time with the aid of hand lenses to measure development from one stage to the next and to identify stage-specific causes of death associated with natural and introduced mortality forces. Analyses explain how to correctly measure multiple mortality forces that act contemporaneously within each stage and how to use such data to provide meaningful population dynamic metrics. The method does not directly account for adult survival and reproduction, which limits inference to dynamics of immature stages. An example is presented that focused on measuring the impact of bottom-up (plant quality) and top-down (natural enemies) effects on the mortality dynamics of B. tabaci in the cotton system.

Methodology for Developing Life Tables for Sessile Insects in the Field Using the Whitefly, Bemisia tabaci, in Cotton As a Model System

Life tables allow quantification of the sources and rates of mortality in insect populations and contribute to understanding, predicting and manipulating population dynamics in agroecosystems. Methods for conducting and analyzing cohort-based life tables in the field for an insect with sessile immature life stages are presented.

Metodoloji geliştirme yaşam tabloları alanını kullanarak Whitefly, Bemisia tabaci, pamuk gibi bir Model sistemi içinde sesil böcekler için için

Life tables provide a means of measuring the schedules of birth and death from populations over time. They also can be used to quantify the sources and ...

Screening Cotton Genotypes for Reniform Nematode Resistance

A rapid non-destructive reniform nematode (Rotylenchulus reniformis) screening protocol is needed for the development of resistant cotton (Gossypium hirsutum) varieties to improve nematode management. Most protocols involve extracting vermiform nematodes or eggs from the cotton root system or potting soil to determine population density or reproduction rate. These approaches are generally time-consuming with a small number of genotypes evaluated. An alternative approach is described here in which the root system is visually examined for nematode infection. The protocol involves inoculating cotton seedling 7 days after planting with vermiform nematodes and determining the number of females attached to the root system 28 days after inoculation. Data are expressed as the number of females per gram of fresh root weight to adjust for variation in root growth. The protocol provides an excellent method for evaluating host-plant resistance associated with the ability of the nematode to establish an infection site; however, resistance that hinders nematode reproduction is not assessed. As with other screening protocols, variation is commonly observed in nematode infection among individual genotypes within and between experiments. Data are presented to illustrate the range of variation observed using the protocol. To adjust for this variation, control genotypes are included in experiments. Nonetheless, the protocol provides a simple and rapid method to evaluate host-plant resistance. The protocol has been successfully used to identify resistant accessions from the G. arboreum germplasm collection and evaluate segregating populations of more than 300 individuals to determine the genetics of resistance. A vegetative propagation method for recovering plants for resistance breeding was also developed. After removal of the root system for nematode evaluation, the vegetative shoot is replanted to allow the development of a new root system. More than 95% of the shoots typically develop a new root system with plants reaching maturity.

Here, a protocol is presented for the rapid non-destructive screening of cotton genotypes for reniform nematode resistance. The protocol involves visually examining the roots of nematode-infected cotton seedlings to determine infection response. The vegetative shoot from each plant is then propagated to recover plants for seed production.

Reniform Nematode direnci için pamuk Genotürleri eleme

A rapid non-destructive reniform nematode (Rotylenchulus reniformis) screening protocol is needed for the development of resistant cotton (Gossypium ...

Genetik

Rearing and Injection of Manduca sexta Larvae to Assess Bacterial Virulence

Manduca sexta, commonly known as the tobacco hornworm, is considered a significant agricultural pest, feeding on solanaceous plants including tobacco and tomato. The susceptibility of M. sexta larvae to a variety of entomopathogenic bacterial species1-5, as well as the wealth of information available regarding the insect's immune system6-8, and the pending genome sequence9 make it a good model organism for use in studying host-microbe interactions during pathogenesis. In addition, M. sexta larvae are relatively large and easy to manipulate and maintain in the laboratory relative to other susceptible insect species. Their large size also facilitates efficient tissue/hemolymph extraction for analysis of the host response to infection.
The method presented here describes the direct injection of bacteria into the hemocoel (blood cavity) of M. sexta larvae. This approach can be used to analyze and compare the virulence characteristics of various bacterial species, strains, or mutants by simply monitoring the time to insect death after injection. This method was developed to study the pathogenicity of Xenorhabdus and Photorhabdus species, which typically associate with nematode vectors as a means to gain entry into the insect. Entomopathogenic nematodes typically infect larvae via natural digestive or respiratory openings, and release their symbiotic bacterial contents into the insect hemolymph (blood) shortly thereafter10. The injection method described here bypasses the need for a nematode vector, thus uncoupling the effects of bacteria and nematode on the insect. This method allows for accurate enumeration of infectious material (cells or protein) within the inoculum, which is not possible using other existing methods for analyzing entomopathogenesis, including nicking11 and oral toxicity assays12. Also, oral toxicity assays address the virulence of secreted toxins introduced into the digestive system of larvae, whereas the direct injection method addresses the virulence of whole-cell inocula.
The utility of the direct injection method as described here is to analyze bacterial pathogenesis by monitoring insect mortality. However, this method can easily be expanded for use in studying the effects of infection on the M. sexta immune system. The insect responds to infection via both humoral and cellular responses. The humoral response includes recognition of bacterial-associated patterns and subsequent production of various antimicrobial peptides7; the expression of genes encoding these peptides can be monitored subsequent to direct infection via RNA extraction and quantitative PCR13. The cellular response to infection involves nodulation, encapsulation, and phagocytosis of infectious agents by hemocytes6. To analyze these responses, injected insects can be dissected and visualized by microscopy13, 14.

Rearing and Injection of Manduca sexta Larvae to Assess Bacterial Virulence

The method described here utilizes direct injection of entomopathogenic bacteria into the hemocoel of Manduca sexta insect larvae. M. sexta is a commercially available and well-studied insect. Thus, this method represents a simple approach to analyzing host-bacterial interactions from the perspective of one or both partners.

Ve Yetiştirme ve Enjeksiyon<em&gt; Manduca Sexta</emBakteriyel virülans Değerlendirememesi&gt; Larva

Manduca sexta, commonly known as the tobacco hornworm, is considered a significant agricultural pest, feeding on solanaceous plants including tobacco and ...

İmmünoloji ve Enfeksiyon

Use of a Recombinant Mosquito Densovirus As a Gene Delivery Vector for the Functional Analysis of Genes in Mosquito Larvae

In vivo microinjection is the most commonly used gene transfer technique for analyzing the gene functions in individual mosquitoes. However, this method requires a more technically demanding operation and involves complicated procedures, especially when used in larvae due to their small size, relatively thin and fragile cuticle, and high mortality, which limit its application. In contrast, viral vectors for gene delivery have been developed to surmount extracellular and intracellular barriers. These systems have the advantages of easy manipulation, high gene transduction efficiency, long-term maintenance of gene expression, and the ability to produce persistent effects in vivo. Mosquito densoviruses (MDVs) are mosquito-specific, small single-stranded DNA viruses that can effectively deliver foreign nucleic acids into mosquito cells; however, the replacement or insertion of foreign genes to create recombinant viruses typically causes a loss of packaging and/or replication abilities, which is a barrier to the development of these viruses as delivery vectors.
Herein, we report using an artificial intronic small-RNA expression strategy to develop a non-defective recombinant Aedes aegypti densovirus (AaeDV) in vivo delivery system. Detailed procedures for the construction, packaging and quantitative analysis of the rAaeDV vectors, and for larval infection are described.
This study demonstrates, for the first time, the feasibility of developing a non-defective recombinant MDV micro RNA (miRNA) expression system, and thus providing a powerful tool for the functional analysis of genes in mosquito and establishing a basis for the application of viral paratransgenesis for controlling mosquito-borne diseases. We demonstrated that Aedes albopictus 1st instar larvae could be easily and effectively infected by introducing the virus into the water body of the larvae breeding site and that the developed rAaeDVs could be used to overexpress or knock down the expression of a specific target gene in larvae, providing a tool for the functional analysis of mosquito genes.

We report using an artificial intronic small RNA expression strategy to develop a non-defective recombinant Aedes aegypti densovirus (AaeDV) in vivo delivery system. A detailed procedure for the construction, packaging, and quantitative analysis of the rAaeDV vectors as well as for larval infection is described.

Sivrisinek larva genlerin fonksiyonel analiz için bir gen teslim vektör olarak rekombinant sivrisinek Densovirus kullanın

In vivo microinjection is the most commonly used gene transfer technique for analyzing the gene functions in individual mosquitoes. However, this method ...

Gelişim Biyolojisi

Fluorescence in situ Hybridizations (FISH) for the Localization of Viruses and Endosymbiotic Bacteria in Plant and Insect Tissues

Fluorescence in situ hybridization (FISH) is a name given to a variety of techniques commonly used for visualizing gene transcripts in eukaryotic cells and can be further modified to visualize other components in the cell such as infection with viruses and bacteria. Spatial localization and visualization of viruses and bacteria during the infection process is an essential step that complements expression profiling experiments such as microarrays and RNAseq in response to different stimuli. Understanding the spatiotemporal infections with these agents complements biological experiments aimed at understanding their interaction with cellular components. Several techniques for visualizing viruses and bacteria such as reporter gene systems or immunohistochemical methods are time-consuming, and some are limited to work with model organisms&#160;and involve complex methodologies. FISH that targets RNA or DNA species in the cell is a relatively easy and fast method for studying spatiotemporal localization of genes and for diagnostic purposes. This method can be robust and relatively easy to implement when the protocols employ short hybridizing, commercially-purchased probes, which are not expensive. This is particularly robust when sample preparation, fixation, hybridization, and microscopic visualization do not involve complex steps. Here we describe a protocol for localization of bacteria and viruses in insect and plant tissues. The method is based on simple preparation, fixation, and hybridization of insect whole mounts and dissected organs or hand-made plant sections, with 20 base pairs short DNA probes conjugated to fluorescent dyes on their 5&#39; or 3&#39; ends. This protocol has been successfully applied to a number of insect and plant tissues, and can be used to analyze expression of mRNAs or other RNA or DNA species in the cell.

Fluorescence in situ Hybridizations FISH for the Localization of Viruses and Endosymbiotic Bacteria in Plant and Insect Tissues

We describe here a simple fluorescence in situ hybridization (FISH) method for the localization of viruses and bacteria in insect and plant tissues. This protocol can be extended for the visualization of mRNA in whole mount and microscopic sections.

Floresan<em&gt; In situ</emVirüsler ve Bitki ve Böcek Dokularda Endosimbiyotik Bakterilerin lokalizasyonu&gt; Hibritlemeler (FISH)

Fluorescence in situ hybridization (FISH) is a name given to a variety of techniques commonly used for visualizing gene transcripts in eukaryotic cells ...

Agrobacterium-Mediated Virus-Induced Gene Silencing Assay In Cotton

Cotton (Gossypium hirsutum) is one of the most important crops worldwide. Considerable efforts have been made on molecular breeding of new varieties. The large-scale gene functional analysis in cotton has been lagged behind most of the modern plant species, likely due to its large size of genome, gene duplication and polyploidy, long growth cycle and recalcitrance to genetic transformation1. To facilitate high throughput functional genetic/genomic study in cotton, we attempt to develop rapid and efficient transient assays to assess cotton gene functions.
Virus-Induced Gene Silencing (VIGS) is a powerful technique that was developed based on the host Post-Transcriptional Gene Silencing (PTGS) to repress viral proliferation2,3. Agrobacterium-mediated VIGS has been successfully applied in a wide range of dicots species such as Solanaceae, Arabidopsis and legume species, and monocots species including barley, wheat and maize, for various functional genomic studies3,4. As this rapid and efficient approach avoids plant transformation and overcomes functional redundancy, it is particularly attractive and suitable for functional genomic study in crop species like cotton not amenable for transformation.
In this study, we report the detailed protocol of Agrobacterium-mediated VIGS system in cotton. Among the several viral VIGS vectors, the tobacco rattle virus (TRV) invades a wide range of hosts and is able to spread vigorously throughout the entire plant yet produce mild symptoms on the hosts5. To monitor the silencing efficiency, GrCLA1, a homolog gene of Arabidopsis Cloroplastos alterados 1 gene (AtCLA1) in cotton, has been cloned and inserted into the VIGS binary vector pYL156. CLA1 gene is involved in chloroplast development6, and previous studies have shown that loss-of-function of AtCLA1 resulted in an albino phenotype on true leaves7, providing an excellent visual marker for silencing efficiency. At approximately two weeks post Agrobacterium infiltration, the albino phenotype started to appear on the true leaves, with 100% silencing efficiency in all replicated experiments. The silencing of endogenous gene expression was also confirmed by RT-PCR analysis. Significantly, silencing could potently occur in all the cultivars we tested, including various commercially grown varieties in Texas. This rapid and efficient Agrobacterium-mediated VIGS assay provides a very powerful tool for rapid large-scale analysis of gene functions at genome-wide level in cotton.

We present the detailed protocol for Agrobacterium-mediated virus-induced gene silencing (VIGS) assay in cotton. The tobacco rattle virus (TRV)-derived VIGS vectors were deployed to induce RNA silencing of cotton GrCLA1, Cloroplastos alterados 1 gene. The albino phenotype caused by silencing GrCLA1 was observed at the seedling stage within 2 weeks after inoculation.

Pamuk olarak Agrobacterium Virüs Bağlı Gen susturma Testi

Cotton (Gossypium hirsutum) is one of the most important crops worldwide. Considerable efforts have been made on molecular breeding of new varieties.  The ...

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our knowledge of prevention and treatment of viral infection. The fruit fly Drosophila melanogaster has proven to be one of the most efficient and productive model organisms to screen for antiviral factors and investigate virus-host interaction, due to powerful genetic tools and highly conserved innate immune signaling pathways. The procedure described here demonstrates a nano-injection method to establish viral infection and induce systemic antiviral responses in adult flies. The precise control of the viral injection dose in this method enables high experimental reproducibility. Protocols described in this study include the preparation of flies and the virus, the injection method, survival rate analysis, the virus load measurement, and an antiviral pathway assessment. The influence effects of viral infection by the flies' background were mentioned here. This infection method is easy to perform and quantitatively repeatable; it can be applied to screen for host/viral factors involved in virus-host interaction and to dissect the crosstalk between innate immune signaling and other biological pathways in response to viral infection.

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

This protocol describes how to establish viral infection in vivo in Drosophila melanogaster using the nano-injection method and basic techniques to analyze virus-host interaction.

Viral enfeksiyon ve analiz Drosophila Melanogaster ana bilgisayar virüs etkileşimin kurulması

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our ...

Transmitting Plant Viruses Using Whiteflies

Whiteflies, Hemiptera: Aleyrodidae, Bemisia tabaci, a complex of morphologically indistinquishable species5, are vectors of many plant viruses. Several genera of these whitefly-transmitted plant viruses (Begomovirus, Carlavirus, Crinivirus, Ipomovirus, Torradovirus) include several hundred species of emerging and economically significant pathogens of important food and fiber crops (reviewed by9,10,16). These viruses do not replicate in their vector but nevertheless are moved readily from plant to plant by the adult whitefly by various means (reviewed by2,6,7,9,10,11,17). For most of these viruses whitefly feeding is required for acquisition and inoculation, while for others only probing is required. Many of these viruses are unable or cannot be easily transmitted by other means. Therefore maintenance of virus cultures, biological and molecular characterization (identification of host range and symptoms)3,13, ecology2,12, require that the viruses be transmitted to experimental hosts using the whitefly vector. In addition the development of new approaches to management, such as evaluation of new chemicals14 or compounds15, new cultural approaches1,4,19, or the selection and development of resistant cultivars7,8,18, requires the use of whiteflies for virus transmission. The use of whitefly transmission of plant viruses for the selection and development of resistant cultivars in breeding programs is particularly challenging7. Effective selection and screening for resistance employs large numbers of plants and there is a need for 100% of the plants to be inoculated in order to find the few genotypes which possess resistance genes. These studies use very large numbers of viruliferous whiteflies, often several times per year.
Whitefly maintenance described here can generate hundreds or thousands of adult whiteflies on plants each week, year round, without the contamination of other plant viruses. Plants free of both whiteflies and virus must be produced to introduce into the whitefly colony each week. Whitefly cultures must be kept free of whitefly pathogens, parasites, and parasitoids that can reduce whitefly populations and/or reduce the transmission efficiency of the virus. Colonies produced in the manner described can be quickly scaled to increase or decrease population numbers as needed, and can be adjusted to accommodate the feeding preferences of the whitefly based on the plant host of the virus.
There are two basic types of whitefly colonies that can be maintained: a nonviruliferous and a viruliferous whitefly colony. The nonviruliferous colony is composed of whiteflies reared on virus-free plants and allows the weekly availability of whiteflies which can be used to transmit viruses from different cultures. The viruliferous whitefly colony, composed of whiteflies reared on virus-infected plants, allows weekly availability of whiteflies which have acquired the virus thus omitting one step in the virus transmission process.

Improving our understanding of and our ability to manage many of the insect-transmitted plant viruses requires the use of the vector. Insect transmission of plant viruses is a tritrophic interaction, and as such requires the manipulation of insects, virus, and plant. Vectors must be reared in large numbers and manipulated in such a way as to insure high rates of transmission to test plants. The basics of rearing and manipulating the whitefly, Bemisa tabaci (Hemiptera: Aleyrodidae), a vector of plant viruses belonging to several emerging plant virus genera, representing a large number of economically significant viruses is presented.

Whiteflies kullanarak Verici Bitki Virüsler

Whiteflies, Hemiptera: Aleyrodidae, Bemisia tabaci, a complex of morphologically indistinquishable species5, are vectors of many plant viruses. Several ...

Pamuk Yeşilkurt bir densovirüs Host Fitness Host doku Dağılımı, İletim-modunu ve Etkisi incelenmesi için Protokoller

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler