Biz, anti-PD-L1 bloke antikorun sağlanması ve kullanılması için Gordon Freeman ederiz. Biz Massachusetts General Hospital ve bu projede onların değerli rolü için tüm katılımcıların de klinik ve laboratuar çalışanlarına teşekkür ederiz. , Ulusal Kalp Akciğer ve Sağlık Ulusal Enstitüleri Kan Enstitüsü (RO1 HL-092.565, DEK); Bu çalışma Ulusal Alerji Enstitüsü ve Sağlık Ulusal Enstitüsü (DEK PO1 AI-080192) Enfeksiyon Hastalıkları tarafından desteklenmiştir. DEK Quebec Sağlığı Araştırma Fonu Araştırmacı Kariyer Ödülü (FRQS) tarafından desteklenmektedir. FP Araştırma ve Harvard Küresel Sağlık Enstitüsü (HGHI) üzerine Massachusetts General Hospital İcra Komitesi burs hibe ile desteklenmektedir.

1.. Ficoll ayırma yoluyla tükenmesi ve PBMC&#39;lerin izolasyonu <ol><li> Tam kan, 50 ul / ml &#39;de insan CD8 + tükenmesi kokteyli eklenerek CD8 + T hücrelerinin tüketilmesi. </li><li> İyice karıştırın ve oda sıcaklığında (18-25 ° C) &#39;de 20 dakika boyunca inkübe edin. </li><li> İnkübasyondan sonra, (Ca2 + veya Mg2 + olmaksızın Hank Dengeli Tuz Çözeltisi) HBSS ile tam kan karıştırın ve Histopaque fazla tabaka. 30 dakika (hiçbir fren, yavaş hızlanma) için 340 RCF Spin. </li><li> PBMC&#39;Ierde toplamak ve yeni bir 50ml konik transfer. 340 RCF 10 dakika boyunca iplik 50 IU Penisilin, 50 | ig / ml streptomisin, 2 mM L-glutamin ve% 1 HEPES ile takviye edilmiş 45 ml RPMI 1640 ile yıkayın 2x. </li></ol> 2. Antikor Blockade ve Hücreler antijen-spesifik uyarım <ol><li> 50 IU Penisilin, 50 | ig / ml streptomisin, 2 mM L-glutamin ve% 1 HEPES ile takviye edilmiş,% 10 insan serumu ihtiva eden RPMI 1640 içinde durum başına 2x10-6 yeniden süspanse hücre,durum başına 500 ul için muhasebe. </li><li> FACS tüp başına hücre süspansiyonu kısım 500 ul. </li><li> Incelenen yolu bağlı olarak, PD-L1, 10 ug / ml &#39;de antikorlar ve / veya izotip kontrolleri IL-bloke 10Rα ekleyin ve 37 ° C,% 5 CO2 de 15 dakika boyunca inkübe edin. </li><li> 1 ug / ml / peptid nihai konsantrasyonda, bir HIV-1 Gag peptidi havuzlu hücreleri uyarır. Ayrıca, her bir durum için bir bloke &quot;no uyarım&quot; kontrolü içerir. 37 ° C, 48 saat boyunca% 5 CO2 ile inkübe edin. </li></ol> 3. Toplama ve süpernatanı üzerinde yapılan analiz <ol><li> 48 saat sonra, 340 rcf 7 dakika FACS tüpler aşağı spin. </li><li> Dikkatle pelet bozmadan Luminex boncuk dizileri için Eppendorf tüpleri 2 x 225 ul süpernatant toplamak. </li><li> % 0.05 PBS-Tween bir son konsantrasyon vermek üzere 25 ul% 0.5 &#39;lik PBS-Tween ile toplanan süpernatan içinde virüs etkisiz hale getirirler. </li><li> Immed değildir Mağazası toplanan süpernatanlanVakit kaybetmeden bir -80 ° C derin dondurucuda kullanılabilir. </li><li> Üreticinin protokolüne göre Millipore Luminex kiti kullanılarak istenen sitokin konsantrasyonları ölçün. </li></ol> 4. Sitometrisi yoluyla Toplama ve Hücre Fenotipik Analizi <ol><li> Süpernatant topladıktan sonra, 3 ml PBS içinde hücreleri yıkayın. 340 rcf 7 dakika hücreleri Spin ve aşırı yıkama süzün. </li><li> Üreticinin protokolüne göre bir DEAD tamir edilebilir / CANLI Ölü Hücre Leke Kit kullanarak canlılığı için leke. </li><li> 340 RCF ve 4 ° C &#39;de, 7 dakika boyunca PBS içinde hücreler yıkayın 100 ul PBS% 1 FBS içinde süspanse edin. </li><li> FcR reaktifi ve karıştırmak için girdap bloke 1.4 ul ekleyerek, monositler veya başka antijen sunan hücreler, blok Fc reseptörleri için boyama durumunda. </li><li> 4 ° C&#39;de 10 dakika boyunca inkübe </li><li> Yüzey antikorlar, vorteks ekleyin ve karanlıkta 4 ° C&#39;de 20 dakika boyunca inkübe edin. </li><li> , PBS,% 1 FBS hücreleri yıkayın fazla yıkama süzün ve 200 ul% 4 paraformaldehid ekleyin. Kuluçkaya yatmakKaranlıkta 20 dakika boyunca oda sıcaklığında karıştırıldı. </li><li> 250 ul PBS,% 1 FBS içinde PBS,% 1 FBS, tekrar süspansiyon hücreleri yıkayın ve bir akış sitometresi üzerinde elde MULTILASER (örneğin BD LSRII veya Fortessa). </li></ol> 5. QRT-PCR ile analiz Hücrelerinin <ol><li> Hücreleri için akış sitometri ile analiz değil: yüzer toplama sonra,% 1 beta-merkaptotanol içeren 300 ul Oiagen Tampon RLT içinde lyse hücreler. Protokolü ile devam değilse, hücreler bu noktadan sonra -80 ° C &#39;de dondurulabilir. </li><li> Üreticinin protokolü takip edilerek, bir RNA izolasyon kiti kullanarak, RNA izole edilir. </li><li> Üreticinin protokolü takip edilerek, bir cDNA sentez kiti kullanılarak RNA&#39;dan cDNA sentez. </li><li> SYBR Green teknolojisi kullanılarak kantitatif PCR gerçekleştirin. </li><li> 10 uM&#39;lik nihai bir konsantrasyon vermek üzere su içermeyen nükleaz primerlerin eklenmesiyle hazırlık geninin (örneğin, IL-13, IL-10, IFN-γ, GAPDH) dahil olmak üzere, kullanılan her bir primer için bir primer karışımını oluşturmakuM. Buz üzerinde tutmak. </li><li> 10,5 ul nükleazsız su, 12.5 ul SYBR yeşil ve plaka başına 1 ul primer karışımı ekleyerek her primer için bir ana karışımı oluşturun. Buz üzerinde tutmak. </li><li> Kullanılacak, plakanın her oyuğuna pipetle 24 ul ana karışımı. </li><li> Şablona göre her kuyuya 1 ul cDNA ekleyin. </li><li> 800 rcf 3 dakika boyunca kuyu ve santrifüj plaka Cap. </li><li> Bir Mah-PCR makinesi, örneğin bir Stratagene MX3005P enstrüman üzerinde plakayı. </li></ol> 6. 48 saat sonra hücre içi sitokin boyama için İntibak Brefeldin ve Monensin önce hücre içi sitokin boyama 6 saat ekleyin. Monensin, üreticinin talimatlarına uygun olarak ilave edilirken Brefeldin 10 ug / ml &#39;lik bir konsantrasyonda ilave edilir. Kolaylık sağlamak için, Brefeldin 5 ug / ml &#39;lik bir konsantrasyonda leke önce 12 saat eklenebilir. <ol><li> Yüzey leke sonra, en çok PBS% 1 FBS ve leke ile yıkama hücreleriIL-12, IFN-γ, ve bir tespit / Permeabilization Solution kiti ve protokol kullanılarak TNF-α gibi ekstrasellüler sitokinler. </li><li> 250 ul PBS,% 1 FBS içinde hücreler tekrar süspansiyon yıkayın ve (örneğin, BD LSR II veya Fortessa) akış sitometresi bir MULTILASER çalışır. </li></ol> 7. Hücreleri Ayırma adaptasyon <ol><li> Canlılığı için stimülasyon, leke sonra 16 saat üreticinin protokolüne göre / CANLI ÖLÜ tamir edilebilir Ölü Hücre Leke Kit kullanarak. Tüm işlem sırasında hücreleri buz üzerinde tutun. </li><li> 340 RCF ve 4 ° C &#39;de, 7 dakika boyunca PBS ile yıkayın hücrelerin 100 ul PBS% 1 FBS içinde süspanse edin. </li><li> Karıştırmak için yüzey antikorlar, vorteks ekleyin ve 20 dakika boyunca karanlıkta buz üzerinde hücrelerin inkübe edilir. </li><li> 340 RCF ve 4 ° C&#39;de PBS,% 1 FBS ile yıkanır ve hücreler tekrar süspansiyon 500 ul% 10 Fetal Bovine Serum ihtiva eden soğuk RPMI 1640 50 IU Penisilin, 50 | ig / ml streptomisin, 2 mM L-glutamin ve% 1 ile desteklenmiş hepes. </li><li> 5 ml polistiro kullanılarak Filtre hücreleriHücre-Süzgeç kapaklı rene Yuvarlak Dipli Tube. </li><li> Fetal Bovine Serum 50 IU Penisilin, 50 | ig / ml streptomisin, 2 mM L-glutamin, ve her bir tüpe,% 1 HEPES ile takviye edilmiş% 10 ihtiva eden 200 | il RPMI 1640 eklenmesi ile bir tür toplama tüpleri hazırlayın. Sıralama sırasında buz üzerinde tüm tüpler tutun. </li><li> Canlı bir enstrüman biyozararli malzeme için donanımlı bir tesiste bulunan (örn. BD FACS Aria II) faiz hücre alt sıralamak. </li><li> Hücreler kriteri edildikten sonra, geriye zaman istenilen miktarda inkübatör ve yüzer toplama / Luminex analizi ve hücre topağı toplama / PCR analizi ile takip yer hücreleri. </li></ol>

<ol>
	<li>Zajac, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+immune+evasion+due+to+persistence+of+activated+T+cells+without+effector+function.">Viral immune evasion due to persistence of activated T cells without effector function.</a> J. Exp. Med. 188, 2205-2213 (1998).</li><li>Wherry, E. J., Blattman, J. N., Murali-Krishna, K., vander Most, R., Ahmed, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+persistence+alters+CD8+T-cell+immunodominance+and+tissue+distribution+and+results+in+distinct+stages+of+functional+impairment.">Viral persistence alters CD8 T-cell immunodominance and tissue distribution and results in distinct stages of functional impairment.</a> J. Virol. 77, 4911-4927 (2003).</li><li>Kwon, D. S., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+and+detrimental+roles+of+IL-10+in+HIV+pathogenesis.">Protective and detrimental roles of IL-10 in HIV pathogenesis.</a> Eur. Cytokine Netw. 21, 208-214 (2010).</li><li>Porichis, F., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+PD-1+in+HIV+pathogenesis+and+as+target+for+therapy.">Role of PD-1 in HIV pathogenesis and as target for therapy.</a> Curr. HIV/AIDS Rep. 9, 81-90 (2012).</li><li>Wherry, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cell+exhaustion.">T cell exhaustion.</a> Nat. 12, 492-499 (2011).</li><li>Trautmann, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Upregulation+of+PD-1+expression+on+HIV-specific+CD8++T+cells+leads+to+reversible+immune+dysfunction.">Upregulation of PD-1 expression on HIV-specific CD8+ T cells leads to reversible immune dysfunction.</a> Nat. Med. 12, 1198-1202 (2006).</li><li>Day, C. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+expression+on+HIV-specific+T+cells+is+associated+with+T-cell+exhaustion+and+disease+progression.">PD-1 expression on HIV-specific T cells is associated with T-cell exhaustion and disease progression.</a> Nature. 443, 350-354 (2006).</li><li>Brockman, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-10+is+up-regulated+in+multiple+cell+types+during+viremic+HIV+infection+and+reversibly+inhibits+virus-specific+T+cells.">IL-10 is up-regulated in multiple cell types during viremic HIV infection and reversibly inhibits virus-specific T cells.</a> Blood. 114, 346-356 (2009).</li><li>Barber, D. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restoring+function+in+exhausted+CD8+T+cells+during+chronic+viral+infection.">Restoring function in exhausted CD8 T cells during chronic viral infection.</a> Nature. 439, 682-687 (2006).</li><li>Zhang, J. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+up-regulation+is+correlated+with+HIV-specific+memory+CD8++T-cell+exhaustion+in+typical+progressors+but+not+in+long-term+nonprogressors.">PD-1 up-regulation is correlated with HIV-specific memory CD8+ T-cell exhaustion in typical progressors but not in long-term nonprogressors.</a> Blood. 109, 4671-4678 (2007).</li><li>Ndhlovu, Z. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-dimensional+immunomonitoring+models+of+HIV-1-specific+CD8+T-cell+responses+accurately+identify+subjects+achieving+spontaneous+viral+control.">High-dimensional immunomonitoring models of HIV-1-specific CD8 T-cell responses accurately identify subjects achieving spontaneous viral control.</a> Blood. 121, 801-811 (2013).</li><li>Porichis, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Responsiveness+of+HIV-specific+CD4+T+cells+to+PD-1+blockade.">Responsiveness of HIV-specific CD4 T cells to PD-1 blockade.</a> Blood. 118, 965-974 (2011).</li><li>Kwon, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD4++CD25++regulatory+T+cells+impair+HIV-1-specific+CD4+T+cell+responses+by+upregulating+interleukin-10+production+in+monocytes.">CD4+ CD25+ regulatory T cells impair HIV-1-specific CD4 T cell responses by upregulating interleukin-10 production in monocytes.</a> 86, 6586-6594 (2012).</li></ol>

Yazarlar, hiçbir rakip mali çıkarlarını olmadığını beyan ederim.

Supernatant koleksiyonu bu deneysel tasarım bir zorunluluk parçasıdır. Luminex deneyi için süpernatantlar hasat zaman, tam bölünen miktarları yapılan ve donma-erime döngüleri nedeniyle protein bozulmasını önlemek için -80 ° C&#39;de tutuldu. Dondurma ve eritme proteinler için ve dondurularak çözülür en aza indirerek sert işlemler olabilir, sinyal deneylerde maksimize edilir. Bu nedenle, bu kez aynı sayıda dondurularak çözülmüş edilmiş alikotlarından çalışırken, tekrarlanabilir ve daha...

Kalıcı viral enfeksiyonlar esnasında, virüs spesifik T-hücreleri, T hücresi bitkinlik olarak bilinen bir işlem fonksiyonel kusurlar kazanır. Erken kronik viral enfeksiyonun LCMV murin modelinde in vivo çalışmalarda tükenmiş virüs spesifik T hücreleri, viral yönden enfekte edilmiş hücrelere karşı sitolitik fonksiyon düşük çoğalma yeteneğini kaybeder ve bu IL-2, TNF-a gibi sitokinler üretmek için kapasitesi düşük olduğunu göstermiştir α ve 1,2 IFN-γ. Örneğin PD-1 ve IL-10 gibi bağışıklık yolların, karmaşık bir ağ, kronik enfeksiyonlar sırasında yukarı düzenlenen ve (3,4 gözden) T hücre fonksiyon bozukluğuna katkıda bulunur. Olarak, LCMV fare Bu engelleyici yolların karşı bloke edici antikor vivo tatbikat model T hücresi tükenme (5 gözden), kısmen geri fenomen olduğunu gösteren, tükenmiş virüs spesifik T hücrelerinin fonksiyonunu ve gelişmiş viral açıklık geri. Th BulgularE LCMV modeli hızlı bir şekilde HBV, HCV ve HIV 5 gibi insan kronik viral enfeksiyonların uzatıldı. Kronik HIV-1 enfeksiyonunda, PD-1 ve IL-10 yollar enfekte olmuş kişilerde yukarı regüle edilir ve CD4 ile ters viral yük ve doğrudan, hastalığın ilerlemesi parametreleri ile ilişkili 6-8 sayılır. LCMV fare modeline benzer, insanlardaki T hücresi tükenme, kısmen geri olgudur belirten HIV spesifik CD4 ve CD8 T hücrelerinin in vitro çoğalması geri PD-1 ya da IL-10 yollarının antikor blokajı. Bununla birlikte, hassas insan örnekleri üzerinde deneyler doğa hem de in vitro deneyleri, bu girişimlerin elde fonksiyonel restorasyon profillerin ayrıntılı soruşturma duyarlılığında sınırlamalar nedeniyle çarpıcı yoktur. Çoğalma deneyleri, bugüne kadar, çoğu çalışmalarda test tek güvenilir in vitro deney olmuştur, ancak bu Inter etkisi üzerine kanıt dikkate değer bir eksikliği varon VENTIONS: sitotoksik T hücrelerinin 1) öldürme kapasitesi, 2) viral replikasyonu üzerindeki T hücrelerinin antiviral etkisi, 3) sitokin sekresyon profili ve diğer hücre alt-gruplarla ilgili CD4 T hücresi yardımıyla 4) etkisi. Hücre içi sitokin boyama (ICS) bir çok yararlı ve yaygın olarak kullanılan bir akım farelerde ve insanlarda hem de çeşitli hücre tiplerinde sitokinlerin üretimini tespit etmek için kullanılır sitometrisi göre deneyidir. Ayrıca inhibitör yollarının antikor ablukasının etkisini araştırmak için kullanılır olmuştur. ICS deneylerinde, sitokin salgılama Brefeldin ve / veya Monensin ilavesiyle engellenir. Hücrelerin içinde sıkışıp sitokinler sonra çok renkli akış sitometrisi kullanılarak floresan antikorlar ile tespit edilir. Tipik olarak antijen ilave 2 saat içinde ilave edilir ve Brefeldin Monensin, hem de hücreler için toksik olmasından dolayı, tahlilin süresi genellikle antijen stimülasyonu sonrası 6 veya 12 saat ile sınırlıdır. ICS deney yararlı i olmuştur güçlü bir tekniktirn hücreleri, antikor maruz 9 sonra belli bir süre sonra ekstre edildi farelerde antikor müdahale bloke in vivo etkisinin araştırılması. Bununla birlikte, insan örneklerinde inhibitör reseptörlerin blokajı etkisini değerlendirmek için bu deneysel yaklaşımın uygulanması için çeşitli sınırlamalar vardır. In vitro olarak, bir 6 ya da 12 saat stimülasyonu (insan örnekleri tipik durum) &#39;de önleyici bir yollarının antikor müdahaleler gerçekleştirirken, standart ICS deneyleri ile ölçüldüğü haliyle, çoğu durumda önleyici reseptörlerinin blokajı antijen-spesifik T hücrelerinin yanıt sıklığını değiştirmez 6, 7. Ortalama yoğunluğu ya da ortalama floresan ile ölçülen hücre başına sitokin üretiminin ölçümü tutarsız sonuçlar 6, 7, 10, verdik. Öte yandan, ICS sonra geç bir zaman noktasında gerçekleştirildiğinde stimülasyonu (yani altı gün), sitokin salgılayan c sayısındaki değişimlerarşın gözlenebilir. Farklılıklar değiştirilmiş çoğalma, hayatta kalma ve zaman 6&#39;daki belirtilen süre boyunca birikir efektör fonksiyonu değişiklikleri, bir kombine etkisi vardır. Kısmen, bu sınırlılıkların üstesinden gelmek için bir yolu yayılması ortaya beklemeden sitokin salgı engelleyicinin ilave edilmeden önce antijen ile daha uzun bir süre (örneğin, 36 saat, 60 saat vs.) Boyunca inkübe etmektir. Başarıyla HIV spesifik CD4 ve CD8 T hücreleri tarafından 11,12 sitokin salgılanmasının kinetiklerini belirlemek için bu yöntemi kullandık, ancak bu yaklaşım küçük tepkiler tespit etmek mümkün değildir ve toplam sitokin salgı meydana gelen entegre bir sonucu vermeyecektir stimülasyon beri. Bu nedenle, ICS supernatan sitokin mRNA miktarının ya da sitokin salgılanması ölçümleri ile karşılaştırıldığında aktive T hücreleri tarafından üretilen sitokin inhibe edici miktarına yollarının blokajı etkisini tespit etmek için yeterince hassas bir yöntem değildirAynı zaman noktalarında t. Ayrıca, aktive edilmiş T hücreleri tarafından üretilen sitokinlerden çok pozitif ya da negatif geri besleme katkıda otokrin bir şekilde hareket antijen sunan hücreler ile etkileşim aracılığıyla döner. Bu nedenle, tahlil sırasında ICS Brefeldin veya Monensin ilavesi sitokin salgılanmasını önler ve böylece T hücrelerinin uyarılması optimal değildir. Son olarak, ICS ile birden fazla sitokin tespiti akış sitometrisi ile sitokinlerin belirlenmesi yanı sıra, herhangi bir panelde aynı anda kullanılabilir fluorochromes sayısında kısıtlamalar tarafından kullanılabilirliği ve antikorlar duyarlılığı ile sınırlıdır. Biz hücreler (APC) ve doğal öldürücü hücreler (NK hücreleri) sunulması antijen HIV-spesifik CD4 T hücreleri tarafından sitokin salınımını düzenleyen ve daha sonra CD4 yardım içinde immünregulatuar yolların etkisini değerlendirmek için son derece hassas bir in vitro deneysel bir yaklaşım geliştirdi. Bu yöntem, aynı zamanda Çarpışma değerlendirmek için kullanılabilirPBMC&#39;lerden CD4 T hücreleri tüketen veya sadece CD8 T hücreleri tarafından tanınan uygun peptitler ile uyarılmasıyla CD8 T hücre işlevi üzerindeki inhibitör moleküllerinin blokajının ct. , 2), daha geniş bir paneli araştırmak 1) üretilmiş sitokin düzeylerinin daha doğru bir ölçümü gerçekleştirmek: hücre içi sitokin boyama deneyleri aksine olarak, edebilmek amacıyla, HIV-özgü CD4 T-hücreleri tarafından sitokin salgılanması ile müdahale karar sitokinler veya efektör moleküller, ve 3) diğer hücre alt-gruplarla ilgili HIV-özgü CD4 T-hücreleri tarafından üretilen sitokin etkisini değerlendirmek. Biz, ilgi konusu bağışıklık yolu için bloke edici antikorların mevcudiyetinde bir HIV-1 Gag peptidi havuzlu CD8 tükenmiş PBMC uyarır. Inkübasyon, genellikle 48 saat içinde arzu edilen süre sonra, boncuk dizileri ile sitokin salgılanmasını ölçmek ve farklı hücre alt fenotipik analizi için ya da transkripsiyonel analizi için ya da hücre pelletleri toplamak için süpernatantlar toplamak. Of t dikkat,Onun 48 saat zaman noktası, biz T hücreleri 12 çoğalan önemli bir nüfus tespit yok. Bu esnek bir yaklaşım ve bu tasarımın bazı uyarlamaların farklı hipotezler gidermek için uygulanabilir. Örneğin, (örneğin, vb HIV spesifik CD4 T hücreleri veya PD-1 yüksek CD4 T hücreleri gibi). Tek hücre alt yüzer ve hücre topakları toplanması ve ardından 36 saat süre ile inkübasyondan önce, daha kuluçkalamadan 12 saat sonra sıralanabilir daha spesifik PBMC&#39;lerin tanımlanmış alt popülasyonlar tarafından sitokin salgılanması üzerindeki abluka müdahalelerin etkisini araştırmak için.

<table><tbody><tr><td>Hanks Balanced Salt Solution without Ca&lt;sup&gt;2+&lt;/sup&gt; or Mg&lt;sup&gt;2+&lt;/sup&gt;</td><td>Sigma</td><td>H9394</td><td></td></tr><tr><td>RPMI 1640</td><td>Sigma</td><td>R0883</td><td></td></tr><tr><td>Histopaque-1077</td><td>Sigma</td><td>10771</td><td></td></tr><tr><td>Human Serum AB</td><td>Gemini BioProducts</td><td>100-512</td><td></td></tr><tr><td>Penicillin/Streptomycin</td><td>Mediatech</td><td>30 001 CI</td><td></td></tr><tr><td>L-glutamine</td><td>Mediatech</td><td>25 005 CI</td><td></td></tr><tr><td>HEPES buffer</td><td>Mediatech</td><td>25060CI</td><td></td></tr><tr><td>FcR blocking reagent, human</td><td>Miltenyi</td><td>130-059-901</td><td></td></tr><tr><td>RosetteSep Human CD8+ Depletion Cocktail </td><td>Stem Cell</td><td>15663</td><td></td></tr><tr><td>LIVE/DEAD Fixable Dead Cell Stain Kit, for UV excitation</td><td>Invitrogen</td><td>L23105</td><td></td></tr><tr><td>Rneasy Mini Kit</td><td>Qiagen</td><td>74104</td><td></td></tr><tr><td>Improm-II Reverse Transcription System</td><td>Promega</td><td>A3800</td><td></td></tr><tr><td>Brilliant II SYBR qPCR Low Rox Master Mix</td><td>Agilent</td><td>600830</td><td></td></tr><tr><td>BD Cytofix/Cytoperm Fixation/Permeabilization Solution Kit</td><td>BD</td><td>554714</td><td></td></tr><tr><td>Tween-20</td><td>Fisher</td><td>BP337100</td><td></td></tr><tr><td>IFN-&amp;#947; primer</td><td>Invitrogen</td><td></td><td>FOR: CGAGATGACTTCGAAAAGCTGA REV: TCTTCGACCTCGAAACAGCA</td></tr><tr><td>GAPDH primer</td><td>Invitrogen</td><td></td><td>FOR: TCATCATCTCTGCCCCCTCT REV: AGTGATGGCATGGACTGTGG</td></tr></tbody></table>

in vitro assay to evaluate the impact of immunoregulatory pathways on hiv-specific cd4 t cell effector function

T hücre bitkinlik kronik viral enfeksiyonlar sırasında başarısız patojen klirensinde önemli bir faktördür. Örneğin PD-1 ve IL-10 gibi bağışıklık düzenleyici yolları, bu devam eden antijen maruz kalma üzerine yukarı regüle ve proliferasyonu kaybı, düşük sitolitik işlevine katkı ve CD4 ve CD8 T hücreleri tarafından sitokin üretimi bozulmaktadır. LCMV enfeksiyonunun murin modelinde, T hücresi tepkilerini artmış olarak bu iki yolun karşı bloke edici antikorların uygulanması. Bununla birlikte, insan örneklerinden hücrelerinde sitokin salgılanması üzerindeki bu blokajı etkisini ölçmek için bir in vitro deney, şu anda mevcuttur. Bizim protokolü ve deneysel yaklaşım doğru ve verimli bir şekilde HIV bulaşmış bireylerden HIV-özgü CD4 T-hücreleri tarafından sitokin üretiminin restorasyon ölçmek için olanak sağlar. Burada, HIV-özgü CD4 T hücreleri ve diğer cel üzerindeki etkisi ile sitokin salgılanmasının ölçümü sağlayan bir in vitro deney tasarımı tasvirl kümeler. CD8 T hücreleri, bütün kandan tükenmiş ve kalan PBMC Ficoll ayırma yöntemi ile izole edildi. CD8-tükenmiş PBMC daha sonra, bir HIV-1 Gag peptidi havuzu ile uyarıldıktan sonra, hücreler, 37 ° C,% 5 CO2 inkübe edildi, PD-L1 ve / veya IL-10Rα karşı bloke edici antikor ile inkübe edilmiştir. 48 saat sonra, yüzer boncuk diziler ve hücre topakları tarafından sitokin analizi için toplandı, sonra, qRT-PCR kullanılarak sitometri veya transkripsiyonel analizi kullanılarak akış fenotipik analizi ya da toplandı. Daha ayrıntılı analiz için, farklı hücre popülasyonları PBMC&#39;lerden selektif alt azalması ile ya da aynı deneylerde değerlendirilen önce akış sitometrisi kullanılarak sıralama ile elde edilmiştir. Bu yöntemler, antijene özgü T-yardımcı hücreleri tarafından sitokin üretiminin modülasyonu tespit etmek ve bağışıklık hücrelerinin farklı popülasyonlar arasında fonksiyonel etkileşimi belirlemek için son derece hassas ve özel bir yaklaşım sağlar.

Bu in vitro bir sistem kullanılarak sitokin ölçümleri gerçekleştirirken, bu uyarım kontrol ile karşılaştırıldığında herhangi bir antijene özgü yanıtları ayırt edebilmek için gereklidir. Genel olarak, bu kontrol ve uyarım tahlilin lineer aralığı içindeydi no göre sitokin seviyelerinde en azından üç kat bir artış elde antijenik uyarımı herhangi bir değeri pozitif tepkiler olarak. Zayıf bir antijene özgü CD4 T hücresi tepkilerini gözlemlemek kılar, 0.16 pg / ml gibi düşü...

Watch this Scientific Journal Video about In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function at JoVE.com

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

Biz HIV-spesifik CD4 T hücreleri tarafından sitokin salgılanmasının düzenlenmesinde immünregulatuar yolların rolünü araştırmak için bir in vitro testi geliştirdi.

Vitro Testi HIV-spesifik CD4 T hücre efektör işlevi üzerinde immünoregülatör yolları etkisini değerlendirmek için

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are ...

in-vitro-assay-to-evaluate-impact-immunoregulatory-pathways-on-hiv

Universidad de Cartagena UDEC

Research

JoVE Journal

Immunology and Infection

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

14.0K Görüntüleme.  The Ragon Institute of MGH, MIT and Harvard.  Biz HIV-spesifik CD4 T hücreleri tarafından sitokin salgılanmasının düzenlenmesinde immünregulatuar yolların rolünü araştırmak için bir in vitro testi geliştirdi. 

Video: In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

Preparation and Use of HIV-1 Infected Primary CD4+ T-Cells as Target Cells in Natural Killer Cell Cytotoxic Assays

Natural killer (NK) cells are a vital component of the innate immune response to virus-infected cells. It is important to understand the ability of NK cells to recognize and lyse HIV-1 infected cells because identifying any aberrancy in NK cell function against HIV-infected cells could potentially lead to therapies that would enhance their cytolytic activity. There is a need to use HIV-infected primary T-cell blasts as target cells rather then infected-T-cell lines in the cytotoxicity assays. T-cell lines, even without infection, are quite susceptible to NK cell lysis. Furthermore, it is necessary to use autologous primary cells to prevent major histocompatibility complex class I mismatches between the target and effector cell that will result in lysis. Early studies evaluating NK cell cytolytic responses to primary HIV-infected cells failed to show significant killing of the infected cells 1,2. However, using HIV-1 infected primary T-cells as target cells in NK cell functional assays has been difficult due the presence of contaminating uninfected cells 3. This inconsistent infected cell to uninfected cell ratio will result in variation in NK cell killing between samples that may not be due to variability in donor NK cell function. Thus, it would be beneficial to work with a purified infected cell population in order to standardize the effector to target cell ratios between experiments 3,4. Here we demonstrate the isolation of a highly purified population of HIV-1 infected cells by taking advantage of HIV-1's ability to down-modulate CD4 on infected cells and the availability of commercial kits to remove dead or dying cells 3-6. The purified infected primary T-cell blasts can then be used as targets in either a degranulation or cytotoxic assay with purified NK cells as the effector population 5-7. Use of NK cells as effectors in a degranulation assay evaluates the ability of an NK cell to release the lytic contents of specialized lysosomes 8 called "cytolytic granules". By staining with a fluorochrome conjugated antibody against CD107a, a lysosomal membrane protein that becomes expressed on the NK cell surface when the cytolytic granules fuse to the plasma membrane, we can determine what percentage of NK cells degranulate in response to target cell recognition. Alternatively, NK cell lytic activity can be evaluated in a cytotoxic assay that allows for the determination of the percentage of target cells lysed by release of 51Cr from within the target cell in the presence of NK cells.

Cytotoxicity assays to measure natural killer cell lytic responses to HIV-infected cells is limited by the purity of the target cells. We demonstrate here the isolation of a highly purified population of HIV-1 infected primary T-cell blasts by taking advantage of HIV-1 s ability to down-modulate CD4.

Hazırlanması ve kullanımı, HIV-1 Enfekte İlköğretim CD4 + T-Hücreleri Hedef Hücreler olarak Natural Killer Hücre Sitotoksik Tahliller

 Natural killer (NK) cells are a vital component of the innate immune response to virus-infected cells. It is important to understand the ability of NK ...

İmmünoloji ve Enfeksiyon

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Regulatory T cells (Tregs) are critical mediators of immune tolerance to self-antigens. In addition, they are crucial regulators of the immune response following an infection. Despite efforts to identify unique surface marker on Tregs, the only unique feature is their ability to suppress the proliferation and function of effector T cells. While it is clear that only in vitro assays can be used in assessing human Treg function, this becomes problematic when assessing the results from cross-sectional studies where healthy cells and cells isolated from subjects with autoimmune diseases (like Type 1 Diabetes-T1D) need to be compared. There is a great variability among laboratories in the number and type of responder T cells, nature and strength of stimulation, Treg:responder ratios and the number and type of antigen-presenting cells (APC) used in human in vitro suppression assays. This variability makes comparison between studies measuring Treg function difficult. The Treg field needs a standardized suppression assay that will work well with both healthy subjects and those with autoimmune diseases. We have developed an in vitro suppression assay that shows very little intra-assay variability in the stimulation of T cells isolated from healthy volunteers compared to subjects with underlying autoimmune destruction of pancreatic &beta;-cells. The main goal of this piece is to describe an in vitro human suppression assay that allows comparison between different subject groups. Additionally, this assay has the potential to delineate a small loss in nTreg function and anticipate further loss in the future, thus identifying subjects who could benefit from preventive immunomodulatory therapy1. Below, we provide thorough description of the steps involved in this procedure. We hope to contribute to the standardization of the in vitro suppression assay used to measure Treg function. In addition, we offer this assay as a tool to recognize an early state of immune imbalance and a potential functional biomarker for T1D.

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Tregs are potent suppressors of the immune system. There is a lack of unique surface markers to define them, hence, definitions of Tregs are primarily functional. Here we describe an optimized in vitro assay capable of identifying immune imbalance in subjects at risk to develop T1D.

Insan In Vitro Bağışıklık Dengesizlik Erken Devlet Tanıma Tarama Aracı Olarak Bastırılması

Regulatory T cells (Tregs) are critical mediators of immune tolerance to self-antigens. In addition, they are crucial regulators of the immune response ...

Quantitative High-throughput Single-cell Cytotoxicity Assay For T Cells

Cancer immunotherapy can harness the specificity of immune response to target and eliminate tumors. Adoptive cell therapy (ACT) based on the adoptive transfer of T cells genetically modified to express a chimeric antigen receptor (CAR) has shown considerable promise in clinical trials1-4. There are several advantages to using CAR+ T cells for the treatment of cancers including the ability to target non-MHC restricted antigens and to functionalize the T cells for optimal survival, homing and persistence within the host; and finally to induce apoptosis of CAR+ T cells in the event of host toxicity5.
Delineating the optimal functions of CAR+ T cells associated with clinical benefit is essential for designing the next generation of clinical trials. Recent advances in live animal imaging like multiphoton microscopy have revolutionized the study of immune cell function in vivo6,7. While these studies have advanced our understanding of T-cell functions in vivo, T-cell based ACT in clinical trials requires the need to link molecular and functional features of T-cell preparations pre-infusion with clinical efficacy post-infusion, by utilizing in vitro assays monitoring T-cell functions like, cytotoxicity and cytokine secretion. Standard flow-cytometry based assays have been developed that determine the overall functioning of populations of T cells at the single-cell level but these are not suitable for monitoring conjugate formation and lifetimes or the ability of the same cell to kill multiple targets8.
Microfabricated arrays designed in biocompatible polymers like polydimethylsiloxane (PDMS) are a particularly attractive method to spatially confine effectors and targets in small volumes9. In combination with automated time-lapse fluorescence microscopy, thousands of effector-target interactions can be monitored simultaneously by imaging individual wells of a nanowell array. We present here a high-throughput methodology for monitoring T-cell mediated cytotoxicity at the single-cell level that can be broadly applied to studying the cytolytic functionality of T cells.

We describe a single-cell high-throughput assay to measure cytotoxicity of T cells when incubated with tumor target cells. This method employs a dense, elastomeric array of sub-nanoliter wells (~100,000 wells/array) to spatially confine the T cells and target cells at defined ratios and is coupled to fluorescence microscopy to monitor effector-target conjugation and subsequent apoptosis.

T Hücreleri İçin Kantitatif Yüksek throughput Tek hücreli Sitotoksisite Testi

Cancer immunotherapy can harness the specificity of  immune response to target and eliminate tumors. Adoptive cell therapy (ACT)  based on the adoptive ...

New Tools to Expand Regulatory T Cells from HIV-1-infected Individuals

CD4+ Regulatory T cells (Tregs) are potent immune modulators and serve an important function in human immune homeostasis. Depletion of Tregs has led to measurable increases in antigen-specific T cell responses in vaccine settings for cancer and infectious pathogens. However, their role in HIV-1 immuno-pathogenesis remains controversial, as they could either serve to suppress deleterious HIV-1-associated immune activation and thus slow HIV-1 disease progression or alternatively suppress HIV-1-specific immunity and thereby promote virus spread. Understanding and modulating Treg function in the context of HIV-1 could lead to potential new strategies for immunotherapy or HIV vaccines. However, important open questions remain on their role in the context of HIV-1 infection, which needs to be carefully studied.
Representing roughly 5% of human CD4+ T cells in the peripheral blood, studying the Treg population has proven to be difficult, especially in HIV-1 infected individuals where HIV-1-associated CD4 T cell and with that Treg depletion occurs. The characterization of regulatory T cells in individuals with advanced HIV-1 disease or tissue samples, for which only very small biological samples can be obtained, is therefore extremely challenging. We propose a technical solution to overcome these limitations using isolation and expansion of Tregs from HIV-1-positive individuals.
Here we describe an easy and robust method to successfully expand Tregs isolated from HIV-1-infected individuals in vitro. Flow-sorted CD3+CD4+CD25+CD127low Tregs were stimulated with anti-CD3/anti-CD28 coated beads and cultured in the presence of IL-2. The expanded Tregs expressed high levels of FOXP3, CTLA4 and HELIOS compared to conventional T cells and were shown to be highly suppressive. Easier access to large numbers of Tregs will allow researchers to address important questions concerning their role in HIV-1 immunopathogenesis. We believe answering these questions may provide useful insight for the development of an effective HIV-1 vaccine.

