Work in the S.H. laboratory was supported by the DFG through SFB1064 (project ID 213249687), the European Research Council (ERC Starting Grant 852798 ConflictResolution), and the Helmholtz Gesellschaft.

Locus-Specific Chromatin Isolation from Yeast Cells

<ol>
	<li>Kornberg, R. D., Lorch, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Twenty-five+years+of+the+nucleosome,+fundamental+particle+of+the+eukaryote+chromosome.">Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome.</a> Cell. 98 (3), 285-294 (1999).</li><li>Gauchier, M., van Mierlo, G., Vermeulen, M., D&#233;jardin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+and+enrichment+of+specific+chromatin+loci.">Purification and enrichment of specific chromatin loci.</a> Nature Methods. 17 (4), 380-389 (2020).</li><li>Korthout, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decoding+the+chromatin+proteome+of+a+single+genomic+locus+by+DNA+sequencing.">Decoding the chromatin proteome of a single genomic locus by DNA sequencing.</a> PLoS Biology. 16 (7), e2005542 (2018).</li><li>Ant&#227;o, J. M., Mason, J. M., D&#233;jardin, J., Kingston, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+landscape+at+Drosophila+melanogaster+telomere-associated+sequence+repeats.">Protein landscape at Drosophila melanogaster telomere-associated sequence repeats.</a> Molecular and Cellular Biology. 32 (12), 2170-2182 (2012).</li><li>D&#233;jardin, J., Kingston, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+proteins+associated+with+specific+genomic+loci.">Purification of proteins associated with specific genomic loci.</a> Cell. 136 (1), 175-186 (2009).</li><li>Ide, S., Dejardin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=End-targeting+proteomics+of+isolated+chromatin+segments+of+a+mammalian+ribosomal+RNA+gene+promoter.">End-targeting proteomics of isolated chromatin segments of a mammalian ribosomal RNA gene promoter.</a> Nature Communications. 6, 6674 (2015).</li><li>Unnikrishnan, A., Gafken, P. R., Tsukiyama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+changes+in+histone+acetylation+regulate+origins+of+DNA+replication.">Dynamic changes in histone acetylation regulate origins of DNA replication.</a> Nature Structural &amp;amp; Molecular Biology. 17 (4), 430 (2010).</li><li>Buxton, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elucidating+protein-DNA+interactions+in+human+alphoid+chromatin+via+hybridization+capture+and+mass+spectrometry.">Elucidating protein-DNA interactions in human alphoid chromatin via hybridization capture and mass spectrometry.</a> Journal of Proteome Research. 16 (9), 3433-3442 (2017).</li><li>Kennedy-Darling, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+chromatin-associated+proteins+via+sequence-specific+capture+and+mass+spectrometric+protein+identification+in+Saccharomyces+cerevisiae.">Discovery of chromatin-associated proteins via sequence-specific capture and mass spectrometric protein identification in Saccharomyces cerevisiae.</a> Journal of Proteome Research. 13 (8), 3810-3825 (2014).</li><li>Liu, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPRi-based+genome-scale+identification+of+functional+long+noncoding+RNA+loci+in+human+cells.">CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells.</a> Science. 355, 7111 (2017).</li><li>Hamperl, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+specific+chromatin+domains+from+single-copy+gene+loci+in+Saccharomyces+cerevisiae.">Purification of specific chromatin domains from single-copy gene loci in Saccharomyces cerevisiae.</a> Functional Analysis of DNA and Chromatin. 1094, 329-341 (2014).</li><li>Hamperl, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Compositional+and+structural+analysis+of+selected+chromosomal+domains+from+Saccharomyces+cerevisiae.">Compositional and structural analysis of selected chromosomal domains from Saccharomyces cerevisiae.</a> Nucleic Acids Research. 42 (1), 2 (2014).</li><li>Wei&#946;, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-copy+locus+proteomics+of+early-+and+late-firing+DNA+replication+origins+identifies+a+role+of+Ask1/DASH+complex+in+replication+timing+control.">Single-copy locus proteomics of early- and late-firing DNA replication origins identifies a role of Ask1/DASH complex in replication timing control.</a> Cell Reports. 42 (2), 112045 (2023).</li><li>Gietz, R. D., Schiestl, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+yeast+transformation+using+the+LiAc/SS+carrier+DNA/PEG+method.">High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method.</a> Nature Protocols. 2 (1), 31-34 (2007).</li><li>Laemmli, U. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cleavage+of+structural+proteins+during+the+assembly+of+the+head+of+bacteriophage+T4.">Cleavage of structural proteins during the assembly of the head of bacteriophage T4.</a> Nature. 227 (5259), 680-685 (1970).</li><li>Towbin, H., Staehelin, T., Gordon, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+transfer+of+proteins+from+polyacrylamide+gels+to+nitrocellulose+sheets:+procedure+and+some+applications.">Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.</a> Proceedings of the National Academy of Sciences of the United States of America. 76 (9), 4350-4354 (1979).</li><li>Western blot membrane stripping for restaining protocol. Abcam Available from: <a target="_blank" href="https://www.abcam.com/protocols/western-blot-membrane-stripping-for-restaining-protocol">https://www.abcam.com/protocols/western-blot-membrane-stripping-for-restaining-protocol</a> (2023)</li><li>Vermeulen, M., D&#233;jardin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Locus-specific+chromatin+isolation.">Locus-specific chromatin isolation.</a> Nature Reviews. Molecular Cell Biology. 21 (5), 249-250 (2020).</li></ol>

The authors have no conflicts of interest to disclose.

The identification of the factors and chromatin landscape of a specific target genomic region continues to pose a major challenge in chromatin research18. This protocol describes an efficient system to specifically excise and purify distinct chromatin domains from yeast chromosomes. To our knowledge, the purity and yield of this single-step purification overcome many of the limitations of locus-specific chromatin purification methods, thus allowing for the achievement of very high enrichment of th...

The dynamic organization of eukaryotic genomes into chromatin compacts the DNA to fit within the confines of the nucleus while ensuring sufficient dynamics for gene expression and accessibility for regulatory factors. In part, this versatility is mediated by the nucleosome, the basic unit of chromatin, which comprises a core particle with 147 bp of DNA wrapped ~1.7 times around the histone octamer1. The nucleosome is a highly dynamic structure with respect to its composition, with numerous histone variants and posttranslational modifications (PTMs) on the N- and C-terminal histone tails. Furthermore, eukaryotic chromatin interacts with a multitude of other essential components, such as transcription factors, DNA and RNA processing machinery, architectural proteins, enzymes involved in chromatin remodeling and modification, and RNA molecules associated with chromatin. These crucial machineries involved in transcription, replication, and repair all require access to chromatin, which serves as the natural substrate for these processes. Consequently, comprehending the molecular mechanisms underlying these DNA transactions necessitates a precise definition of the collective alterations in chromatin structure at the specific genomic regions where these machineries converge and facilitate biological reactions.
Despite the identification of numerous chromatin factors through genetics and protein-protein interaction studies, performing direct, unbiased, and comprehensive analyses of chromatin interactions at particular genomic sites has remained a significant obstacle2,3. Initially, only highly abundant regions of the genome (i.e., repetitive loci) or multi-copy plasmids could be isolated in sufficient amounts and purity for mass spectrometric identification of the associated proteins4,5,6,7. A series of new approaches based on the direct hybridization of capture probes to chromatinized DNA, proximity biotinylation using the CRISPR-dCas9 system, or the binding of sequence-specific adapter proteins to the locus of interest have started to unravel the proteome of single-copy loci from yeast and mammalian genomes8,9,10. However, all these methods require formaldehyde crosslinking to stabilize the protein-DNA interactions and sonication to solubilize the chromatin for subsequent purification. Together, both manipulations exclude the possibility of subsequent structural and functional studies of the purified chromatin.
To overcome these limitations, we previously devised a methodology that employs site-specific recombination to extract targeted chromosomal domains from yeast11,12. In essence, the genomic region of interest is surrounded by recognition sites (RS) for the site-specific R-recombinase from Zygosaccharomyces rouxi while simultaneously incorporating a group of three DNA binding sites for the prokaryotic transcriptional repressor LexA protein (LexA) within the same region. The yeast cells contain an expression cassette for the simultaneous expression of R-recombinase and a LexA protein fused to a tandem affinity purification (TAP) tag. After the induction of R-recombinase, the enzyme efficiently excises the targeted region from the chromosome in the form of a circular chromatin domain. This domain can be purified via the LexA-TAP adapter protein, which binds to the LexA DNA binding sites, as well as to an affinity support. This method has been recently used to isolate distinct chromatin domains containing selected replication origins of yeast chromosome III13.
One major advantage of this ex vivo approach is that it allows for functional analyses of the isolated material. For example, replication origin domains purified with this method can be subjected to in vitro replication assays to assess the efficiency of origin firing in a test tube from native in vivo assembled chromatin templates. Ultimately, the biochemical and functional characterization of the isolated material may allow the reconstitution of nuclear processes using purified proteins together with the native chromatin template. In summary, this methodology opens an exciting avenue in chromatin research, as it will be possible to follow the collective compositional and structural chromatin changes of a specific genomic region undergoing a certain chromosomal transaction.

<table><tbody><tr><td>&lt;strong&gt;Yeast strains&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Control Strain:&lt;/strong&gt; MATa; ura3&amp;Delta;0; leu2&amp;Delta;0; his3&amp;Delta;1; met15&amp;Delta;0; bar1::kanMX4; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR</td><td></td><td></td><td>Section 1, see references 13 and 14</td></tr><tr><td>&lt;strong&gt;Recombination Strain:&lt;/strong&gt; MATa; ura3&amp;Delta;0; leu2&amp;Delta;0; his3&amp;Delta;1; met15&amp;Delta;0; bar1::kanMX4; RS_LEXA_NS-3_ARS316_NS+3_RS; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR</td><td></td><td></td><td>Section 1, see reference 13 and 14</td></tr><tr><td>&lt;strong&gt;Plasmid&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>K238 plasmid</td><td></td><td></td><td>Section 1, see reference 13&lt;br/&gt; Storage: Store at -20 &amp;deg;C</td></tr><tr><td>K071 Spike-in plasmid DNA</td><td></td><td></td><td>Section 7.1, see reference 13&lt;br/&gt; Storage: Store at -20 &amp;deg;C</td></tr><tr><td>&lt;strong&gt;Reagents&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Acetone</td><td>Carl Roth</td><td>5025.1</td><td>Section 2&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Ammonium acetate (NH&lt;sub&gt;4&lt;/sub&gt;Ac)</td><td>Sigma Aldrich</td><td>A7262</td><td>Section 6 and 7.1&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Ammonium solution (NH&lt;sub&gt;4&lt;/sub&gt;OH) 25%</td><td>Merck Millipore</td><td>533003</td><td>Section 6&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Ammonium sulfate</td><td>Santa Cruz</td><td>Sc-29085</td><td>Section 2&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Bacto agar</td><td>BD (VWR)</td><td>90000-760</td><td>Section 3&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Bacto peptone</td><td>BD (VWR)</td><td>211820</td><td>Section 3&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>&amp;beta;-Mercaptoethanol</td><td>Sigma Aldrich</td><td>07604</td><td>Section 7.2&lt;br/&gt; Storage: Store at 4 &amp;deg;C</td></tr><tr><td>Chemiluminescent substrate kit</td><td>ThermoFisher</td><td>34580</td><td>Section 7.2&lt;br/&gt; Storage: Store at 4 &amp;deg;C</td></tr><tr><td>Di-Sodium Hydrogen phosphate dodecahydrate</td><td>Merck</td><td>1.06579.1000</td><td>Section 2 and 7.1&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Dithiothreitol (DTT)</td><td>ThermoFisher</td><td>15508013</td><td>Section 4&lt;br/&gt; Storage: Store at 4 &amp;deg;C</td></tr><tr><td>Ethanol</td><td>Merck</td><td>100983</td><td>Section 7.1&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Ethylenediaminetetraacetic acid (EDTA)</td><td>Sigma Aldrich</td><td>ED</td><td>Section 7.1&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Galactose (20% (w/v) stock)</td><td>Sigma Aldrich</td><td>G0625-1KG&amp;nbsp; /&amp;nbsp; 5KG</td><td>Section 3&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Gel loading dye (6x)</td><td>BioLabs</td><td>B7024A</td><td>Section 7.1&lt;br/&gt; Storage: Store at -20 &amp;deg;C</td></tr><tr><td>Glusose</td><td>Sigma-Aldrich</td><td>G8270</td><td>Section&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Glycine</td><td>Carl Roth</td><td>.0079.4</td><td>Section 2&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Glycogen (5 mg/mL)</td><td>Invitrogen</td><td>AM9510</td><td>Section 7.1&lt;br/&gt; Storage: Store at -20 &amp;deg;C</td></tr><tr><td>Hydrochloric acid (HCl)</td><td>PanReac AppliChem</td><td>182109.1211</td><td>Section 2, 4 and 7.1&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Magnesium Acetate (MgAc)</td><td>Bernd Kraft</td><td>15274.2600/C035</td><td>Section 4&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Magnesium chloride (MgCl&lt;sub&gt;2&lt;/sub&gt;)</td><td>Sigma Aldrich</td><td>M8266</td><td>Section 6&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Nu PAGE LDS sample buffer (4x)</td><td>Invitrogen</td><td>2399549</td><td>Section 7.2&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Phenol/Chloroform/Isoamyl alcohol (25:24:1 v/v)</td><td>Invitrogen</td><td>15593-031</td><td>Section 7.1&lt;br/&gt; Storage: Store at 4 &amp;deg;C</td></tr><tr><td>Potassium chloride (KCl)</td><td>Sigma</td><td>P9541</td><td>Section 4&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Radioactively labeled &amp;alpha;-32P dATP (3,000 Ci/mmol, 10 mCi/mL)</td><td>Hartmann Analytic</td><td>SRP-203</td><td>Section 7.1&lt;br/&gt; Storage: Store at 4 &amp;deg;C</td></tr><tr><td>RadPrime labeling system</td><td>ThermoFisher</td><td>18428-011</td><td>Section 7.1&lt;br/&gt; Storage: Store at -20 &amp;deg;C</td></tr><tr><td>Raffinose (20% (w/v) stock)</td><td>SERVA</td><td>34140.03</td><td>Section 3&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Sodium chloride (NaCl)</td><td>Merck</td><td>K53710504142</td><td>Section 7.1&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Sodium citrate (Na3C6H5O7)</td><td>Sigma-Aldrich</td><td>71402</td><td>Section 7.1&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Sodium hydroxide (NaOH)</td><td>Sigma Aldrich</td><td>S5881</td><td>Section 7.1&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Sodium n-dodecyl sulfate (SDS) (5% stock (w/v) )</td><td>Alfa Aesar</td><td>A11183</td><td>Section 7.1&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Sodium phosphate monobasic</td><td>Sigma-Aldrich</td><td>71496</td><td>Section 2 and 7.1&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Sodium&amp;nbsp;azide</td><td>Santa Cruz&amp;nbsp;Biotechnology</td><td>sc-208393</td><td>Section 2&lt;br/&gt; Storage: Store at -20 &amp;deg;C</td></tr><tr><td>&amp;nbsp;Triethylamine</td><td>Sigma Aldrich</td><td>90340</td><td>Section 2&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Tris base</td><td>Chem Cruz</td><td>SC-3715B</td><td>Section 2 and 4&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Triton X-100</td><td>Sigma Aldrich</td><td>X100</td><td>Section 2 and 4&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Tween-20</td><td>Bernd Kraft</td><td>18014332</td><td>Section 4&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Yeast extract</td><td>BD (VWR)</td><td>212720</td><td>Section 3&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Yeast mating factor alpha (1 &amp;micro;g/mL stock )</td><td>&amp;nbsp;Biomol</td><td>Y2016.5</td><td>Section 3&lt;br/&gt; Storage: Store at -20 &amp;deg;C</td></tr><tr><td>Yeast Synthetic Drop-out medium Supplements without LEUCINE</td><td>Sigma Aldrich</td><td>Y1376</td><td>Section 1, see reference 14</td></tr><tr><td>&lt;strong&gt;Enzymes&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>HpaI restriction enzyme (5,000 U/mL)</td><td>NEB</td><td>R0105S</td><td>Section 7.1&lt;br/&gt; Storage: Store at -20 &amp;deg;C</td></tr><tr><td>Protease and Phosphatase Inhibitor Cocktail (100x)</td><td>ThermoFisher Scientific</td><td>78446</td><td>Section 4&lt;br/&gt; Storage: Store at4 &amp;deg;C</td></tr><tr><td>Proteinase K (10 mg/mL)</td><td>SERVA</td><td>33756</td><td>Section 7.1&lt;br/&gt; Storage: Store at -20 &amp;deg;C</td></tr><tr><td>RNase A (10 mg/mL)</td><td>&amp;nbsp;ThermoFisher</td><td>EN0531</td><td>Section 7.1&lt;br/&gt; Storage: Store at -20 &amp;deg;C</td></tr><tr><td>TEV protease (10000 U/&amp;micro;L)</td><td>NEB</td><td>P8112S</td><td>Section 5&lt;br/&gt; Storage: Store at -20 &amp;deg;C</td></tr><tr><td>&lt;strong&gt;Materials&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>BcMag Epoxy-Activated Magnetic Beads</td><td>Bioclone Inc.</td><td>FC-102</td><td>Section 2&lt;br/&gt; Storage: Store at 4 &amp;deg;C</td></tr><tr><td>Dry ice</td><td></td><td></td><td>Section 4</td></tr><tr><td>Low-binding centrifuge tubes 2.0 mL</td><td>Eppendorf</td><td>22431102</td><td>Section 4</td></tr><tr><td>Microspin&amp;nbsp;G-25 Columns</td><td>Cytiva</td><td>27-5325-01</td><td>Section 7.1&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>Parafilm</td><td>Merck</td><td>P7793</td><td>Section 4</td></tr><tr><td>Positive nylon membrane</td><td>Biozol</td><td>11MEMP0001</td><td>Section 7.1&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>PVDF transfer membrane</td><td>Immobilon-Merck Millipore</td><td>IPVH00010</td><td>Section 7.2&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>SDS-PAGE gel 4-12% bis-tris (15 well, 1.5 mm)</td><td>Invitrogen</td><td>&amp;nbsp;NP0336BOX</td><td>Section 7.2&lt;br/&gt; Storage: Store at 4 &amp;deg;C</td></tr><tr><td>Syringe (25 mL) with luer fitting</td><td>Henke Sass Wolf</td><td>4200-000V0</td><td>Section 3</td></tr><tr><td>Whatman paper (Grade 3MM CHR Cellulose Western Blotting Paper Sheet)</td><td>Cytiva</td><td>3030-917</td><td>Section 7.1&lt;br/&gt; Storage: Store at room temperature</td></tr><tr><td>&lt;strong&gt;Antibodies&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Anti-LexA, rabbit polyclonal IgG, DNA binding region antibody</td><td>Merck Millipore</td><td>06-719</td><td>Section 7.2&lt;br/&gt; Storage: Store at -20 &amp;deg;C</td></tr><tr><td>Goat Anti-Rabbit IgG (H+L), Horseradish peroxidase conjugate</td><td>Invitrogen</td><td>G21234</td><td>Section 7.2&lt;br/&gt; Storage: Store at -20 &amp;deg;C</td></tr><tr><td>Peroxidase Anti-Peroxidase (PAP) antibody produced in rabbit for the detection of TAP-tagged proteins</td><td>Sigma Aldrich</td><td>P1291-500UL</td><td>Section 7.2&lt;br/&gt; Storage: Store at -20 &amp;deg;C</td></tr><tr><td>Rabbit IgG antibodies</td><td>Sigma</td><td>I5006-100MG</td><td>Section 2&lt;br/&gt; Storage: Store at 4 &amp;deg;C</td></tr><tr><td>&lt;strong&gt;Primers (10 &amp;micro;M)&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;ARS316:&lt;/strong&gt; fwd 5&#039;- CGGCATTATCGTACACAACCT, rev 5&#039;- GTTCTTCGTTGCCTACATTTTCT</td><td></td><td></td><td>Section 7.1</td></tr><tr><td>&lt;strong&gt;K071 Spike-in plasmid DNA:&lt;/strong&gt; fwd: 5&#039;-TTTTCGCTGCTTGTCCTTTT, rev 5&#039;- CATTTTCGTCCTCCCAACAT</td><td></td><td></td><td>Section 7.1</td></tr><tr><td>&lt;strong&gt;PCR fragment from yeast genomic DNA as a template &amp;nbsp;for ARS316 amplification (for southern blot):&lt;/strong&gt; fwd 5&amp;rsquo;- AAATTCTGCCCTTGATTCGT&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp; rev 5&amp;rsquo;- TTTGTTTATCTCATCACTAAT</td><td></td><td></td><td>Section 7.1</td></tr><tr><td>&lt;strong&gt;PDC1:&lt;/strong&gt; fwd 5&#039;- CATGATCAGATGGGGCTTCA, rev 5&#039;-ACCGGTGGTAGCGACTCTGT</td><td></td><td></td><td>Section 7.1</td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Coffee grinder</td><td>Gastroback</td><td>42601</td><td>Section 4</td></tr><tr><td>Dewar flask</td><td>NAL GENE</td><td>4150-2000</td><td>Section 3</td></tr><tr><td>DynaMag TM-2 magnetic rack</td><td>Invitrogen</td><td>12321D</td><td>Section 4, 5 and 6</td></tr><tr><td>Hybridization oven</td><td>Hybaid Mini10</td><td>Ri418</td><td>Section 2</td></tr><tr><td>Microcentrifuge</td><td>Eppendorf</td><td>5424R</td><td>Section 4 and 7.1</td></tr><tr><td>UV-crosslinker</td><td>Analytikjena</td><td>95-0174-02</td><td>Section 7.1</td></tr></tbody></table>

single-copy gene locus chromatin purification in saccharomyces cerevisiae

The basic organizational unit of eukaryotic chromatin is the nucleosome core particle (NCP), which comprises DNA wrapped ~1.7 times around a histone octamer. Chromatin is defined as the entity of NCPs and numerous other protein complexes, including transcription factors, chromatin remodeling and modifying enzymes. It is still unclear how these protein-DNA interactions are orchestrated at the level of specific genomic loci during different stages of the cell cycle. This is mainly due to the current technical limitations, which make it challenging to obtain precise measurements of such dynamic interactions. Here, we describe an improved method combining site-specific recombination with an efficient single-step affinity purification protocol to isolate a single-copy gene locus of interest in its native chromatin state. The method allows for the robust enrichment of the target locus over genomic chromatin, making this technique an effective strategy for identifying and quantifying protein interactions in an unbiased and systematic manner, for example by mass spectrometry. Further to such compositional analyses, native chromatin purified by this method likely reflects the in vivo situation regarding nucleosome positioning and histone modifications and is, therefore, amenable to further structural and biochemical analyses of chromatin derived from virtually any genomic locus in yeast.

The purification of the ~1.4 kb ARS316 chromatin domain was mediated by the constitutively expressed LexA-TAP adapter protein. To serve as a negative control, we conducted purifications using an isogenic strain that expresses LexA-TAP but does not contain integrated RS and LexA-binding sites. Figure 3 illustrates the DNA analysis outcome from a standard purification experiment performed on both the control and a recombination-competent strain targeting the ARS316 locus. After DNA isolation a...

Watch this Scientific Journal Video about Advancing Chromatin Research and Overcoming Limitations with a High-Enrichment Locus-Specific Chromatin Isolation Protocol at JoVE.com

Author Spotlight: Advancing Chromatin Research and Overcoming Limitations with a High-Enrichment Locus-Specific Chromatin Isolation Protocol 

This protocol presents a locus-specific chromatin isolation method based on site-specific recombination to purify a single-copy gene locus of interest in its native chromatin context from budding yeast, Saccharomyces cerevisiae.

Single-Copy Gene Locus Chromatin Purification in Saccharomyces cerevisiae

The basic organizational unit of eukaryotic chromatin is the nucleosome core particle (NCP), which comprises DNA wrapped ~1.7 times around a histone ...

single-copy-gene-locus-chromatin-purification-saccharomyces

Universidad de Cartagena UDEC

Research

JoVE Journal

Biochemistry

967 Views.  Helmholtz Zentrum München. This protocol presents a locus-specific chromatin isolation method based on site-specific recombination to purify a single-copy gene locus of interest in its native chromatin context from budding yeast, Saccharomyces cerevisiae.

Video: Author Spotlight: Advancing Chromatin Research and Overcoming Limitations with a High-Enrichment Locus-Specific Chromatin Isolation Protocol 

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug used to treat depression and anxiety by binding to the serotonin transporter with high-affinity, blocking serotonin reuptake. Here we report an efficient procedure and a set of tools to stabilize, express, purify, and crystallize serotonin transporter-antibody complexes bound to S-citalopram and other antidepressants. Mutations which stabilize the serotonin transporter were identified using an S-citalopram binding assay. Serotonin transporter expressed in baculovirus-transduced HEK293S GnTI- cells, was reconstituted into proteoliposomes and used to raise high-affinity antibodies. We have developed a strategy to discover antibodies that are useful for structural studies. A straightforward approach for the expression of antibody fragments in Sf9 cells has also been established. Transporter-antibody complexes purified using this procedure are well-behaved and readily crystallize, producing complexes with S-citalopram that diffract X-rays to 3-4 &#197; resolution. The strategies developed here can be utilized to determine the structure of other challenging membrane proteins.

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

This manuscript describes how to screen for thermostabilizing mutations, purify the human serotonin transporter, generate high affinity antibodies, and crystallize the serotonin transporter-antibody complex bound to the antidepressant drug S-citalopram. This protocol can be adapted to the study of other challenging membrane transporters, receptors, and channels.

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug ...

Expression, Purification, and Antimicrobial Activity of S100A12

Calgranulin proteins are important mediators of innate immunity and are members of the S100 class of the EF-hand family of calcium binding proteins. Some S100 proteins have the capacity to bind transition metals with high affinity and effectively sequester them away from invading microbial pathogens in a process that is termed "nutritional immunity". S100A12 (EN-RAGE) binds both zinc and copper and is highly abundant in innate immune cells such as macrophages and neutrophils. We report a refined method for the expression, enrichment and purification of S100A12 in its active, metal-binding configuration. Utilization of this protein in bacterial growth and viability analyses reveals that S100A12 has antimicrobial activity against the bacterial pathogen, Helicobacter pylori. The antimicrobial activity is predicated on the zinc-binding activity of S100A12, which chelates nutrient zinc, thereby starving H. pylori which requires zinc for growth and proliferation.

Here, we present a method to express and purify S100A12 (calgranulin C). We describe a protocol to measure its antimicrobial activity against the human pathogen H. pylori.

Calgranulin proteins are important mediators of innate immunity and are members of the S100 class of the EF-hand family of calcium binding proteins. Some ...

Genome-wide Mapping of Protein-DNA Interactions with ChEC-seq in Saccharomyces cerevisiae

Genome-wide mapping of protein-DNA interactions is critical for understanding gene regulation, chromatin remodeling, and other chromatin-resident processes. Formaldehyde crosslinking followed by chromatin immunoprecipitation and high-throughput sequencing (X-ChIP-seq) has been used to gain many valuable insights into genome biology. However, X-ChIP-seq has notable limitations linked to crosslinking and sonication. Native ChIP avoids these drawbacks by omitting crosslinking, but often results in poor recovery of chromatin-bound proteins. In addition, all ChIP-based methods are subject to antibody quality considerations. Enzymatic methods for mapping protein-DNA interactions, which involve fusion of a protein of interest to a DNA-modifying enzyme, have also been used to map protein-DNA interactions. We recently combined one such method, chromatin endogenous cleavage (ChEC), with high-throughput sequencing as ChEC-seq. ChEC-seq relies on fusion of a chromatin-associated protein of interest to micrococcal nuclease (MNase) to generate targeted DNA cleavage in the presence of calcium in living cells. ChEC-seq is not based on immunoprecipitation and so circumvents potential concerns with crosslinking, sonication, chromatin solubilization, and antibody quality while providing high resolution mapping with minimal background signal. We envision that ChEC-seq will be a powerful counterpart to ChIP, providing an independent means by which to both validate ChIP-seq findings and discover new insights into genomic regulation.

Genome-wide Mapping of Protein-DNA Interactions with ChEC-seq in Saccharomyces cerevisiae

We describe chromatin endogenous cleavage coupled with high-throughput sequencing (ChEC-seq), a chromatin immunoprecipitation (ChIP)-orthogonal method for mapping protein binding sites genome-wide with micrococcal nuclease (MNase) fusion proteins.

Genome-wide mapping of protein-DNA interactions is critical for understanding gene regulation, chromatin remodeling, and other chromatin-resident ...

Genetics

Chromatin Immunoprecipitation (ChIP) of Histone Modifications from Saccharomyces cerevisiae

Histone post-translational modifications (PTMs), such as acetylation, methylation and phosphorylation, are dynamically regulated by a series of enzymes that add or remove these marks in response to signals received by the cell. These PTMS are key contributors to the regulation of processes such as gene expression control and DNA repair. Chromatin immunoprecipitation (chIP) has been an instrumental approach for dissecting the abundance and localization of many histone PTMs throughout the genome in response to diverse perturbations to the cell. Here, a versatile method for performing chIP of post-translationally modified histones from the budding yeast Saccharomyces cerevisiae (S. cerevisiae) is described. This method relies on crosslinking of proteins and DNA using formaldehyde treatment of yeast cultures, generation of yeast lysates by bead beating, solubilization of chromatin fragments by micrococcal nuclease, and immunoprecipitation of histone-DNA complexes. DNA associated with the histone mark of interest is purified and subjected to quantitative PCR analysis to evaluate its enrichment at multiple loci throughout the genome. Representative experiments probing the localization of the histone marks H3K4me2 and H4K16ac in wildtype and mutant yeast are discussed to demonstrate data analysis and interpretation. This method is suitable for a variety of histone PTMs and can be performed with different mutant strains or in the presence of diverse environmental stresses, making it an excellent tool for investigating changes in chromatin dynamics under different conditions.

Chromatin Immunoprecipitation ChIP of Histone Modifications from Saccharomyces cerevisiae

Here, we describe a protocol for chromatin immunoprecipitation of modified histones from the budding yeast Saccharomyces cerevisiae. Immunoprecipitated DNA is subsequently used for quantitative PCR to interrogate the abundance and localization of histone post-translational modifications throughout the genome.

Histone post-translational modifications (PTMs), such as acetylation, methylation and phosphorylation, are dynamically regulated by a series of enzymes ...

Improved Protocol for Chromatin Immunoprecipitation from Mouse Skeletal Muscle

We describe an efficient and reproducible protocol for the preparation of chromatin from adult mouse skeletal muscle, a physically resistant tissue with a high content of structural proteins. Dissected limb muscles from adult mice are physically disrupted by mechanical homogenisation, or a combination of mincing and douncing, in a hypotonic buffer before formaldehyde fixation of the cell lysate. The fixed nuclei are purified by further cycles of mechanical homogenisation or douncing and sequential filtrations to remove cell debris. The purified nuclei can be sonicated immediately or at a later stage after freezing. The chromatin can be efficiently sonicated and is suitable for chromatin immunoprecipitation experiments, as illustrated by the profiles obtained for transcription factors, RNA polymerase II, and covalent histone modifications. The binding events detected using chromatin prepared by this protocol are predominantly those taking place in the muscle fiber nuclei despite the presence of chromatin from other fiber-associated satellite and endothelial cells. This protocol is therefore adapted to study gene regulation in the adult mouse skeletal muscle.

A novel protocol for the preparation of chromatin from adult mouse skeletal muscle adapted to the study of gene regulation in muscle fibers by chromatin immunoprecipitation is presented.

We describe an efficient and reproducible protocol for the preparation of chromatin from adult mouse skeletal muscle, a physically resistant tissue with a ...

High Sensitivity Measurement of Transcription Factor-DNA Binding Affinities by Competitive Titration Using Fluorescence Microscopy

Accurate quantification of transcription factor (TF)-DNA interactions is essential for understanding the regulation of gene expression. Since existing approaches suffer from significant limitations, we have developed a new method for determining TF-DNA binding affinities with high sensitivity on a large scale. The assay relies on the established fluorescence anisotropy (FA) principle but introduces important technical improvements. First, we measure a full FA competitive titration curve in a single well by incorporating TF and a fluorescently labeled reference DNA in a porous agarose gel matrix. Unlabeled DNA oligomer is loaded on the top as a competitor and, through diffusion, forms a spatio-temporal gradient. The resulting FA gradient is then read out using a customized epifluorescence microscope setup. This improved setup greatly increases the sensitivity of FA signal detection, allowing both weak and strong binding to be reliably quantified, even for molecules of similar molecular weights. In this fashion, we can measure one titration curve per well of a multi-well plate, and through a fitting procedure, we can extract both the absolute dissociation constant (KD) and active protein concentration. By testing all single-point mutation variants of a given consensus binding sequence, we can survey the entire binding specificity landscape of a TF, typically on a single plate. The resulting position weight matrices (PWMs) outperform those derived from other methods in predicting in vivo TF occupancy. Here, we present a detailed guide for implementing HiP-FA on a conventional automated fluorescent microscope and the data analysis pipeline.

Here we present a novel method for determining binding affinities at equilibrium and in solution with high sensitivity on a large scale. This improves the quantitative analysis of transcription factor-DNA binding. The method is based on automated fluorescence anisotropy measurements in a controlled delivery system.

Accurate quantification of transcription factor (TF)-DNA interactions is essential for understanding the regulation of gene expression. Since existing ...

A Suppressor Screen for the Characterization of Genetic Links Regulating Chronological Lifespan in Saccharomyces cerevisiae

Aging is the time dependent deterioration of an organism&#8217;s normal biological processes that increases the probability of death. Many genetic factors contribute to alterations in the normal aging process. These factors intersect in complex ways, as evidenced by the wealth of documented links identified and conserved in many organisms. Most of these studies focus on loss-of-function, null mutants that allow for rapid screening of many genes simultaneously. There is much less work that focuses on characterizing the role that overexpression of a gene in this process. In the present work, we present a straightforward methodology to identify and clone genes in the budding yeast, Saccharomyces cerevisiae, for study in suppression of the short-lived chronological lifespan phenotype seen in many genetic backgrounds. This protocol is designed to be accessible to researchers from a wide variety of backgrounds and at various academic stages. The SIR2 gene, which codes for a histone deacetylase, was selected for cloning in the pRS315 vector, as there have been conflicting reports on its effect on the chronological lifespan. SIR2 also plays a role in autophagy, which results when disrupted via the deletion of several genes, including the transcription factor ATG1. As a proof of principle, we clone the SIR2 gene to perform a suppressor screen on the shortened lifespan phenotype characteristic of the autophagy deficient atg1&#916; mutant and compare it to an otherwise isogenic, wild type genetic background.

A Suppressor Screen for the Characterization of Genetic Links Regulating Chronological Lifespan in Saccharomyces cerevisiae

Here is a protocol to identify genetic interactions through an increased copy number suppressor screen in Saccharomyces cerevisiae. This method allows researchers to identify, clone, and test suppressors in short-lived yeast mutants. We test the effect of the copy number increase of SIR2 on lifespan in an autophagy null mutant.

Aging is the time dependent deterioration of an organism&#8217;s normal biological processes that increases the probability of death. Many genetic factors ...

Quantitative Analysis of the Cellular Lipidome of Saccharomyces Cerevisiae Using Liquid Chromatography Coupled with Tandem Mass Spectrometry

Lipids are structurally diverse amphipathic molecules that are insoluble in water. Lipids are essential contributors to the organization and function of biological membranes, energy storage and production, cellular signaling, vesicular transport of proteins, organelle biogenesis, and regulated cell death. Because the budding yeast Saccharomyces cerevisiae is a unicellular eukaryote amenable to thorough molecular analyses, its use as a model organism helped uncover mechanisms linking lipid metabolism and intracellular transport to complex biological processes within eukaryotic cells. The availability of a versatile analytical method for the robust, sensitive, and accurate quantitative assessment of major classes of lipids within a yeast cell is crucial for getting deep insights into these mechanisms. Here we present a protocol to use liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS) for the quantitative analysis of major cellular lipids of S. cerevisiae. The LC-MS/MS method described is versatile and robust. It enables the identification and quantification of numerous species (including different isobaric or isomeric forms) within each of the 10 lipid classes. This method is sensitive and allows identification and quantitation of some lipid species at concentrations as low as 0.2 pmol/&#181;L. The method has been successfully applied to assessing lipidomes of whole yeast cells and their purified organelles. The use of alternative mobile phase additives for electrospray ionization mass spectrometry in this method can increase the efficiency of ionization for some lipid species and can be therefore used to improve their identification and quantitation.

Quantitative Analysis of the Cellular Lipidome of Saccharomyces Cerevisiae Using Liquid Chromatography Coupled with Tandem Mass Spectrometry

We present a protocol using liquid chromatography coupled with tandem mass spectrometry to identify and quantify major cellular lipids in Saccharomyces cerevisiae. The described method for a quantitative assessment of major lipid classes within a yeast cell is versatile, robust, and sensitive.

Lipids are structurally diverse amphipathic molecules that are insoluble in water. Lipids are essential contributors to the organization and function of ...

CRISPR/Cas12a Multiplex Genome Editing of Saccharomyces cerevisiae and the Creation of Yeast Pixel Art

High efficiency, ease of use and versatility of the clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) system has facilitated advanced genetic modification of Saccharomyces cerevisiae, a model organism and workhorse in industrial biotechnology. CRISPR-associated protein 12a (Cas12a), an RNA-guided endonuclease with features distinguishable from Cas9 is applied in this work, further extending the molecular toolbox for genome editing purposes. A benefit of the CRISPR/Cas12a system is that it can be used in multiplex genome editing with multiple guide RNAs expressed from a single transcriptional unit (single CRISPR RNA (crRNA) array). We present a protocol for multiplex integration of multiple heterologous genes into independent loci of the S. cerevisiae genome using the CRISPR/Cas12a system with multiple crRNAs expressed from a single crRNA array construct. The proposed method exploits the ability of S. cerevisiae to perform in vivo recombination of DNA fragments to assemble the single crRNA array into a plasmid that can be used for transformant selection, as well as the assembly of donor DNA sequences that integrate into the genome at intended positions. Cas12a is pre-expressed constitutively, facilitating cleavage of the S.&#160;cerevisiae genome at the intended positions upon expression of the single crRNA array. The protocol includes the design and construction of a single crRNA array and donor DNA expression cassettes, and exploits an integration approach making use of unique 50-bp DNA connectors sequences and separate integration flank DNA sequences, which simplifies experimental design through standardization and modularization and extends the range of applications. Finally, we demonstrate a straightforward technique for creating yeast pixel art with an acoustic liquid handler using differently colored carotenoid producing yeast strains that were constructed.

CRISPR/Cas12a Multiplex Genome Editing of Saccharomyces cerevisiae and the Creation of Yeast Pixel Art

The CRISPR/Cas12a system in combination with a single crRNA array enables efficient multiplex editing of the S.&#160;cerevisiae genome at multiple loci simultaneously. This is demonstrated by constructing carotenoid producing yeast strains which are subsequently used to create yeast pixel art.

High efficiency, ease of use and versatility of the clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) ...

Bioengineering

Genome-wide Purification of Extrachromosomal Circular DNA from Eukaryotic Cells

Extrachromosomal circular DNAs (eccDNAs) are common genetic elements in Saccharomyces cerevisiae and are reported in other eukaryotes as well. EccDNAs contribute to genetic variation among somatic cells in multicellular organisms and to evolution of unicellular eukaryotes. Sensitive methods for detecting eccDNA are needed to clarify how these elements affect genome stability and how environmental and biological factors&#160;induce their formation in eukaryotic cells. This video presents a sensitive eccDNA-purification method called Circle-Seq. The method encompasses column purification of circular DNA, removal of remaining linear chromosomal DNA, rolling-circle amplification of eccDNA, deep sequencing, and mapping. Extensive exonuclease treatment&#160;was&#160;required for sufficient linear chromosomal DNA degradation. The rolling-circle amplification step by &#966;29 polymerase enriched for circular DNA over linear DNA. Validation of the Circle-Seq method on three S. cerevisiae CEN.PK populations of 1010 cells detected hundreds of eccDNA profiles in sizes larger than 1 kilobase. Repeated findings of ASP3-1, COS111, CUP1, RSC30,&#160;HXT6, HXT7 genes on circular DNA in both S288c and CEN.PK suggests that DNA circularization is conserved between strains at these loci. In sum, the Circle-Seq method has broad applicability for genome-scale screening for eccDNA in eukaryotes as well as for detecting specific eccDNA types.

This paper presents a sensitive method called Circle-Seq for purifying extrachromosomal circular DNA (eccDNA). The method encompasses column purification, removal of remaining linear chromosomal DNA, rolling-circle amplification and high-throughput sequencing. Circle-Seq is applicable to genome-scale screening of eukaryotic eccDNA and studying genome instability and copy-number variation.

Extrachromosomal circular DNAs (eccDNAs) are common genetic elements in Saccharomyces cerevisiae and are reported in other eukaryotes as well. EccDNAs ...

Single-Copy Gene Locus Chromatin Purification in Saccharomyces cerevisiae

Podsumowanie

Przeglądaj więcej filmów

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

Expression, Purification, and Antimicrobial Activity of S100A12

Genome-wide Mapping of Protein-DNA Interactions with ChEC-seq in Saccharomyces cerevisiae

Chromatin Immunoprecipitation (ChIP) of Histone Modifications from Saccharomyces cerevisiae

Improved Protocol for Chromatin Immunoprecipitation from Mouse Skeletal Muscle

High Sensitivity Measurement of Transcription Factor-DNA Binding Affinities by Competitive Titration Using Fluorescence Microscopy

A Suppressor Screen for the Characterization of Genetic Links Regulating Chronological Lifespan in Saccharomyces cerevisiae

Quantitative Analysis of the Cellular Lipidome of Saccharomyces Cerevisiae Using Liquid Chromatography Coupled with Tandem Mass Spectrometry

CRISPR/Cas12a Multiplex Genome Editing of Saccharomyces cerevisiae and the Creation of Yeast Pixel Art

Genome-wide Purification of Extrachromosomal Circular DNA from Eukaryotic Cells