Esta pesquisa foi apoiada pela National Science Foundation subvenção IOS-1025642 (GBM). Agradecemos Maria Harrison para fornecer a tensão ARqua1.

1. Guia de RNA Concepção e Construção Vector <ol><li> Identificar sequências alvo para os genes de interesse. Há uma variedade de programas de encontrar alvo CRISPR linha adequados para este passo 13,14. NOTA: Aqui usamos o GN 20 GG motivo alvo, mas outros desenhos podem ser adequadas, dependendo do sistema de aplicação ou vector usado. </li><li> Design 60-mer oligonucleótidos gRNA para incluir a porção GN 19 dos motivos alvo flanqueado em 5 &#39;e 3&#39; as sequências de 20 nt que são necessárias para a montagem de ADN. O motivo final de 60-mer é: 5&#39;-TCAAGCGAACCAGTAGGCTT-GN 19 -GTTTTAGAGCTAGAAATAGC-3 &#39;. NOTA: Padrão, primers já dessalgado funcionar bem. </li><li> Prepare os quatro DNAs de montagem (Figura 1). Veja arquivo suplementar para sequências de ADN. <ol><li> Digerir 1-5 ug de p201N: 10 Cas9 plasmídeo com a enzima de restrição Spe ​​I em 1X tampão de 4 a 37 ° C durante 2 h. Coluna-purificar a digerir umaegundo as instruções do fabricante. Ressuspender em ~ 15 ul de Tris-HCl a 10, e quantificar por espectrofotometria de UV. </li><li> Executar uma segunda digestão com a enzima de restrição Swa I em 1X tampão de 3,1 a 25 ° C durante 2 h. Verificar 100-200 ng sobre um gel de agarose a 0,8% para confirmar a digestão completa. NOTA: Um plasmídeo correctamente digerido terá uma única banda a 14313 pb. Nota: a inactivação térmica da enzima e desfosforilação não são necessários. plasmídeo digerido podem ser armazenadas a -20 ° C. </li><li> PCR amplificar o truncatula Medicago (Mt) de promotor U6 e andaime DNAs pela PUC gRNA Shuttle 10 plasmídeo utilizando os primers Swa I_MtU6F / MtU6R e ScaffoldF / Spe I_ScaffoldR, respectivamente. Usar uma polimerase de alta fidelidade com as condições de PCR: 95 ° C durante 3 min; 31 ciclos (98 ° C durante 20 seg, 60 ° C durante 15 seg, 72 ° C durante 30 seg); e 72 ° C durante 5 min. <ol><li> Visualize ~ 3 mL alíquotas de pr PCRodutos sobre um gel de agarose a 1% para confirmar a amplificação. O amplicon MtU6 é 377 pb e o fragmento amplificado andaime é de 106 pb. Coluna-purificar os produtos de PCR restantes de acordo com as instruções do fabricante, quantificar por espectrofotometria de UV e armazenar a -20 ° C. </li></ol></li><li> Ressuspender todo o tubo de oligos gRNA 100 mM em água de grau de laboratório. Adicionar 1 ml de oligo 100 uM a 500 ul de 1x tampão de 2,1. Misture bem. Se pooling múltiplos oligos, adicionar 1 ul de cada oligo 100 uM para o tubo do tampão 1x 2.1. oligos diluído pode ser armazenado a -20 ° C. </li></ol></li><li> Programar um termociclador para manter a 50 ° C, usando uma tampa aquecida. Combinar 100 ng (0,011 pmol) de vector linearizado, 50 ng (0,2 pmol) de promotor MtU6, 12 ng (0,2 pmol) de andaime, 1 ul (0,2 pmol) de oligo diluída gRNA (s), e água até um volume de 5 ul. Adicionar 5 ul de 2x de alta fidelidade montagem DNA mistura principal, misture bem e girar para baixo. Incubar de reacção durante 60 min no50 ° C termociclador. Em seguida, coloque a reação no gelo. Nota: Os volumes de reacção pode ser aumentada para acomodar os rendimentos baixos de ADN. </li><li> Transformar 2 ul da reacção em E. competente células de E. coli, utilizando técnicas padrão e placa em placas de LB suplementadas com 50 mg L-1 de canamicina (Kan 50). Crescer as células plaqueadas a 37 ° C durante a noite. Guardar a reacção montagem ADN remanescente à temperatura de -20 ° C. </li><li> tela Colony por PCR utilizando o StUbi3P218R primers e ISceIR. Dilui-se uma alíquota da reacção de montagem ADN remanescente com água 1: 5. Use 1 ml como um controle positivo para a tela da colônia e 1 ng de p201N circular: plasmídeo Cas9 como um controle não-inserção. <ol><li> Amplificar por PCR com as condições; 95 ° C durante 3 min; 31 ciclos (95 ° C durante 30 seg, 58 ° C durante 30 seg, 72 ° C durante 30 seg); e a 72 ° C durante 5 min. Visualizar os produtos de PCR num gel de agarose a 1%. Certifique-se de que as inserções correctas têm uma banda de 725 pb e vetores witinserções hout (por exemplo, vetor sem cortes) terá uma banda de 310 pb. </li></ol></li><li> Crescer colónias positivas em LB Kan 50 culturas líquidas durante a noite a 37 ° C e purificar plasmideos de acordo com as instruções do fabricante. sequência Sanger plasmídeos com o primer StUbi3P218R e alinhar cromatogramas ao promotor MtU6, alvo, e sequências de andaime para garantir que não haja erros foram introduzidas durante a clonagem. </li><li> Realizar um diagnóstico digerir por digestão ~ 1 ug de plasmídeo com Eco RV e Sty I. Visualizar num gel de agarose a 0,8%. Fragments (em pb) são: 4192, 2001, 1743, 1544, 1381, 995, 831, 702, 460, 423, 318 e 174. </li><li> Use montagem DNA para construir vectores com vários gRNAs. <ol><li> Para construir um vector com duas cassetes gRNA, amplificar por PCR a primeira posição gRNA com os iniciadores Swa I_MtU6F / UNS1_ScaffoldR e a segunda posição gRNA com os iniciadores UNS1_MtU6F / Spe I_ScaffoldR de 1 ng de cada um dos respectivosplasmídeos construídos nos passos 1.1 - 1.8. Use as condições de PCR no passo 1.3.3. Visualizar ~ 3 aliquotas ul de produtos de PCR num gel de agarose a 1% para confirmar a amplificação. Amplicons são ~ 500 pb. </li><li> Combinar e misturar quantidades aproximadamente iguais dos produtos de PCR purificados em un num tubo de 200 ul (tipicamente 3-4 mL de cada). Para a montagem, adicionar 1 ul de produtos de PCR combinados, 50 ng de Swa I e Spe I linearizado p201N: Cas9, água de grau laboratorial e 2,5 uL e 2,5 uL de 2x de alta fidelidade de ADN montagem mistura principal. Incubar em um termociclador a 50 ° C durante 15 min. Nota: Os manuais de montagem de DNA recomenda a 15 min de incubação por 2 - 3 fragmentos. </li><li> Transformação 1 - 2 ul em E. competente coli e placa em LB Kan 50. Cultivar células plaqueadas a 37 ° C durante a noite. Guardar a reacção restante à temperatura de -20 ° C. </li><li> tela Colony por PCR com primers StUbi3P218R e ISceIR com as mesmas condições que o passo 1.6. correcta clones terá um amplicon 1.200 pb. Crescer colónias positivas em LB Kan 50 culturas líquidas durante a noite e purificar plasmídeos. </li><li> Sanger plasmídeos sequência com o StUbi3P218R iniciadores (cobre primeira posição gRNA) e p201R (cobre-segunda posição gRNA). Alinhar cromatogramas para as sequências de promotor, de destino e de andaime MtU6. Diagnóstico digerir com Eco RV e Sty I irá resultar nos seguintes fragmentos (em pb): 4192, 2476, 1743, 1544, 1381, 995, 831, 702, 460, 423, 318, 174. fragmento em negrito contém a segunda gRNA. </li></ol></li><li> Após a reunião todas as expectativas de controle de qualidade, transformar plasmídeos em Agrobacterium rhizogenes estirpe ARqua1 15. Adicionar 1 ul da preparação de plasmídeo a 50 ul de células electrocompetentes e electroporar numa cuvete de um milímetro com as definições: 2,4 kV, 25 uF, 200 e Ω. Recuperar células em ~ 500 mL de SOC e agitar a 28 ° C durante 2 h. Placa em LB Kan 50 e glinha a 28 ° C durante 2 dias. tela colónia executar usando os mesmos iniciadores e condições de PCR como 1.3.3. Adicione estoques de glicerol a partir de clones positivos. </li></ol> Transformação 2. Hairy Root <ol><li> Esterilizar sementes de tomate em água sanitária de 20% para 15 min, com mistura constante. Em uma capela de fluxo laminar, retire a água sanitária e lave em água de grau de laboratório estéril 3 vezes. </li><li> Placa 30 sementes em uma caixa GA-7 contendo meio ½ MS (2,22 g L -1 MS sais + Gamborg vitaminas, 10 g L -1 de sacarose, 3 g L -1 goma de gel, pH 5,8). Germinar para ~ 2 dias no escuro, em seguida, passar GA-7 caixas de luz. A produção de mudas para ~ 4 mais dias na luz. </li><li> No dia antes da transformação, raia fora A. rhizogenes culturas acesa LB Kan 50 e crescer a 28 ° C durante a noite. </li><li> Dia da transformação, na capela de fluxo laminar montar materiais estéreis: 12 ml tubos de cultura, tubo de 50 ml, ½ MS líquido (sem gelana gum), 200? M acetoseringona, papel de filtro, placas de Petri, pinça e bisturi, pipetas e ponteiras. Adicionar 25 ul de acetossiringona a 50 ml de ½ MS e despeje ~ 6 ml em cada tubo de cultura. </li><li> Use uma inclinação ponta de 200 mL para raspar A. rhizogenes células da placa e os ressuspender em 6 ml de ½ MS líquido. Vortex do tubo para voltar a suspender as células. Após ressuspender as células de cada vector, medir a densidade óptica (OD) de 1 ml de células a um comprimento de onda fixo de 600 nm. Certifique-se de OD é entre 0,2 e 0,4; diluir ou adicionar mais células como necessário. Repita o procedimento para cada construção. </li><li> Adicionar 2 ml de ~ ½ MS líquido para uma placa de Petri com papel de filtro estéril. cotilédones especiais sobre o consumo de mudas e coloque sobre o papel de filtro umedecido. Uma vez que todos os cotilédones foram recolhidos, cortar as distais ~ 1 cm fora dos cotilédones, resultando em peças de cotilédones, com duas extremidades cortadas. Adicionar explantes com A. soluções rhizogenes, misturar e incubar por 20 mincom inversão ocasional. Nota: Cerca de 12 explantes por construção são rotineiramente utilizados, embora até 80 explantes foram inoculados em 6 ml de A. solução rhizogenes. </li><li> Durante a A. rhizogenes incubação, adicionar papel de filtro para placas de Petri, um por construto transformado. Também definir ½ MS meios sólidos, sem antibióticos, na capela de fluxo laminar para secar. </li><li> Colher cotilédones de A. solução rhizogenes com uma pinça estéril e coloque sobre papel de filtro seco. Cubra com Petri tampa para garantir tecidos não sequem enquanto prosseguir para a próxima transformação. cotilédones mancha no papel de filtro e transferência, com o lado abaxial para cima, a ½ meio MS. Enrole placas com fita cirúrgica e co-cultivar no escuro à temperatura ambiente durante 2 dias. </li><li> Após o co-cultivo, cotilédones de transferência, com o lado abaxial para cima, para meio de cultura MS suplementado com 300 mg L-1 ticarcilina / ácido clavulânico (Tm 300, para impedir o crescimento de residual A. rhizogenes) e Kan 50 (para seleção de plantas) e enrole com fita cirúrgica. Manter culturas sob luzes fluorescentes à temperatura ambiente com um fotoperíodo de 16 horas. </li><li> Depois de ~ 1,5 - 2 semanas raízes, pelo menos, 2 cm de comprimento são excisados ​​a partir dos cotilédones, utilizando fórceps estéreis e um bisturi e transferidos para meio MS Kan 50 300 Tm meios. Transferir 10 a 15 raízes de uma única placa. Marcar a posição das pontas de raiz com um marcador, enrole com fita cirúrgica, e manter na sala de cultura. </li><li> Após uma semana, as raízes transformadas são vistas crescer nos meios selectivos. Colher uma subamostra de raízes transformadas para extração de DNA utilizando o método de DNA de extracção preferido. Nota: Placas com cotilédones pode ser mantido por 2 - 3 colheitas semanais, após o que apontam as raízes crescem em um emaranhado e são difíceis de isolar. tecidos da raiz não colhidas pode ser mantida indefinidamente. Uma variedade de ensaios pode ser realizado na amostra de DNA isolados para determinar a freqüência mutação do DNA e tipo. Os resultados de algumas dessas análises estão descritos a seguir. </li></ol>

<ol>
	<li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells.">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343 (6166), 84-87 (2014).</li><li>Zhou, Y. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+screening+of+a+CRISPR/Cas9+library+for+functional+genomics+in+human+cells.">High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells.</a> Nature. 509 (509), 487-491 (2014).</li><li>Doudna, J. A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+new+frontier+of+genome+engineering+with+CRISPR-Cas9.">The new frontier of genome engineering with CRISPR-Cas9.</a> Science. 346 (6213), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Patron, N. J., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Editing+plant+genomes+with+CRISPR/Cas9.">Editing plant genomes with CRISPR/Cas9.</a> Current Opinion in Biotechnology. 32, 76-84 (2015).</li><li>Bortesi, L., Fischer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR/Cas9+system+for+plant+genome+editing+and+beyond.">The CRISPR/Cas9 system for plant genome editing and beyond.</a> Biotechnology Advances. 33 (1), 41-52 (2015).</li><li>Jia, H. G., Wang, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+editing+of+sweet+orange+using+Cas9/sgRNA.">Targeted genome editing of sweet orange using Cas9/sgRNA.</a> Plos One. 9, (2014).</li><li>Upadhyay, S. K., Kumar, J., Alok, A., Tuli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+Genome+Editing+for+Target+Gene+Mutations+in+Wheat.">RNA-Guided Genome Editing for Target Gene Mutations in Wheat.</a> G3-Genes Genomes Genetics. 3 (12), 2233-2238 (2013).</li><li>Ron, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hairy+root+transformation+using+Agrobacterium+rhizogenes.+as+a+tool+for+exploring+cell+type-specific+gene+expression+and+function+using+tomato+as+a+model.">Hairy root transformation using Agrobacterium rhizogenes. as a tool for exploring cell type-specific gene expression and function using tomato as a model.</a> Plant Physiology. 166 (2), 455-U4442 (2014).</li><li>Jacobs, T. B., LaFayette, P. R., Schmitz, R. J., Parrott, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modifications+in+soybean+with+CRISPR/Cas9.">Targeted genome modifications in soybean with CRISPR/Cas9.</a> BMC Biotechnology. 15, (2015).</li><li>Gibson, D. G., Smith, H. O., Hutchison, C. A., Venter, J. C., Merryman, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+synthesis+of+the+mouse+mitochondrial+genome.">Chemical synthesis of the mouse mitochondrial genome.</a> Nature Methods. 7 (11), 901-903 (2010).</li><li>Zhou, X., Jacobs, T. B., Xue, L. J., Harding, S. A., Tsai, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploiting+SNPs+for+biallelic+CRISPR+mutations+in+the+outcrossing+woody+perennial+Populus+reveals+4-coumarate:CoA+ligase+specificity+and+redundancy.">Exploiting SNPs for biallelic CRISPR mutations in the outcrossing woody perennial Populus reveals 4-coumarate:CoA ligase specificity and redundancy.</a> New Phytologist. , (2015).</li><li>Stemmer, M., Thumberger, T., Keyer, M. D., Wittbrodt, J., Mateo, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CCTop:+An+Intuitive,+Flexible+and+Reliable+CRISPR/Cas9+Target+Prediction+Tool.">CCTop: An Intuitive, Flexible and Reliable CRISPR/Cas9 Target Prediction Tool.</a> Plos One. 10, (2015).</li><li>Lei, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-P:+A+Web+Tool+for+Synthetic+Single-Guide+RNA+Design+of+CRISPR-System+in+Plants.">CRISPR-P: A Web Tool for Synthetic Single-Guide RNA Design of CRISPR-System in Plants.</a> Molecular Plant. 7 (9), 1494-1496 (2014).</li><li>Quandt, H. J., Puhler, A., Broer, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TRANSGENIC+ROOT-NODULES+OF+VICIA-HIRSUTA+-+A+FAST+AND+EFFICIENT+SYSTEM+FOR+THE+STUDY+OF+GENE-EXPRESSION+IN+INDETERMINATE-TYPE+NODULES.">TRANSGENIC ROOT-NODULES OF VICIA-HIRSUTA - A FAST AND EFFICIENT SYSTEM FOR THE STUDY OF GENE-EXPRESSION IN INDETERMINATE-TYPE NODULES.</a> Molecular Plant-Microbe Interactions. 6, 699-706 (1993).</li><li>Zhu, X. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+genotyping+method+for+genome-modified+animals+and+human+cells+generated+with+CRISPR/Cas9+system.">An efficient genotyping method for genome-modified animals and human cells generated with CRISPR/Cas9 system.</a> Scientific Reports. 4 (8), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant+genome+editing+made+easy:+targeted+mutagenesis+in+model+and+crop+plants+using+the+CRISPR/Cas+system.">Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system.</a> Plant Methods. 9 (1), 39 (2013).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li><li>Li, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+and+homologous+recombination-mediated+genome+editing+in+Arabidopsis+and+Nicotiana+benthamiana+using+guide+RNA+and+Cas9.">Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9.</a> Nat Biotech. 31 (8), 688-691 (2013).</li><li>Fu, Y. F., Sander, J. D., Reyon, D., Cascio, V. M., Joung, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+CRISPR-Cas+nuclease+specificity+using+truncated+guide+RNAs.">Improving CRISPR-Cas nuclease specificity using truncated guide RNAs.</a> Nature Biotechnology. 32 (3), 279-284 (2014).</li><li>Torella, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+nucleotide+sequence-guided+assembly+of+repetitive+DNA+parts+for+synthetic+biology+applications.">Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications.</a> Nat Protoc. 9 (9), 2075-2089 (2014).</li><li>Ono, N. N., Tian, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+multiplicity+of+hairy+root+cultures:+Prolific+possibilities.">The multiplicity of hairy root cultures: Prolific possibilities.</a> Plant Science. 180 (3), 439-446 (2011).</li><li>Tepfer, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+several+species+of+higher+plants+by+Agrobacterium+rhizogenes.:+sexual+transmission+of+the+transformed+genotype+and+phenotype.">Transformation of several species of higher plants by Agrobacterium rhizogenes.: sexual transmission of the transformed genotype and phenotype.</a> Cell. 37 (3), 959-967 (1984).</li><li>Li, H., Deng, Y., Wu, T. L., Subramanian, S., Yu, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Misexpression+of+miR482,+miR1512,+and+miR1515+Increases+Soybean+Nodulation.">Misexpression of miR482, miR1512, and miR1515 Increases Soybean Nodulation.</a> Plant Physiology. 153 (4), 1759-1770 (2010).</li><li>Boisson-Dernier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+rhizogenes-transformed+roots+of+Medicago+truncatula+for+the+study+of+nitrogen-fixing+and+endomycorrhizal+symbiotic+associations.">Agrobacterium rhizogenes-transformed roots of Medicago truncatula for the study of nitrogen-fixing and endomycorrhizal symbiotic associations.</a> Molecular Plant-Microbe Interactions. 14 (6), 695-700 (2001).</li><li>Collier, R., Fuchs, B., Walter, N., Kevin Lutke, W., Taylor, C. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+vitro.+composite+plants:+an+inexpensive,+rapid+method+for+root+biology.">Ex vitro. composite plants: an inexpensive, rapid method for root biology.</a> Plant Journal. 43 (3), 449-457 (2005).</li></ol>

Os autores não têm nada para revelar.

Since DNA assembly is used to recombine any overlapping DNA sequences, this cloning method can be applied to any CRISPR vector construction. Most CRISPR cloning schemes use either gene synthesis of the gRNA, type IIS restriction enzymes17,18, or overlap-extension PCR19. Each of these techniques has inherent advantages and disadvantages, but they typically require multiple hands-on cloning steps. The primary advantage of the cloning method presented here is that the entire process occurs in a single,...

A capacidade de gerar modificações no DNA orientadas e dotadas de CRISPR / Cas9 tem um grande potencial para estudos de genômica funcional. Existem dois componentes do sistema CRISPR / Cas9; a nuclease Cas9, derivada de Staphylococcus pyogenes e um 100-nt ARN guia (gRNA) de aproximadamente molécula que dirige Cas9 ao local de ADN alvo (s) 1. Reconhecimento do alvo é conferido pelo primeiro ~ 20 nt do gRNA, que permite a produção de alto rendimento de segmentação vetores 2,3. A maioria dos organismos que podem ser modificadas, já esteve com CRISPR tecnologia / Cas9 4,5. Em plantas, os promotores constitutivos, tais como o promotor CaMV 35S, são vulgarmente utilizados para dirigir a expressão da nuclease Cas9 6. Os gRNAs são expressas usando a polimerase III U6 ou U3 promotores de ARN, o que limita a primeira base do gRNA, quer um G, para U6, ou R para U3, para a transcrição eficiente. No entanto prom RNA polimerase IIoters, que são livres de tais restrições, também têm sido utilizados 7,8. Diferentes gRNAs induzir mutações de DNA com eficiências diferentes, e por isso pode ser importante para o primeiro validar vetores CRISPR antes de investir em transformações de toda a planta ou a criação de amplas telas fenotípicas. A expressão transiente de construções de CRISPR em plantas, utilizando agroinfiltração por exemplo, geralmente resulta em uma menor frequência de modificação do ADN, em comparação com as plantas estáveis ​​6, tornando a detecção de mutações difíceis e ensaios fenotípicos impraticáveis ​​com tais abordagens. Os chamados raízes peludas são um sistema conveniente, alternativa uma vez que grande número de elementos independentes, transformadas de forma estável podem ser gerados dentro de algumas semanas, ao contrário de meses para plantas estáveis. Vectores CRISPR são muito eficazes na indução de mutações de ADN nas raízes 9,10. métodos de montagem de ADN eficiente ligar fragmentos de ADN contendo Overlapping extremidades 11. Uma grande vantagem de alguns métodos de montagem de ADN é a capacidade de incorporar ADNcs (isto é, os oligos) para os produtos montados. Desde gRNAs são apenas ~ 20 nt de comprimento e novos alvos pode ser feita com os oligos sintetizados, estes métodos de montagem de ADN são bem adequados para a clonagem de CRISPR. Os protocolos aqui descritos baseiam-se na série de vectores de p201 CRISPR que tem sido utilizado com sucesso em plantas de soja 10, 12 e choupo agora tomate. O procedimento de clonagem apresentado oferece várias vantagens sobre o método de clonagem de corrente 10. Nomeadamente, os vectores totalmente funcionais podem ser gerados numa única reacção de clonagem num único dia. construção do vector também podem ser agrupados para gerar múltiplos vetores CRISPR em paralelo, reduzindo ainda mais hands-on tempo e custos de materiais. Nós também apresentamos um protocolo para a geração de tomate raízes peludas como um método eficiente para a produção de materiais transgênicos com deleções de genes-alvo. raízes peludas são usados ​​para válidacomeu os vetores CRISPR e fornecer material para experimentos posteriores.

<table><tbody><tr><td>NEBuilder&amp;reg; (HiFi DNA assembly mix)</td><td>New England Biolabs</td><td>E5520</td><td></td></tr><tr><td>p201N:Cas9</td><td>Addgene</td><td>59175</td><td>The p201H:Cas9 plasmid (59176) is also compatible with the reported overlaps and enzymes.</td></tr><tr><td>pUC gRNA Shuttle</td><td>Addgene</td><td>47024</td><td></td></tr><tr><td>&lt;em&gt;Swa&lt;/em&gt;I</td><td>New England Biolabs</td><td>R0604S</td><td></td></tr><tr><td>&lt;em&gt;Spe&lt;/em&gt;I</td><td>New England Biolabs</td><td>R0133S</td><td></td></tr><tr><td>Zymo clean and concentrator-5 column purification</td><td>Zymo Research</td><td>D4003</td><td></td></tr><tr><td>NEB Buffer 2.1</td><td>New England Biolabs</td><td>B7202S</td><td></td></tr><tr><td>NEB CutSmart (Buffer 4)</td><td>New England Biolabs</td><td>B7204S</td><td></td></tr><tr><td>NEB Buffer 3.1</td><td>New England Biolabs</td><td>B7203S</td><td></td></tr><tr><td>EconoSpin Mini Spin Column (plasmid prep)</td><td>Epoch Life Sciences</td><td>1910-050/250</td><td></td></tr><tr><td>EcoRV-HF&amp;reg;</td><td>New England Biolabs</td><td>R3195S</td><td></td></tr><tr><td>StyI-HF&amp;reg;</td><td>New England Biolabs</td><td>R3500S</td><td></td></tr><tr><td>MS Salts + Gamborg Vitamins</td><td>Phytotechnology Laboratories</td><td>M404</td><td></td></tr><tr><td>Phytagel&amp;trade; (gellan gum)</td><td>Sigma Aldrich</td><td>P8169</td><td></td></tr><tr><td>GA-7 Boxes</td><td>Sigma Aldrich</td><td>V8505</td><td></td></tr><tr><td>Micropore&amp;trade; surgical tape</td><td>3M</td><td>1535-0</td><td></td></tr><tr><td>Timentin&amp;reg; (Ticarcillin/Clavulanic acid)</td><td>Various</td><td>0029-6571-26</td><td></td></tr><tr><td>Primers 5&#039; &amp;#8594; 3&#039;</td><td></td><td></td><td></td></tr><tr><td>SwaI_MtU6F&amp;nbsp;</td><td>&lt;strong&gt;GATATTAATCTCTTCGATGA&lt;br/&gt;AATTT&lt;/strong&gt;ATGCCTATCTTATAT&lt;br/&gt;GATCAATGAGG</td><td></td><td></td></tr><tr><td>MtU6R&amp;nbsp;&amp;nbsp;</td><td>AAGCCTACTGGTTCGCTTG&lt;br/&gt;AAG</td><td></td><td></td></tr><tr><td>ScaffoldF&amp;nbsp;</td><td>GTTTTAGAGCTAGAAATAGC&lt;br/&gt;AAGTT</td><td></td><td></td></tr><tr><td>&lt;em&gt;Spe&lt;/em&gt;I_Scaffold R</td><td>&lt;strong&gt;GTCATGAATTGTAATACGACTC&lt;br/&gt;A&lt;/strong&gt;AAAAAAAGCACCGACTCGGTG</td><td></td><td></td></tr><tr><td>StUbi3P218R&amp;nbsp;</td><td>ACATGCACCTAATTTCACTA&lt;br/&gt;GATGT</td><td></td><td></td></tr><tr><td>ISceIR</td><td>GTGATCGATTACCCTGTTAT&lt;br/&gt;CCCTAG</td><td>Cannot be used for Sanger sequencing since there is a second binding site on the plasmid</td><td></td></tr><tr><td>UNS1_Scaffold R&amp;nbsp;</td><td>GAGAATGGATGCGAGTAATGAA&lt;br/&gt;AAAAAGCACCGACTCGGTG</td><td></td><td></td></tr><tr><td>UNS1_MtU6 F&amp;nbsp;&amp;nbsp;</td><td>CATTACTCGCATCCATTCTCAT&lt;br/&gt;GCCTATCTTATATGATCAATGAGG</td><td></td><td></td></tr><tr><td>p201R&amp;nbsp;</td><td>CGCGCCGAATTCTAGTGATCG</td><td></td><td></td></tr><tr><td>Bolded sequences denote 20-nt overlaps with linearized p201N:Cas9.</td><td></td><td></td><td></td></tr></tbody></table>

high-throughput crispr vector construction and characterization of dna modifications by generation of tomato hairy roots

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for functional genomics studies. While most cloning strategies are simple to perform, they generally use multiple steps and can require several days to generate the ultimate constructs. The method presented here is based on DNA assembly and can produce fully functional CRISPR vectors in a single cloning reaction. Vector construction can also be pooled, further increasing the efficiency and utility of the process. A modification of the method is used to create CRISPR vectors with multiple gene targets. CRISPR vectors are then transformed into tomato hairy roots to generate transgenic materials with targeted DNA modifications. Hairy roots are a useful system for testing vector functionality as they are technically simple to generate and amenable to large-scale production. The methods presented here will have wide application as they can be used to generate a variety of CRISPR vectors and be used in a wide range of plant species.

construção CRISPR vector com montagem de DNA normalmente gera dezenas a centenas de clones independentes. Triagem Colony por PCR facilmente identifica clones corretos e pode distinguir entre plasmídeos com e sem inserções (Figura 2A) que é útil para solução de problemas. Normalmente, todos os clones contêm uma inserção e um usuário pode optar por ignorar as etapas de triagem colónia completamente. Digestões de diagnóstico (Figura 2B) e Sa...

Watch this Scientific Journal Video about High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots at JoVE.com

High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

De alto rendimento CRISPR Vector construção e caracterização de DNA Modificações pela geração de raízes de tomateiro Cabeludo

Usando o conjunto de DNA, vectores de múltiplos CRISPR podem ser construídos em paralelo numa única reacção de clonagem, tornando a construção de um grande número de vectores CRISPR uma tarefa simples. Tomate raízes peludas são um excelente sistema modelo para validar vetores CRISPR e gerar materiais mutantes.

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for ...

high-throughput-crispr-vector-construction-characterization-dna

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

17.9K visualizações.  Boyce Thompson Institute for Plant Research.  Usando o conjunto de DNA, vectores de múltiplos CRISPR podem ser construídos em paralelo numa única reacção de clonagem, tornando a construção de um grande número de vectores CRISPR uma tarefa simples. Tomate raízes peludas são um excelente sistema modelo para validar vetores CRISPR e gerar materiais mutantes. 

Vídeo: High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

Transient Expression in Nicotiana Benthamiana Leaves for Triterpene Production at a Preparative Scale

The triterpenes are one of the largest and most structurally diverse families of plant natural products. Many triterpene derivatives have been shown to possess medicinally relevant biological activity. However, thus far this potential has not translated into a plethora of triterpene-derived drugs in the clinic. This is arguably (at least partially) a consequence of limited practical synthetic access to this class of compound, a problem that can stifle the exploration of structure-activity relationships and development of lead candidates by traditional medicinal chemistry workflows. Despite their immense diversity, triterpenes are all derived from a single linear precursor, 2,3-oxidosqualene. Transient heterologous expression of biosynthetic enzymes in N. benthamiana can divert endogenous supplies of 2,3-oxidosqualene towards the production of new high-value triterpene products that are not naturally produced by this host. Agro-infiltration is an efficient and simple means of achieving transient expression in N. benthamiana. The process involves infiltration of plant leaves with a suspension of Agrobacterium tumefaciens carrying the expression construct(s) of interest. Co-infiltration of an additional A. tumefaciens strain carrying an expression construct encoding an enzyme that boosts precursor supply significantly increases yields. After a period of five days, the infiltrated leaf material can be harvested and processed to extract and isolate the resulting triterpene product(s). This is a process that is linearly and reliably scalable, simply by increasing the number of plants used in the experiment. Herein is described a protocol for rapid preparative-scale production of triterpenes utilizing this plant-based platform. The protocol utilizes an easily replicable vacuum infiltration apparatus, which allows the simultaneous infiltration of up to four plants, enabling batch-wise infiltration of hundreds of plants in a short period of time.

Transient Expression in Nicotiana Benthamiana Leaves for Triterpene Production at a Preparative Scale

Transient heterologous expression of biosynthetic enzymes in Nicotiana benthamiana leaves can divert endogenous supplies of 2,3-oxidosqualene towards the production of new high-value triterpene products. Herein is described a detailed protocol for rapid (5 days) preparative-scale production of triterpenes and analogs utilizing this powerful plant-based platform.

Expressão transiente em Nicotiana Benthamiana deixa triterpeno produção em escala preparativa

The triterpenes are one of the largest and most structurally diverse families of plant natural products. Many triterpene derivatives have been shown to ...

Bioquímica

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease

Ralstonia solanacearum is a devastating soil borne vascular pathogen that can infect a large range of plant species, causing an important threat to agriculture. However, the Ralstonia model is considerably underexplored in comparison to other models involving bacterial plant pathogens, such as Pseudomonas syringae in Arabidopsis. Research targeted to understanding the interaction between Ralstonia and crop plants is essential to develop sustainable solutions to fight against bacterial wilt disease but is currently hindered by the lack of straightforward experimental assays to characterize the different components of the interaction in native host plants. In this scenario, we have developed a method to perform genetic analysis of Ralstonia infection of tomato, a natural host of Ralstonia. This method is based on Agrobacterium rhizogenes-mediated transformation of tomato roots, followed by Ralstonia soil-drenching inoculation of the resulting plants, containing transformed roots expressing the construct of interest. The versatility of the root transformation assay allows performing either gene overexpression or gene silencing mediated by RNAi. As a proof of concept, we used this method to show that RNAi-mediated silencing of SlCESA6 in tomato roots conferred resistance to Ralstonia. Here, we describe this method in detail, enabling genetic approaches to understand bacterial wilt disease in a relatively short time and with small requirements of equipment and plant growth space.

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease

Here, we present a versatile method for tomato root transformation followed by inoculation with Ralstonia solanacearum to perform straightforward genetic analysis for the study of bacterial wilt disease.

Transformação da Raiz do Tomate Seguida de Inoculação com Ralstonia Solanacearum para Análise Genética Direta da Doença de Wilt Bacteriano

Ralstonia solanacearum is a devastating soil borne vascular pathogen that can infect a large range of plant species, causing an important threat to ...

Genética

Inducing Hairy Roots by Agrobacterium rhizogenes-Mediated Transformation in Tartary Buckwheat (Fagopyrum tataricum)

Tartary buckwheat (TB) [Fagopyrum tataricum (L.) Gaertn] possesses various biological and pharmacological activities because it contains abundant secondary metabolites such as flavonoids, especially rutin. Agrobacterium rhizogenes have been gradually used worldwide to induce hairy roots in medicinal plants to investigate gene functions and increase the yield of secondary metabolites. In this study, we have described a detailed method to generate A. rhizogenes-mediated hairy roots in TB. Cotyledons and hypocotyledonary axis at 7&#8211;10 days were selected as explants and infected with A. rhizogenes carrying a binary vector, which induced adventitious hairy roots that appeared after 1 week. The generated hairy root transformation was identified based on morphology, resistance selection (kanamycin), and reporter gene expression (green fluorescent protein). Subsequently, the transformed hairy roots were self-propagated as required. Meanwhile, a myeloblastosis (MYB) transcription factor, FtMYB116, was transformed into the TB genome using the A. rhizogenes-mediated hairy roots to verify the role of FtMYB116 in synthesizing flavonoids. The results showed that the expression of flavonoid-related genes and the yield of flavonoid compounds (rutin and quercetin) were significantly (p &#60; 0.01) promoted by FtMYB116, indicating that A. rhizogenes-mediated hairy roots can be used as an effective alternative tool to investigate gene functions and the production of secondary metabolites. The detailed step-by-step protocol described in this study for generating hairy roots can be adopted for any genetic transformation or other medicinal plants after adjustment.

Inducing Hairy Roots by Agrobacterium rhizogenes-Mediated Transformation in Tartary Buckwheat Fagopyrum tataricum

We describe a method of inducing hairy roots by Agrobacterium rhizogenes-mediated transformation in Tartary buckwheat (Fagopyrum tataricum). This can be used to investigate gene functions and production of secondary metabolites in Tartary buckwheat, be adopted for any genetic transformation, or used for other medicinal plants after improvement.

Indindo Raízes Peludas por Agrobacterium rhizogenes-Transformação Mediada em Trigo-Buck Tartary(Fagopyrum tataricum)

Tartary buckwheat (TB) [Fagopyrum tataricum (L.) Gaertn] possesses various biological and pharmacological activities because it contains abundant ...

CcCIPK14 Gene Function Analysis to Illuminate the Efficient Root Transgenic System

An efficient and stable transformation system is fundamental for gene function study and molecular breeding of plants. Here, we describe the use of an Agrobacterium rhizogenes mediated transformation system on pigeon pea. The stem is infected with A. rhizogenes carrying a binary vector, which induced callus after 7 days and adventitious roots 14 days later. The generated transgenic hairy root was identified by morphological analysis and a GFP reporter gene.To further illustrate the application range of this system, CcCIPK14 (Calcineurin B-like protein-interacting protein kinases) was transformed into pigeon pea using this transformation method. The transgenic plants were treated with jasmonic acid (JA) and abscisic acid (ABA), respectively, for the purpose of testing whether CcCIPK14 responds to those hormones. The results demonstrated that (1) exogenous hormones could significantly upregulate the expression levelof CcCIPK14, especially in CcCIPK14 over-expression (OE) plants; (2) the content of Genistein in CcCIPK14-OE lines was significantly higher than the control; (3) the expression level of two downstream key flavonoid synthase genes, CcHIDH1 and CcHIDH2, were up-regulated in the CcCIPK14-OE lines; and (4) the hairy root transgenic system can be used to study metabolically functional genes in non-model plants.

CcCIPK14 Gene Function Analysis to Illuminate the Efficient Root Transgenic System

Here we present an efficient and stable transformation system for the functional analysis of the CcCIPK14 gene as an example, providing a technical basis for studying the metabolism of non-model plants.

An efficient and stable transformation system is fundamental for gene function study and molecular breeding of plants. Here, we describe the use of an ...

Uma construção de biblioteca de plasmídeos UAS-cDNA/ORF de alto rendimento usando CRISPRmass

CRISPR-Based Modular Assembly for High-Throughput Construction of a UAS-cDNA/ORF Plasmid Library

Functional genomics screening offers a powerful approach to probe gene function and relies on the construction of genome-wide plasmid libraries. Conventional approaches for plasmid library construction are time-consuming and laborious. Therefore, we recently developed a simple and efficient method, CRISPR-based modular assembly (CRISPRmass), for high-throughput construction of a genome-wide upstream activating sequence-complementary DNA/open reading frame (UAS-cDNA/ORF) plasmid library. Here, we present a protocol for CRISPRmass, taking as an example the construction of a GAL4/UAS-based UAS-cDNA/ORF plasmid library. The protocol includes massively parallel two-step test tube reactions followed by bacterial transformation. The first step is to linearize the existing complementary DNA (cDNA) or open reading frame (ORF) cDNA or ORF library plasmids by cutting the shared upstream vector sequences adjacent to the 5&#39; end of cDNAs or ORFs using CRISPR/Cas9 together with single guide RNA (sgRNA), and the second step is to insert a UAS module into the linearized cDNA or ORF plasmids using a single step reaction. CRISPRmass allows the simple, fast, efficient, and cost-effective construction of various plasmid libraries. The UAS-cDNA/ORF plasmid library can be utilized for gain-of-function screening in cultured cells and for constructing a genome-wide transgenic UAS-cDNA/ORF library in Drosophila.&#160;

Autor em destaque: simplificando a construção da biblioteca de plasmídeos em todo o genoma usando CRISPRmass

We present a protocol for CRISPR-based modular assembly (CRISPRmass), a method for high-throughput construction of UAS-cDNA/ORF plasmid library in Drosophila using publicly available cDNA/ORF resources. CRISPRmass can be applied to editing various plasmid libraries.

Montagem modular baseada em CRISPR para construção de alto rendimento de uma biblioteca de plasmídeos UAS-cDNA/ORF

Functional genomics screening offers a powerful approach to probe gene function and relies on the construction of genome-wide plasmid libraries. ...

Rapid Assembly of Multi-Gene Constructs using Modular Golden Gate Cloning

The Golden Gate cloning method enables the rapid assembly of multiple genes in any user-defined arrangement. It utilizes type IIS restriction enzymes that cut outside of their recognition sites and create a short overhang. This modular cloning (MoClo) system uses a hierarchical workflow in which different DNA parts, such as promoters, coding sequences (CDS), and terminators, are first cloned into an entry vector. Multiple entry vectors then assemble into transcription units. Several transcription units then connect into a multi-gene plasmid. The Golden Gate cloning strategy is of tremendous advantage because it allows scar-less, directional, and modular assembly in a one-pot reaction. The hierarchical workflow typically enables the facile cloning of a large variety of multi-gene constructs with no need for sequencing beyond entry vectors. The use of fluorescent protein dropouts enables easy visual screening. This work provides a detailed, step-by-step protocol for assembling multi-gene plasmids using the yeast modular cloning (MoClo) kit. We show optimal and suboptimal results of multi-gene plasmid assembly and provide a guide for screening for colonies. This cloning strategy is highly applicable for yeast metabolic engineering and other situations in which multi-gene plasmid cloning is required.

The goal of this protocol is to provide a detailed, step-by-step guide for assembling multi-gene constructs using the modular cloning system based on Golden Gate cloning. It also gives recommendations on critical steps to ensure optimal assembly based on our experiences.

Montagem rápida de construções multigênicas usando clonagem modular de golden gate

The Golden Gate cloning method enables the rapid assembly of multiple genes in any user-defined arrangement. It utilizes type IIS restriction enzymes that ...

Bioengenharia

Produção de alta eficiência de raízes pilosas de soja transgênica

Soybean Hairy Root Transformation for the Analysis of Gene Function

Soybean (Glycine max) is a valuable crop in agriculture that has thousands of industrial uses. Soybean roots are the primary site of interaction with soil-borne microbes that form symbiosis to fix nitrogen and pathogens, which makes research involving soybean root genetics of prime importance to improve its agricultural production. The genetic transformation of soybean hairy roots (HRs) is mediated by the Agrobacterium rhizogenes strain NCPPB2659 (K599) and is an efficient tool for studying gene function in soybean roots, taking only 2 months from start to finish. Here, we provide a detailed protocol that outlines the method for overexpressing and silencing a gene of interest in soybean HRs. This methodology includes soybean seed sterilization, infection of cotyledons with K599, and the selection and harvesting of genetically transformed HRs for RNA isolation and, if warranted, metabolite analyses. The throughput of the approach is sufficient to simultaneously study several genes or networks and could determine the optimal engineering strategies prior to committing to long-term stable transformation approaches.

Autor em destaque: Transformação da raiz peluda da soja para a análise da função gênica  

Here, we present a protocol for the high-efficiency production of transgenic soybean hairy roots.

Transformação de raízes pilosas de soja para análise da função gênica

Soybean (Glycine max) is a valuable crop in agriculture that has thousands of industrial uses. Soybean roots are the primary site of interaction with ...

De alto rendimento CRISPR Vector construção e caracterização de DNA Modificações pela geração de raízes de tomateiro Cabeludo

Resumo

Explore mais vídeos

Capítulos neste vídeo

Expressão transiente em Nicotiana Benthamiana deixa triterpeno produção em escala preparativa

Transformação da Raiz do Tomate Seguida de Inoculação com Ralstonia Solanacearum para Análise Genética Direta da Doença de Wilt Bacteriano

Indindo Raízes Peludas por Agrobacterium rhizogenes-Transformação Mediada em Trigo-Buck Tartary(Fagopyrum tataricum)

CcCIPK14 Gene Function Analysis to Illuminate the Efficient Root Transgenic System

Montagem modular baseada em CRISPR para construção de alto rendimento de uma biblioteca de plasmídeos UAS-cDNA/ORF

Montagem modular baseada em CRISPR para construção de alto rendimento de uma biblioteca de plasmídeos UAS-cDNA/ORF

Montagem modular baseada em CRISPR para construção de alto rendimento de uma biblioteca de plasmídeos UAS-cDNA/ORF

Montagem rápida de construções multigênicas usando clonagem modular de golden gate

Transformação de raízes pilosas de soja para análise da função gênica

Transformação de raízes pilosas de soja para análise da função gênica