CD4+ Regulatory T cells are potent immune-modulators and serve important functions in immune homeostasis. The paucity of these cells in peripheral blood makes functional studies challenging, specifically in the context of HIV-1-infection. We here describe a method to isolate and expand functional CD4+ Tregs from peripheral blood from HIV-1-infected individuals.

Yeni Araçlar HIV-1 ile enfekte bireyler gelen Düzenleyici T hücreleri büyütmek için

CD4+ Regulatory T cells (Tregs) are potent immune modulators and serve an important function in human immune homeostasis. Depletion of Tregs has led to ...

Assessing the Innate Sensing of HIV-1 Infected CD4+ T Cells by Plasmacytoid Dendritic Cells Using an Ex vivo Co-culture System.

HIV-1 innate sensing requires direct contact of infected CD4+ T cells with plasmacytoid dendritic cells (pDCs). In order to study this process, the protocols described here use freshly isolated human peripheral blood mononuclear cells (PBMCs) or plasmacytoid dendritic cells (pDCs) to sense infections in either T cell line (MT4) or heterologous primary CD4+ T cells. In order to ensure proper sensing, it is essential that PBMC are isolated immediately after blood collection and that optimal percentage of infected T cells are used. Furthermore, multi-parametric flow cytometric staining can be used to confirm that PBMC samples contain the different cell lineages at physiological ratios. A number of controls can also be included to evaluate viability and functionality of pDCs. These include, the presence of specific surface markers, assessing cellular responses to known agonist of Toll-Like Receptors (TLR) pathways, and confirming a lack of spontaneous type-I interferon (IFN) production. In this system, freshly isolated PBMCs or pDCs are co-cultured with HIV-1 infected cells in 96 well plates for 18-22 hr. Supernatants from these co-cultures are then used to determine the levels of bioactive type-I IFNs by monitoring the activation of the ISGF3 pathway in HEK-Blue IFN-&#945;/&#946; cells. Prior and during co-culture conditions, target cells can be subjected to flow cytometric analysis to determine a number of parameters, including the percentage of infected cells, levels of specific surface markers, and differential killing of infected cells. Although, these protocols were initially developed to follow type-I IFN production, they could potentially be used to study other imuno-modulatory molecules released from pDCs and to gain further insight into the molecular mechanisms governing HIV-1 innate sensing.

Assessing the Innate Sensing of HIV-1 Infected CD4+ T Cells by Plasmacytoid Dendritic Cells Using an Ex vivo Co-culture System.

Unlike cell-free HIV-1 particles, infected CD4+ T cells are effectively sensed by plasmacytoid dendritic cells (pDCs). This manuscript describes a method where peripheral blood mononuclear cells (PBMCs) or isolated pDCs are co-cultured with HIV-1 infected T cells to evaluate innate sensing by pDCs as assessed by release of type-I IFN.

HIV-1 Enfekte CD4 Doğuştan Algılama Değerlendirilmesi<sup&gt; +</sup&gt; Bir kullanılması plazmositoid dendritik hücreler tarafından T Hücreleri<em&gt; Ex vivo</em&gt; Co-kültür sistemi.

HIV-1 innate sensing requires direct contact of infected CD4+ T cells with plasmacytoid dendritic cells (pDCs). In order to study this process, the ...

Conformational Evaluation of HIV-1 Trimeric Envelope Glycoproteins Using a Cell-based ELISA Assay

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins are able to fuel the fusion process through their conformational changes could lead to the design of better, more effective immunogens for vaccine strategies. Here we describe a cell-based ELISA assay that allows studying the recognition of trimeric HIV-1 Env by monoclonal antibodies. Following expression of HIV-1 trimeric Env at the surface of transfected cells, conformation specific anti-Env antibodies are incubated with the cells. A horseradish peroxidase-conjugated secondary antibody and a simple chemiluminescence reaction are then used to detect bound antibodies. This system is highly flexible and can detect Env conformational changes induced by soluble CD4 or cellular proteins. It requires minimal amount of material and no highly-specialized equipment or know-how. Thus, this technique can be established for medium to high throughput screening of antigens and antibodies, such as newly-isolated antibodies.

Understanding viral surface antigens conformations is required to evaluate antibody neutralization and guide the design of effective vaccine immunogens. Here we describe a cell-based ELISA assay that allows the study of the recognition of trimeric HIV-1 Env expressed at the surface of transfected cells by specific anti-Env antibodies.

Bir Hücre temelli bir ELISA testi kullanarak, HIV-1 zarf trimerik Glikoproteinler konformasyonel Değerlendirilmesi

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins ...

An In Vitro Model for Measuring Immune Responses to Malaria in the Context of HIV Co-infection

Malaria and HIV co-infection is a growing health priority. However, most research on malaria or HIV currently focuses on each infection individually. Although understanding the disease dynamics for each of these pathogens independently is vital, it is also important that the interactions between these pathogens are investigated and understood. 
We have developed a versatile in vitro model of HIV-malaria co-infection to study host immune responses to malaria in the context of HIV infection. Our model allows the study of secreted factors in cellular supernatants, cell surface and intracellular protein markers, as well as RNA expression levels. The experimental design and methods used limit variability and promote data reliability and reproducibility. 
All pathogens used in this model are natural human pathogens (Plasmodium falciparum and HIV-1), and all infected cells are naturally infected and used fresh. We use human erythrocytes parasitized with P. falciparum and maintained in continuous in vitro culture. We obtain freshly isolated peripheral blood mononuclear cells from chronically HIV-infected volunteers. Every condition used has an appropriate control (P. falciparum parasitized vs. normal erythrocytes), and every HIV-infected donor has an HIV uninfected control, from which cells are harvested on the same day. This model provides a realistic environment to study the interactions between malaria parasites and human immune cells in the context of HIV infection.

An In Vitro Model for Measuring Immune Responses to Malaria in the Context of HIV Co-infection

Human co-infection is difficult to replicate in vitro. However, human malaria parasites can readily be cultured in vitro, as can freshly isolated human peripheral blood mononuclear cells naturally infected with HIV. This provides an excellent model for studying early immune responses to malaria parasites in the context of HIV co-infection.

Bir<em&gt; İn Vitro</em&gt; HIV Co-enfeksiyon Bağlamında Sıtma için Bağışıklık Yanıtları Ölçüm Modeli

Malaria and HIV co-infection is a growing health priority. However, most research on malaria or HIV currently focuses on each infection individually. ...

Phenotypic and Functional Analysis of Activated Regulatory T Cells Isolated from Chronic Lymphocytic Choriomeningitis Virus-infected Mice

Regulatory T (Treg) cells, which express Foxp3 as a transcription factor, are subsets of CD4+ T cells. Treg cells play crucial roles in immune tolerance and homeostasis maintenance by regulating the immune response. The primary role of Treg cells is to suppress the proliferation of effector T (Teff) cells and the production of cytokines such as IFN-&#947;, TNF-&#945;, and IL-2. It has been demonstrated that Treg cells&#39; ability to inhibit the function of Teff cells is enhanced during persistent pathogen infection and cancer development. To clarify the function of Treg cells under resting or inflamed conditions, a variety of in vitro suppression assays using mouse or human Treg cells have been devised. The main aim of this study is to develop a method to compare the differences in phenotype and suppressive function between resting and activated Treg cells. To isolate activated Treg cells, mice were infected with lymphocytic choriomeningitis virus (LCMV) clone 13 (CL13), a chronic strain of LCMV. Treg cells isolated from the spleen of LCMV CL13-infected mice exhibited both the activated phenotype and enhanced suppressive activity compared with resting Treg cells isolated from na&#239;ve mice. Here, we describe the basic protocol for ex vivo phenotype analysis to distinguish activated Treg cells from resting Treg cells. Furthermore, we describe a protocol for the measurement of the suppressive activity of fully activated Treg cells.

Here, we describe a protocol to analyze the phenotype of regulatory T (Treg) cells isolated from na&#239;ve and chronic lymphocytic choriomeningitis virus-infected mice. In addition, we provide a process to evaluate the suppressive activity of the Treg cells.

Fenotipik ve Kronik Lenfositik koryomenenjit Virüs ile enfekte Fare İzole Aktif Düzenleyici T hücrelerinin Fonksiyonel Analiz

Regulatory T (Treg) cells, which express Foxp3 as a transcription factor, are subsets of CD4+ T cells. Treg cells play crucial roles in immune tolerance ...

Stem-cell Based Engineered Immunity Against HIV Infection in the Humanized Mouse Model

With the rapid development of stem cell-based gene therapies against HIV, there is pressing requirement for an animal model to study the hematopoietic differentiation and immune function of the genetically modified cells. The humanized Bone-marrow/Liver/Thymus (BLT) mouse model allows for full reconstitution of a human immune system in the periphery, which includes T cells, B cells, NK cells and monocytes. The human thymic implant also allows for thymic selection of T cells in autologous thymic tissue. In addition to the study of HIV infection, the model stands as a powerful tool to study differentiation, development and functionality of cells derived from hematopoietic stem cells (HSCs). Here we outline the construction of humanized non-obese diabetic (NOD)-severe combined immunodeficient (SCID)-common gamma chain knockout (c&#947;-/-)-Bone-marrow/Liver/Thymus (NSG-BLT) mice with HSCs transduced with CD4 chimeric antigen receptor (CD4CAR) lentivirus vector. We show that the CD4CAR HSCs can successfully differentiate into multiple lineages and have anti-HIV activity. The goal of the study is to demonstrate the use of NSG-BLT mouse model as an in vivo model for engineered immunity against HIV. It is worth noting that, because lentivirus and human tissue is used, experiments and surgeries should be performed in a Class II biosafety cabinet in a Biosafety Level 2 (BSL2) with special precautions (BSL2+) facility.

This protocol describes the methods in constructing a humanized bone-marrow/liver/thymus mouse model with stem cell-based engineered immunity against HIV infection.

Insanlaşmış Fare Modelinde HIV enfeksiyonuna karşı kök hücre Tabanlı Engineered Bağışıklık

With the rapid development of stem cell-based gene therapies against HIV, there is pressing requirement for an animal model to study the hematopoietic ...

Tıp

Tailoring In Vivo Cytotoxicity Assays to Study Immunodominance in Tumor-specific CD8+ T Cell Responses

Carboxyfluorescein succinimidyl ester (CFSE)-based in vivo cytotoxicity assays enable sensitive and accurate quantitation of CD8+ cytolytic T lymphocyte (CTL) responses elicited against tumor- and pathogen-derived peptides. They offer several advantages over traditional killing assays. First, they permit the monitoring of CTL-mediated cytotoxicity within architecturally intact secondary lymphoid organs, typically in the spleen. Second, they allow for mechanistic studies during the priming, effector and recall phases of CTL responses. Third, they provide useful platforms for vaccine/drug efficacy testing in a truly in vivo setting. Here, we provide an optimized protocol for the examination of concomitant CTL responses against more than one peptide epitope of a model tumor antigen (Ag), namely, simian virus 40 (SV40)-encoded large T Ag (T Ag). Like most other clinically relevant tumor proteins, T Ag harbors many potentially immunogenic peptides. However, only four such peptides induce detectable CTL responses in C57BL/6 mice. These responses are consistently arranged in a hierarchical order based on their magnitude, which forms the basis for TCD8 &#8220;immunodominance&#8221; in this powerful system. Accordingly, the bulk of the T Ag-specific TCD8 response is focused against a single immunodominant epitope while the other three epitopes are recognized and responded to only weakly. Immunodominance compromises the breadth of antitumor TCD8 responses and is, as such, considered by many as an impediment to successful vaccination against cancer. Therefore, it is important to understand the cellular and molecular factors and mechanisms that dictate or shape TCD8 immunodominance. The protocol we describe here is tailored to the investigation of this phenomenon in the T Ag immunization model, but can be readily modified and extended to similar studies in other tumor models. We provide examples of how the impact of experimental immunotherapeutic interventions can be measured using in vivo cytotoxicity assays.

Tailoring In Vivo Cytotoxicity Assays to Study Immunodominance in Tumor-specific CD8+ T Cell Responses

We describe here a flow cytometry-based in vivo killing assay that enables examination of immunodominance in cytotoxic T lymphocyte (CTL) responses to a model tumor antigen. We provide examples of how this elegant assay may be employed for mechanistic studies and for drug efficacy testing.

Tümör-spesifik CD8+ T hücre tepkiler Immunodominance çalışması Için In vivo sitotoksisite assays terzilik

Carboxyfluorescein succinimidyl ester (CFSE)-based in vivo cytotoxicity assays enable sensitive and accurate quantitation of CD8+ cytolytic T lymphocyte ...

Vitro Testi HIV-spesifik CD4 T hücre efektör işlevi üzerinde immünoregülatör yolları etkisini değerlendirmek için

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler