This research was supported by National Science Foundation grant IOS-1025642 (GBM). We thank Maria Harrison for providing the ARqua1 strain.

1. Guide RNA Design and Vector Construction
<ol>
	<li>Identify target sequences for the genes of interest. There are a variety of online CRISPR target-finding programs suitable for this step13,14. 
	NOTE: Here we use the GN20GG target motif, but other designs may be suitable depending on the application or vector system used.</li>
	<li>Design 60-mer gRNA oligos to include the GN19 portion of the target motifs flanked by 5&#39; and 3&#39; 20-nt sequences that are required for DNA assembly. The final 60-mer motif is: 5&#39;-TCAAGCGAACCAGTAGGCTT-GN19-GTTTTAGAGCTAGAAATAGC-3&#39;. 
	NOTE: Standard, desalted primers work fine.</li>
	<li>Prepare the four DNAs for assembly (Figure 1). See supplementary file for DNA sequences.
	<ol>
		<li>Digest 1 - 5 &#181;g of p201N:Cas910 plasmid with the restriction enzyme SpeI in 1x Buffer 4 at 37 &#176;C for 2 hr. Column-purify the digest according to manufacturer&#39;s instructions. Resuspend in ~15 &#181;l of 10 mM Tris-HCl, and quantify by UV spectrophotometry.</li>
		<li>Perform a second digest with the restriction enzyme SwaI in 1x Buffer 3.1 at 25 &#176;C for 2 hr. Check 100 - 200 ng on a 0.8% agarose gel to confirm complete digestion. 
		NOTE: A correctly digested plasmid will have a single band at 14,313 bp. Note: Heat inactivation of the enzyme and dephosphorylation are not required. Digested plasmid may be stored at -20 &#176;C.</li>
		<li>PCR amplify the Medicago truncatula (Mt) U6 promoter and scaffold DNAs from the pUC gRNA Shuttle10 plasmid using the primers SwaI_MtU6F / MtU6R and ScaffoldF / SpeI_ScaffoldR, respectively. Use a high-fidelity polymerase with the PCR conditions: 95 &#176;C for 3 min; 31 cycles (98 &#176;C for 20 sec, 60 &#176;C for 15 sec, 72 &#176;C for 30 sec); and 72 &#176;C for 5 min.
		<ol>
			<li>Visualize ~3 &#181;l aliquots of PCR products on a 1% agarose gel to confirm amplification. The MtU6 amplicon is 377 bp and the scaffold amplicon is 106 bp. Column-purify the remaining PCR products according to manufacturer&#39;s instructions, quantify by UV spectrophotometry and store at -20 &#176;C.</li>
		</ol>
		</li>
		<li>Resuspend the entire tube of gRNA oligos to 100 &#181;M in laboratory-grade water. Add 1 &#181;l of 100 &#181;M oligo to 500 &#181;l of 1x Buffer 2.1. Mix well. If pooling multiple oligos, add 1 &#181;l of each 100 &#181;M oligo to the 1x Buffer 2.1 tube. Diluted oligos can be stored at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Program a thermal cycler to hold at 50 &#176;C, using a heated lid. Combine 100 ng (0.011 pmol) of linearized vector, 50 ng (0.2 pmol) of MtU6 promoter, 12 ng (0.2 pmol) of scaffold, 1 &#181;l (0.2 pmol) of diluted gRNA oligo(s), and water to a volume of 5 &#181;l. Add 5 &#181;l of 2x high-fidelity DNA assembly master mix, mix well and spin down. Incubate reaction for 60 min in the 50 &#176;C thermal cycler. Then place the reaction on ice. 
	Note: Reaction volumes can be increased to accommodate low DNA yields.</li>
	<li>Transform 2 &#181;l&#160;of the reaction into competent E. coli cells using standard techniques and plate on LB supplemented with 50 mg L-1 kanamycin (Kan50). Grow plated-cells at 37 &#176;C overnight. Save the remaining DNA assembly reaction at -20 &#176;C.</li>
	<li>Colony screen by PCR using the primers StUbi3P218R and ISceIR. Dilute an aliquot of the remaining DNA assembly reaction with water 1:5. Use 1 &#181;l&#160;as a positive control for the colony screen and 1 ng of circular p201N:Cas9 plasmid as a no-insert control.
	<ol>
		<li>PCR amplify with the conditions; 95 &#176;C for 3 min; 31 cycles (95 &#176;C for 30 sec, 58 &#176;C for 30 sec, 72 &#176;C for 30 sec); and at 72 &#176;C for 5 min. Visualize PCR products on a 1% agarose gel. Ensure that correct insertions have a band at 725 bp and vectors without inserts (e.g., uncut vector) will have a 310-bp band.</li>
	</ol>
	</li>
	<li>Grow positive colonies in LB Kan50 liquid cultures overnight at 37 &#176;C and purify plasmids according to manufacturer&#39;s instructions. Sanger sequence plasmids with the StUbi3P218R primer and align chromatograms to the MtU6 promoter, target, and scaffold sequences to ensure no errors were introduced during cloning.</li>
	<li>Perform a diagnostic digest by digesting ~1 &#181;g of plasmid with EcoRV and StyI. Visualize on a 0.8% agarose gel. Fragments (in bp) are: 4192, 2001, 1743, 1544, 1381, 995, 831, 702, 460, 423, 318, and 174.</li>
	<li>Use DNA assembly to construct vectors with multiple gRNAs.
	<ol>
		<li>To construct a vector with two gRNA cassettes, PCR amplify the first-position gRNA with the primers SwaI_MtU6F / UNS1_ScaffoldR and the second-position gRNA with the primers UNS1_MtU6F / SpeI_ScaffoldR from 1 ng of each of the respective plasmids constructed in steps 1.1 - 1.8. Use the PCR conditions in step 1.3.3. Visualize ~3 &#181;l aliquots of PCR products on a 1% agarose gel to confirm amplification. Amplicons are ~500 bp.</li>
		<li>Combine and mix approximately equal amounts of un-purified PCR products in a 200 &#181;l tube (typically 3 - 4 &#181;l of each). For assembly, add 1 &#181;l combined PCR products, 50 ng of SwaI and SpeI linearized p201N:Cas9, laboratory-grade water to 2.5 &#181;l and 2.5 &#181;l of 2x high-fidelity DNA assembly master mix. Incubate in a 50 &#176;C thermal cycler for 15 min. 
		Note: The DNA assembly manuals recommends a 15 min incubation for 2 - 3 fragments.</li>
		<li>Transform 1 - 2 &#181;l into competent E. coli cells and plate on LB Kan50. Grow plated cells at 37 &#176;C overnight. Save the remaining reaction at -20 &#176;C.</li>
		<li>Colony screen by PCR with primers StUbi3P218R and ISceIR with the same conditions as step 1.6. Correct clones will have a 1,200 bp amplicon. Grow positive colonies in LB Kan50 liquid cultures overnight and purify plasmids.</li>
		<li>Sanger sequence plasmids with the primers StUbi3P218R (covers first-position gRNA) and p201R (covers second-position gRNA). Align chromatograms to the MtU6 promoter, target, and scaffold sequences. Diagnostic digest with EcoRV and StyI will result in the following fragments (in bp): 4192, 2476, 1743, 1544, 1381, 995, 831, 702, 460, 423, 318, 174. Bolded fragment contains the second gRNA.</li>
	</ol>
	</li>
	<li>After meeting all the quality-control expectations, transform plasmids into Agrobacterium rhizogenes strain ARqua115. Add 1 &#181;l of the plasmid prep to 50 &#181;l of electrocompetent cells and electroporate in a 1 mm cuvette with the settings: 2.4 kV, 25 &#181;F, and 200 &#8486;. Recover cells in ~500 &#181;l of SOC and shake at 28 &#176;C for 2 hr. Plate on LB Kan50 and grow at 28 &#176;C for 2 days. Perform colony screen using the same primers and PCR conditions as 1.3.3. Make glycerol stocks from positive clones.</li>
</ol>
2. Hairy Root Transformation
<ol>
	<li>Sterilize tomato seeds in 20% household bleach for 15 min, with constant mixing. In a laminar flow hood, remove the bleach and wash in sterile laboratory-grade water 3 times.</li>
	<li>Plate 30 seeds in a GA-7 box containing &#189; MS media (2.22 g L-1 MS salts + Gamborg Vitamins, 10 g L-1 sucrose, 3 g L-1 gellan gum, pH 5.8). Germinate for ~2 days in the dark, then move GA-7 boxes to light. Grow seedlings for ~4 more days in the light.</li>
	<li>The day before transformation, streak out A. rhizogenes cultures on solid LB Kan50 and grow at 28 &#176;C overnight.</li>
	<li>Day of transformation, in the laminar flow hood assemble sterile materials: 12 ml culture tubes, 50 ml conical tube, &#189; MS liquid (no gellan gum), 200 &#181;M acetosyringone, filter paper, Petri dishes, forceps and scalpel, pipettes and pipette tips. Add 25 &#181;l of acetosyringone to 50 ml of &#189; MS and pour ~ 6 ml into each culture tube.</li>
	<li>Use a bent 200 &#181;l tip to scrape A. rhizogenes cells from the plate and resuspend in the 6 ml of &#189; MS liquid. Vortex the tube to completely resuspend the cells. After resuspending cells from each vector, measure the optical density (O.D.) of 1 ml of cells at a fixed wavelength of 600 nM. Ensure O.D. is between 0.2 and 0.4; dilute or add more cells as necessary. Repeat for each construct.</li>
	<li>Add ~ 2 ml of &#189; MS liquid to a Petri dish with a sterile filter paper. Excise cotyledons from the seedlings and place on the moistened filter paper. Once all cotyledons have been collected, cut the distal ~1 cm off of the cotyledons, resulting in cotyledon pieces with two cut ends. Add explants to A. rhizogenes solutions, mix, and incubate for 20 min with occasional inverting. 
	Note: Approximately 12 explants per construct are routinely used, though as many as 80 explants have been inoculated in 6 ml of A. rhizogenes solution.</li>
	<li>During the A. rhizogenes incubation, add filter paper to Petri dishes, one per construct transformed. Also set &#189; MS solid media, no antibiotics, in the laminar flow hood to dry.</li>
	<li>Scoop cotyledons out of A. rhizogenes solution with sterile forceps and place on dry filter paper. Cover with Petri lid to ensure tissues do not dry out while proceeding to the next transformation. Blot cotyledons on the filter paper and transfer, abaxial side up, to &#189; MS media. Wrap plates with surgical tape and co-cultivate in the dark at room temperature for 2 days.</li>
	<li>After co-cultivation, transfer cotyledons, abaxial side up, to &#189; MS media supplemented with 300 mg L-1 ticarcillin/clavulanic acid (Tim300, to prevent the growth of residual A. rhizogenes) and Kan50 (for plant selection) and wrap with surgical tape. Maintain cultures under fluorescent lights at room temperature with a 16-hour photoperiod.</li>
	<li>After ~1.5 - 2 weeks roots at least 2 cm in length are excised from the cotyledons using sterile forceps and a scalpel and transferred to &#189; MS Kan50 Tim300 media. Transfer 10 to 15 roots to a single plate. Mark the position of the root tips with a marker, wrap with surgical tape, and maintain in culture room.</li>
	<li>After one week, transformed roots are seen growing on the selective media. Harvest a subsample of transformed roots for DNA extraction using the preferred DNA-extraction method. Note: Plates with cotyledons can be kept for 2 - 3 weekly harvests, after which point the roots grow into a tangled mess and are difficult to isolate. Non harvested root tissues can be maintained indefinitely. A variety of assays can be performed on the isolated DNA samples to determine DNA mutation frequency and type. Results from a few such assays are described below.</li>
</ol>

<ol>
	<li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells.">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343 (6166), 84-87 (2014).</li><li>Zhou, Y. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+screening+of+a+CRISPR/Cas9+library+for+functional+genomics+in+human+cells.">High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells.</a> Nature. 509 (509), 487-491 (2014).</li><li>Doudna, J. A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+new+frontier+of+genome+engineering+with+CRISPR-Cas9.">The new frontier of genome engineering with CRISPR-Cas9.</a> Science. 346 (6213), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Patron, N. J., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Editing+plant+genomes+with+CRISPR/Cas9.">Editing plant genomes with CRISPR/Cas9.</a> Current Opinion in Biotechnology. 32, 76-84 (2015).</li><li>Bortesi, L., Fischer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR/Cas9+system+for+plant+genome+editing+and+beyond.">The CRISPR/Cas9 system for plant genome editing and beyond.</a> Biotechnology Advances. 33 (1), 41-52 (2015).</li><li>Jia, H. G., Wang, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+editing+of+sweet+orange+using+Cas9/sgRNA.">Targeted genome editing of sweet orange using Cas9/sgRNA.</a> Plos One. 9, (2014).</li><li>Upadhyay, S. K., Kumar, J., Alok, A., Tuli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+Genome+Editing+for+Target+Gene+Mutations+in+Wheat.">RNA-Guided Genome Editing for Target Gene Mutations in Wheat.</a> G3-Genes Genomes Genetics. 3 (12), 2233-2238 (2013).</li><li>Ron, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hairy+root+transformation+using+Agrobacterium+rhizogenes.+as+a+tool+for+exploring+cell+type-specific+gene+expression+and+function+using+tomato+as+a+model.">Hairy root transformation using Agrobacterium rhizogenes. as a tool for exploring cell type-specific gene expression and function using tomato as a model.</a> Plant Physiology. 166 (2), 455-U4442 (2014).</li><li>Jacobs, T. B., LaFayette, P. R., Schmitz, R. J., Parrott, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modifications+in+soybean+with+CRISPR/Cas9.">Targeted genome modifications in soybean with CRISPR/Cas9.</a> BMC Biotechnology. 15, (2015).</li><li>Gibson, D. G., Smith, H. O., Hutchison, C. A., Venter, J. C., Merryman, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+synthesis+of+the+mouse+mitochondrial+genome.">Chemical synthesis of the mouse mitochondrial genome.</a> Nature Methods. 7 (11), 901-903 (2010).</li><li>Zhou, X., Jacobs, T. B., Xue, L. J., Harding, S. A., Tsai, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploiting+SNPs+for+biallelic+CRISPR+mutations+in+the+outcrossing+woody+perennial+Populus+reveals+4-coumarate:CoA+ligase+specificity+and+redundancy.">Exploiting SNPs for biallelic CRISPR mutations in the outcrossing woody perennial Populus reveals 4-coumarate:CoA ligase specificity and redundancy.</a> New Phytologist. , (2015).</li><li>Stemmer, M., Thumberger, T., Keyer, M. D., Wittbrodt, J., Mateo, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CCTop:+An+Intuitive,+Flexible+and+Reliable+CRISPR/Cas9+Target+Prediction+Tool.">CCTop: An Intuitive, Flexible and Reliable CRISPR/Cas9 Target Prediction Tool.</a> Plos One. 10, (2015).</li><li>Lei, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-P:+A+Web+Tool+for+Synthetic+Single-Guide+RNA+Design+of+CRISPR-System+in+Plants.">CRISPR-P: A Web Tool for Synthetic Single-Guide RNA Design of CRISPR-System in Plants.</a> Molecular Plant. 7 (9), 1494-1496 (2014).</li><li>Quandt, H. J., Puhler, A., Broer, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TRANSGENIC+ROOT-NODULES+OF+VICIA-HIRSUTA+-+A+FAST+AND+EFFICIENT+SYSTEM+FOR+THE+STUDY+OF+GENE-EXPRESSION+IN+INDETERMINATE-TYPE+NODULES.">TRANSGENIC ROOT-NODULES OF VICIA-HIRSUTA - A FAST AND EFFICIENT SYSTEM FOR THE STUDY OF GENE-EXPRESSION IN INDETERMINATE-TYPE NODULES.</a> Molecular Plant-Microbe Interactions. 6, 699-706 (1993).</li><li>Zhu, X. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+genotyping+method+for+genome-modified+animals+and+human+cells+generated+with+CRISPR/Cas9+system.">An efficient genotyping method for genome-modified animals and human cells generated with CRISPR/Cas9 system.</a> Scientific Reports. 4 (8), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant+genome+editing+made+easy:+targeted+mutagenesis+in+model+and+crop+plants+using+the+CRISPR/Cas+system.">Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system.</a> Plant Methods. 9 (1), 39 (2013).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li><li>Li, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+and+homologous+recombination-mediated+genome+editing+in+Arabidopsis+and+Nicotiana+benthamiana+using+guide+RNA+and+Cas9.">Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9.</a> Nat Biotech. 31 (8), 688-691 (2013).</li><li>Fu, Y. F., Sander, J. D., Reyon, D., Cascio, V. M., Joung, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+CRISPR-Cas+nuclease+specificity+using+truncated+guide+RNAs.">Improving CRISPR-Cas nuclease specificity using truncated guide RNAs.</a> Nature Biotechnology. 32 (3), 279-284 (2014).</li><li>Torella, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+nucleotide+sequence-guided+assembly+of+repetitive+DNA+parts+for+synthetic+biology+applications.">Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications.</a> Nat Protoc. 9 (9), 2075-2089 (2014).</li><li>Ono, N. N., Tian, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+multiplicity+of+hairy+root+cultures:+Prolific+possibilities.">The multiplicity of hairy root cultures: Prolific possibilities.</a> Plant Science. 180 (3), 439-446 (2011).</li><li>Tepfer, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+several+species+of+higher+plants+by+Agrobacterium+rhizogenes.:+sexual+transmission+of+the+transformed+genotype+and+phenotype.">Transformation of several species of higher plants by Agrobacterium rhizogenes.: sexual transmission of the transformed genotype and phenotype.</a> Cell. 37 (3), 959-967 (1984).</li><li>Li, H., Deng, Y., Wu, T. L., Subramanian, S., Yu, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Misexpression+of+miR482,+miR1512,+and+miR1515+Increases+Soybean+Nodulation.">Misexpression of miR482, miR1512, and miR1515 Increases Soybean Nodulation.</a> Plant Physiology. 153 (4), 1759-1770 (2010).</li><li>Boisson-Dernier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+rhizogenes-transformed+roots+of+Medicago+truncatula+for+the+study+of+nitrogen-fixing+and+endomycorrhizal+symbiotic+associations.">Agrobacterium rhizogenes-transformed roots of Medicago truncatula for the study of nitrogen-fixing and endomycorrhizal symbiotic associations.</a> Molecular Plant-Microbe Interactions. 14 (6), 695-700 (2001).</li><li>Collier, R., Fuchs, B., Walter, N., Kevin Lutke, W., Taylor, C. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+vitro.+composite+plants:+an+inexpensive,+rapid+method+for+root+biology.">Ex vitro. composite plants: an inexpensive, rapid method for root biology.</a> Plant Journal. 43 (3), 449-457 (2005).</li></ol>

The authors have nothing to disclose.

Since DNA assembly is used to recombine any overlapping DNA sequences, this cloning method can be applied to any CRISPR vector construction. Most CRISPR cloning schemes use either gene synthesis of the gRNA, type IIS restriction enzymes17,18, or overlap-extension PCR19. Each of these techniques has inherent advantages and disadvantages, but they typically require multiple hands-on cloning steps. The primary advantage of the cloning method presented here is that the entire process occurs in a single,...

The ability to generate targeted DNA modifications with CRISPR/Cas9 has great potential for functional genomics studies. There are two components of the CRISPR/Cas9 system; the Cas9 nuclease, derived from Staphylococcus pyogenes and an approximately 100-nt guide RNA (gRNA) molecule that directs Cas9 to the targeted DNA site(s)1. Target recognition is conferred by the first ~20-nt of the gRNA, which allows for high-throughput production of targeting vectors2,3. Most organisms that can be engineered, already have been with CRISPR/Cas9 technology4,5.
In plants, constitutive promoters, such as the CaMV 35S promoter, are commonly used to drive the expression of the Cas9 nuclease6. The gRNAs are expressed using the RNA polymerase III U6 or U3 promoters which restricts the first base of the gRNA to either a G, for U6, or A for U3, for efficient transcription. However RNA polymerase II promoters, which are free of these restrictions, have also been used7,8.
Different gRNAs induce DNA mutations with different efficiencies, and so it can be important to first validate CRISPR vectors before investing in whole-plant transformations or setting up extensive phenotypic screens. Transient expression of CRISPR constructs in plants, by using agroinfiltration for example, generally results in a lower frequency of DNA modification as compared to stable plants6, making detection of mutations difficult and phenotypic assays impractical with such approaches. So-called hairy roots are a convenient, alternative system since a large number of independent, stably transformed materials can be generated within weeks, as opposed to months for stable plants. CRISPR vectors are very effective at inducing DNA mutations in hairy roots9,10.
DNA assembly methods efficiently ligate DNA fragments containing overlapping ends11. A major advantage of some DNA assembly methods is the ability to incorporate ssDNA (i.e., oligos) into the assembled products. Since gRNAs are only ~20-nt long and new targets can be made with synthesized oligos, these DNA assembly methods are well suited to CRISPR cloning. The protocols described here are based on the p201 series of CRISPR vectors that has been successfully used in soybean10, poplar12 and now tomato. The cloning procedure presented offers several advantages over the current cloning method10. Namely, fully functional vectors can be generated in a single cloning reaction in a single day. Vector construction can also be pooled to generate multiple CRISPR vectors in parallel, further reducing hands-on time and material costs. We also present a protocol for the generation of tomato hairy roots as an efficient method to produce transgenic materials with targeted gene deletions. Hairy roots are used to validate the CRISPR vectors and provide material for subsequent experiments.

<table><tbody><tr><td>NEBuilder&amp;reg; (HiFi DNA assembly mix)</td><td>New England Biolabs</td><td>E5520</td><td></td></tr><tr><td>p201N:Cas9</td><td>Addgene</td><td>59175</td><td>The p201H:Cas9 plasmid (59176) is also compatible with the reported overlaps and enzymes.</td></tr><tr><td>pUC gRNA Shuttle</td><td>Addgene</td><td>47024</td><td></td></tr><tr><td>&lt;em&gt;Swa&lt;/em&gt;I</td><td>New England Biolabs</td><td>R0604S</td><td></td></tr><tr><td>&lt;em&gt;Spe&lt;/em&gt;I</td><td>New England Biolabs</td><td>R0133S</td><td></td></tr><tr><td>Zymo clean and concentrator-5 column purification</td><td>Zymo Research</td><td>D4003</td><td></td></tr><tr><td>NEB Buffer 2.1</td><td>New England Biolabs</td><td>B7202S</td><td></td></tr><tr><td>NEB CutSmart (Buffer 4)</td><td>New England Biolabs</td><td>B7204S</td><td></td></tr><tr><td>NEB Buffer 3.1</td><td>New England Biolabs</td><td>B7203S</td><td></td></tr><tr><td>EconoSpin Mini Spin Column (plasmid prep)</td><td>Epoch Life Sciences</td><td>1910-050/250</td><td></td></tr><tr><td>EcoRV-HF&amp;reg;</td><td>New England Biolabs</td><td>R3195S</td><td></td></tr><tr><td>StyI-HF&amp;reg;</td><td>New England Biolabs</td><td>R3500S</td><td></td></tr><tr><td>MS Salts + Gamborg Vitamins</td><td>Phytotechnology Laboratories</td><td>M404</td><td></td></tr><tr><td>Phytagel&amp;trade; (gellan gum)</td><td>Sigma Aldrich</td><td>P8169</td><td></td></tr><tr><td>GA-7 Boxes</td><td>Sigma Aldrich</td><td>V8505</td><td></td></tr><tr><td>Micropore&amp;trade; surgical tape</td><td>3M</td><td>1535-0</td><td></td></tr><tr><td>Timentin&amp;reg; (Ticarcillin/Clavulanic acid)</td><td>Various</td><td>0029-6571-26</td><td></td></tr><tr><td>Primers 5&#039; &amp;#8594; 3&#039;</td><td></td><td></td><td></td></tr><tr><td>SwaI_MtU6F&amp;nbsp;</td><td>&lt;strong&gt;GATATTAATCTCTTCGATGA&lt;br/&gt;AATTT&lt;/strong&gt;ATGCCTATCTTATAT&lt;br/&gt;GATCAATGAGG</td><td></td><td></td></tr><tr><td>MtU6R&amp;nbsp;&amp;nbsp;</td><td>AAGCCTACTGGTTCGCTTG&lt;br/&gt;AAG</td><td></td><td></td></tr><tr><td>ScaffoldF&amp;nbsp;</td><td>GTTTTAGAGCTAGAAATAGC&lt;br/&gt;AAGTT</td><td></td><td></td></tr><tr><td>&lt;em&gt;Spe&lt;/em&gt;I_Scaffold R</td><td>&lt;strong&gt;GTCATGAATTGTAATACGACTC&lt;br/&gt;A&lt;/strong&gt;AAAAAAAGCACCGACTCGGTG</td><td></td><td></td></tr><tr><td>StUbi3P218R&amp;nbsp;</td><td>ACATGCACCTAATTTCACTA&lt;br/&gt;GATGT</td><td></td><td></td></tr><tr><td>ISceIR</td><td>GTGATCGATTACCCTGTTAT&lt;br/&gt;CCCTAG</td><td>Cannot be used for Sanger sequencing since there is a second binding site on the plasmid</td><td></td></tr><tr><td>UNS1_Scaffold R&amp;nbsp;</td><td>GAGAATGGATGCGAGTAATGAA&lt;br/&gt;AAAAAGCACCGACTCGGTG</td><td></td><td></td></tr><tr><td>UNS1_MtU6 F&amp;nbsp;&amp;nbsp;</td><td>CATTACTCGCATCCATTCTCAT&lt;br/&gt;GCCTATCTTATATGATCAATGAGG</td><td></td><td></td></tr><tr><td>p201R&amp;nbsp;</td><td>CGCGCCGAATTCTAGTGATCG</td><td></td><td></td></tr><tr><td>Bolded sequences denote 20-nt overlaps with linearized p201N:Cas9.</td><td></td><td></td><td></td></tr></tbody></table>

high-throughput crispr vector construction and characterization of dna modifications by generation of tomato hairy roots

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for functional genomics studies. While most cloning strategies are simple to perform, they generally use multiple steps and can require several days to generate the ultimate constructs. The method presented here is based on DNA assembly and can produce fully functional CRISPR vectors in a single cloning reaction. Vector construction can also be pooled, further increasing the efficiency and utility of the process. A modification of the method is used to create CRISPR vectors with multiple gene targets. CRISPR vectors are then transformed into tomato hairy roots to generate transgenic materials with targeted DNA modifications. Hairy roots are a useful system for testing vector functionality as they are technically simple to generate and amenable to large-scale production. The methods presented here will have wide application as they can be used to generate a variety of CRISPR vectors and be used in a wide range of plant species.

CRISPR vector construction with DNA assembly typically generates tens to hundreds of independent clones. Colony screening by PCR easily identifies correct clones and can distinguish between plasmids with and without inserts (Figure 2A) which is useful for troubleshooting. Typically, all of the clones contain an insert and a user may opt to skip the colony screening steps altogether. Diagnostic digests (Figure 2B) and Sanger sequencing are used for quality...

Watch this Scientific Journal Video about High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots at JoVE.com

High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

Using DNA assembly, multiple CRISPR vectors can be constructed in parallel in a single cloning reaction, making the construction of large numbers of CRISPR vectors a simple task. Tomato hairy roots are an excellent model system to validate CRISPR vectors and generate mutant materials.

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for ...

high-throughput-crispr-vector-construction-characterization-dna

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

17.8K Views.  Boyce Thompson Institute for Plant Research. Using DNA assembly, multiple CRISPR vectors can be constructed in parallel in a single cloning reaction, making the construction of large numbers of CRISPR vectors a simple task. Tomato hairy roots are an excellent model system to validate CRISPR vectors and generate mutant materials.

Video: High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

Transient Expression in Nicotiana Benthamiana Leaves for Triterpene Production at a Preparative Scale

The triterpenes are one of the largest and most structurally diverse families of plant natural products. Many triterpene derivatives have been shown to possess medicinally relevant biological activity. However, thus far this potential has not translated into a plethora of triterpene-derived drugs in the clinic. This is arguably (at least partially) a consequence of limited practical synthetic access to this class of compound, a problem that can stifle the exploration of structure-activity relationships and development of lead candidates by traditional medicinal chemistry workflows. Despite their immense diversity, triterpenes are all derived from a single linear precursor, 2,3-oxidosqualene. Transient heterologous expression of biosynthetic enzymes in N. benthamiana can divert endogenous supplies of 2,3-oxidosqualene towards the production of new high-value triterpene products that are not naturally produced by this host. Agro-infiltration is an efficient and simple means of achieving transient expression in N. benthamiana. The process involves infiltration of plant leaves with a suspension of Agrobacterium tumefaciens carrying the expression construct(s) of interest. Co-infiltration of an additional A. tumefaciens strain carrying an expression construct encoding an enzyme that boosts precursor supply significantly increases yields. After a period of five days, the infiltrated leaf material can be harvested and processed to extract and isolate the resulting triterpene product(s). This is a process that is linearly and reliably scalable, simply by increasing the number of plants used in the experiment. Herein is described a protocol for rapid preparative-scale production of triterpenes utilizing this plant-based platform. The protocol utilizes an easily replicable vacuum infiltration apparatus, which allows the simultaneous infiltration of up to four plants, enabling batch-wise infiltration of hundreds of plants in a short period of time.

Transient Expression in Nicotiana Benthamiana Leaves for Triterpene Production at a Preparative Scale

Transient heterologous expression of biosynthetic enzymes in Nicotiana benthamiana leaves can divert endogenous supplies of 2,3-oxidosqualene towards the production of new high-value triterpene products. Herein is described a detailed protocol for rapid (5 days) preparative-scale production of triterpenes and analogs utilizing this powerful plant-based platform.

The triterpenes are one of the largest and most structurally diverse families of plant natural products. Many triterpene derivatives have been shown to ...

Biochemistry

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease

Ralstonia solanacearum is a devastating soil borne vascular pathogen that can infect a large range of plant species, causing an important threat to agriculture. However, the Ralstonia model is considerably underexplored in comparison to other models involving bacterial plant pathogens, such as Pseudomonas syringae in Arabidopsis. Research targeted to understanding the interaction between Ralstonia and crop plants is essential to develop sustainable solutions to fight against bacterial wilt disease but is currently hindered by the lack of straightforward experimental assays to characterize the different components of the interaction in native host plants. In this scenario, we have developed a method to perform genetic analysis of Ralstonia infection of tomato, a natural host of Ralstonia. This method is based on Agrobacterium rhizogenes-mediated transformation of tomato roots, followed by Ralstonia soil-drenching inoculation of the resulting plants, containing transformed roots expressing the construct of interest. The versatility of the root transformation assay allows performing either gene overexpression or gene silencing mediated by RNAi. As a proof of concept, we used this method to show that RNAi-mediated silencing of SlCESA6 in tomato roots conferred resistance to Ralstonia. Here, we describe this method in detail, enabling genetic approaches to understand bacterial wilt disease in a relatively short time and with small requirements of equipment and plant growth space.

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease

Here, we present a versatile method for tomato root transformation followed by inoculation with Ralstonia solanacearum to perform straightforward genetic analysis for the study of bacterial wilt disease.

Ralstonia solanacearum is a devastating soil borne vascular pathogen that can infect a large range of plant species, causing an important threat to ...

Genetics

Inducing Hairy Roots by Agrobacterium rhizogenes-Mediated Transformation in Tartary Buckwheat (Fagopyrum tataricum)

Tartary buckwheat (TB) [Fagopyrum tataricum (L.) Gaertn] possesses various biological and pharmacological activities because it contains abundant secondary metabolites such as flavonoids, especially rutin. Agrobacterium rhizogenes have been gradually used worldwide to induce hairy roots in medicinal plants to investigate gene functions and increase the yield of secondary metabolites. In this study, we have described a detailed method to generate A. rhizogenes-mediated hairy roots in TB. Cotyledons and hypocotyledonary axis at 7&#8211;10 days were selected as explants and infected with A. rhizogenes carrying a binary vector, which induced adventitious hairy roots that appeared after 1 week. The generated hairy root transformation was identified based on morphology, resistance selection (kanamycin), and reporter gene expression (green fluorescent protein). Subsequently, the transformed hairy roots were self-propagated as required. Meanwhile, a myeloblastosis (MYB) transcription factor, FtMYB116, was transformed into the TB genome using the A. rhizogenes-mediated hairy roots to verify the role of FtMYB116 in synthesizing flavonoids. The results showed that the expression of flavonoid-related genes and the yield of flavonoid compounds (rutin and quercetin) were significantly (p &#60; 0.01) promoted by FtMYB116, indicating that A. rhizogenes-mediated hairy roots can be used as an effective alternative tool to investigate gene functions and the production of secondary metabolites. The detailed step-by-step protocol described in this study for generating hairy roots can be adopted for any genetic transformation or other medicinal plants after adjustment.

Inducing Hairy Roots by Agrobacterium rhizogenes-Mediated Transformation in Tartary Buckwheat Fagopyrum tataricum

We describe a method of inducing hairy roots by Agrobacterium rhizogenes-mediated transformation in Tartary buckwheat (Fagopyrum tataricum). This can be used to investigate gene functions and production of secondary metabolites in Tartary buckwheat, be adopted for any genetic transformation, or used for other medicinal plants after improvement.

Tartary buckwheat (TB) [Fagopyrum tataricum (L.) Gaertn] possesses various biological and pharmacological activities because it contains abundant ...

CcCIPK14 Gene Function Analysis to Illuminate the Efficient Root Transgenic System

An efficient and stable transformation system is fundamental for gene function study and molecular breeding of plants. Here, we describe the use of an Agrobacterium rhizogenes mediated transformation system on pigeon pea. The stem is infected with A. rhizogenes carrying a binary vector, which induced callus after 7 days and adventitious roots 14 days later. The generated transgenic hairy root was identified by morphological analysis and a GFP reporter gene.To further illustrate the application range of this system, CcCIPK14 (Calcineurin B-like protein-interacting protein kinases) was transformed into pigeon pea using this transformation method. The transgenic plants were treated with jasmonic acid (JA) and abscisic acid (ABA), respectively, for the purpose of testing whether CcCIPK14 responds to those hormones. The results demonstrated that (1) exogenous hormones could significantly upregulate the expression levelof CcCIPK14, especially in CcCIPK14 over-expression (OE) plants; (2) the content of Genistein in CcCIPK14-OE lines was significantly higher than the control; (3) the expression level of two downstream key flavonoid synthase genes, CcHIDH1 and CcHIDH2, were up-regulated in the CcCIPK14-OE lines; and (4) the hairy root transgenic system can be used to study metabolically functional genes in non-model plants.

CcCIPK14 Gene Function Analysis to Illuminate the Efficient Root Transgenic System

Here we present an efficient and stable transformation system for the functional analysis of the CcCIPK14 gene as an example, providing a technical basis for studying the metabolism of non-model plants.

An efficient and stable transformation system is fundamental for gene function study and molecular breeding of plants. Here, we describe the use of an ...

A High-Throughput UAS-cDNA/ORF Plasmid Library Construction Using CRISPRmass

CRISPR-Based Modular Assembly for High-Throughput Construction of a UAS-cDNA/ORF Plasmid Library

Functional genomics screening offers a powerful approach to probe gene function and relies on the construction of genome-wide plasmid libraries. Conventional approaches for plasmid library construction are time-consuming and laborious. Therefore, we recently developed a simple and efficient method, CRISPR-based modular assembly (CRISPRmass), for high-throughput construction of a genome-wide upstream activating sequence-complementary DNA/open reading frame (UAS-cDNA/ORF) plasmid library. Here, we present a protocol for CRISPRmass, taking as an example the construction of a GAL4/UAS-based UAS-cDNA/ORF plasmid library. The protocol includes massively parallel two-step test tube reactions followed by bacterial transformation. The first step is to linearize the existing complementary DNA (cDNA) or open reading frame (ORF) cDNA or ORF library plasmids by cutting the shared upstream vector sequences adjacent to the 5&#39; end of cDNAs or ORFs using CRISPR/Cas9 together with single guide RNA (sgRNA), and the second step is to insert a UAS module into the linearized cDNA or ORF plasmids using a single step reaction. CRISPRmass allows the simple, fast, efficient, and cost-effective construction of various plasmid libraries. The UAS-cDNA/ORF plasmid library can be utilized for gain-of-function screening in cultured cells and for constructing a genome-wide transgenic UAS-cDNA/ORF library in Drosophila.&#160;

Author Spotlight: Simplifying Genome-Wide Plasmid Library Construction Using CRISPRmass

We present a protocol for CRISPR-based modular assembly (CRISPRmass), a method for high-throughput construction of UAS-cDNA/ORF plasmid library in Drosophila using publicly available cDNA/ORF resources. CRISPRmass can be applied to editing various plasmid libraries.

Functional genomics screening offers a powerful approach to probe gene function and relies on the construction of genome-wide plasmid libraries. ...

Rapid Assembly of Multi-Gene Constructs using Modular Golden Gate Cloning

The Golden Gate cloning method enables the rapid assembly of multiple genes in any user-defined arrangement. It utilizes type IIS restriction enzymes that cut outside of their recognition sites and create a short overhang. This modular cloning (MoClo) system uses a hierarchical workflow in which different DNA parts, such as promoters, coding sequences (CDS), and terminators, are first cloned into an entry vector. Multiple entry vectors then assemble into transcription units. Several transcription units then connect into a multi-gene plasmid. The Golden Gate cloning strategy is of tremendous advantage because it allows scar-less, directional, and modular assembly in a one-pot reaction. The hierarchical workflow typically enables the facile cloning of a large variety of multi-gene constructs with no need for sequencing beyond entry vectors. The use of fluorescent protein dropouts enables easy visual screening. This work provides a detailed, step-by-step protocol for assembling multi-gene plasmids using the yeast modular cloning (MoClo) kit. We show optimal and suboptimal results of multi-gene plasmid assembly and provide a guide for screening for colonies. This cloning strategy is highly applicable for yeast metabolic engineering and other situations in which multi-gene plasmid cloning is required.

The goal of this protocol is to provide a detailed, step-by-step guide for assembling multi-gene constructs using the modular cloning system based on Golden Gate cloning. It also gives recommendations on critical steps to ensure optimal assembly based on our experiences.

The Golden Gate cloning method enables the rapid assembly of multiple genes in any user-defined arrangement. It utilizes type IIS restriction enzymes that ...

Bioengineering

High-Efficiency Production of Transgenic Soybean Hairy Roots

Soybean Hairy Root Transformation for the Analysis of Gene Function

Soybean (Glycine max) is a valuable crop in agriculture that has thousands of industrial uses. Soybean roots are the primary site of interaction with soil-borne microbes that form symbiosis to fix nitrogen and pathogens, which makes research involving soybean root genetics of prime importance to improve its agricultural production. The genetic transformation of soybean hairy roots (HRs) is mediated by the Agrobacterium rhizogenes strain NCPPB2659 (K599) and is an efficient tool for studying gene function in soybean roots, taking only 2 months from start to finish. Here, we provide a detailed protocol that outlines the method for overexpressing and silencing a gene of interest in soybean HRs. This methodology includes soybean seed sterilization, infection of cotyledons with K599, and the selection and harvesting of genetically transformed HRs for RNA isolation and, if warranted, metabolite analyses. The throughput of the approach is sufficient to simultaneously study several genes or networks and could determine the optimal engineering strategies prior to committing to long-term stable transformation approaches.

Author Spotlight: Soybean Hairy Root Transformation for the Analysis of Gene Function  

Here, we present a protocol for the high-efficiency production of transgenic soybean hairy roots.

Soybean (Glycine max) is a valuable crop in agriculture that has thousands of industrial uses. Soybean roots are the primary site of interaction with ...

Efficient Agroinfiltration of Plants for High-level Transient Expression of Recombinant Proteins

Mammalian cell culture is the major platform for commercial production of human vaccines and therapeutic proteins. However, it cannot meet the increasing worldwide demand for pharmaceuticals due to its limited scalability and high cost. Plants have shown to be one of the most promising alternative pharmaceutical production platforms that are robust, scalable, low-cost and safe. The recent development of virus-based vectors has allowed rapid and high-level transient expression of recombinant proteins in plants. To further optimize the utility of the transient expression system, we demonstrate a simple, efficient and scalable methodology to introduce target-gene containing Agrobacterium into plant tissue in this study. Our results indicate that agroinfiltration with both syringe and vacuum methods have resulted in the efficient introduction of Agrobacterium into leaves and robust production of two fluorescent proteins; GFP and DsRed. Furthermore, we demonstrate the unique advantages offered by both methods. Syringe infiltration is simple and does not need expensive equipment. It also allows the flexibility to either infiltrate the entire leave with one target gene, or to introduce genes of multiple targets on one leaf. Thus, it can be used for laboratory scale expression of recombinant proteins as well as for comparing different proteins or vectors for yield or expression kinetics. The simplicity of syringe infiltration also suggests its utility in high school and college education for the subject of biotechnology. In contrast, vacuum infiltration is more robust and can be scaled-up for commercial manufacture of pharmaceutical proteins. It also offers the advantage of being able to agroinfiltrate plant species that are not amenable for syringe infiltration such as lettuce and Arabidopsis. Overall, the combination of syringe and vacuum agroinfiltration provides researchers and educators a simple, efficient, and robust methodology for transient protein expression. It will greatly facilitate the development of pharmaceutical proteins and promote science education.

Plants offer a novel system for the production of pharmaceutical proteins on a commercial scale that is more scalable, cost-efficient and safe than current expression paradigms. In this study, we report a simple and convenient, yet scalable approach to introduce target-gene containing Agrobacterium tumefaciens into plants for protein transient expression.

Mammalian cell culture is the major platform for commercial production of human vaccines and therapeutic proteins. However, it cannot meet the increasing ...

Plant Promoter Analysis: Identification and Characterization of Root Nodule Specific Promoter in the Common Bean

The upstream sequences of gene coding sequences are termed as promoter sequences. Studying the expression patterns of promoters are very significant in understanding the gene regulation and spatiotemporal expression patterns of target genes. On the other hand, it is also critical to establish promoter evaluation tools and genetic transformation techniques that are fast, efficient, and reproducible. In this study, we investigated the spatiotemporal expression pattern of the rhizobial symbiosis-specific nodule inception (NIN) promoter of Phaseolus vulgaris in the transgenic hairy roots. Using plant genome databases and analysis tools we identified, isolated, and cloned the P. vulgaris NIN promoter in a transcriptional fusion to the chimeric reporter &#946;-glucuronidase (GUS) GUS-enhanced::GFP. Further, this protocol describes a rapid and versatile system of genetic transformation in the P. vulgaris using Agrobacterium rhizogenes induced hairy roots. This system generates &#8805;2 cm hairy roots at 10 to 12 days after transformation. Next, we assessed the spatiotemporal expression of NIN promoter in Rhizobium inoculated hairy roots at periodic intervals of post-inoculation. Our results depicted by GUS activity show that the NIN promoter was active during the process of nodulation. Together, the present protocol demonstrates how to identify, isolate, clone, and characterize a plant promoter in the common bean hairy roots. Moreover, this protocol is easy to use in non-specialized laboratories.

Promoter expression analyses are crucial to improving the understanding of gene regulation and the spatiotemporal expression of target genes. Herein we present a protocol to identify, isolate, and clone a plant promoter. Further, we describe the characterization of the nodule-specific promoter in the common bean hairy roots.

The upstream sequences of gene coding sequences are termed as promoter sequences. Studying the expression patterns of promoters are very significant in ...

One-Step Hairy Root Transformation Method for Advancing Root-Related Biology

An Efficient and Reproducible Method for Producing Composite Plants by Agrobacterium rhizogenes-Based Hairy Root Transformation

Producing composite plants with transgenic roots and nontransgenic stems and buds using Agrobacterium rhizogenes-mediated hairy root transformation is a powerful tool to study root-related biology. Hairy root transformation is established in a wide range of dicotyledons and in several monocotyledon species and is almost independent of the genotype. The traditional method of hypocotyl injection with A. rhizogenes to obtain composite plants is inefficient, time-consuming, laborious, and frequently causes the death of tender and tiny hypocotyl plants. A highly efficient, one-step hairy root transformation mediated by A. rhizogenes was established previously, which eliminates the need for transplanting after producing hairy roots. In this study, a partial hypocotyl and primary root were removed, the hypocotyl incision site was coated with A. rhizogenes, and&#160;then hypocotyls were planted in sterile vermiculite. After 12 days of cultivation, the hypocotyl incision expanded and new hairy roots were induced. This article provides the detailed protocol of a one-step transformation method mediated by A. rhizogenes, with its effectiveness demonstrated by producing composite plants of wild soybean, Solanum americanum, and pumpkin.

Author Spotlight: Streamlining Composite Plant Production via Agrobacterium rhizogenes-Mediated Hairy Root Transformation 

Here, we provide the detailed protocol of a one-step transformation method mediated by Agrobacterium tumefaciens to produce composite plants.

Producing composite plants with transgenic roots and nontransgenic stems and buds using Agrobacterium rhizogenes-mediated hairy root transformation is a ...

High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Transient Expression in Nicotiana Benthamiana Leaves for Triterpene Production at a Preparative Scale

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease

Inducing Hairy Roots by Agrobacterium rhizogenes-Mediated Transformation in Tartary Buckwheat (Fagopyrum tataricum)

CcCIPK14 Gene Function Analysis to Illuminate the Efficient Root Transgenic System

CRISPR-Based Modular Assembly for High-Throughput Construction of a UAS-cDNA/ORF Plasmid Library

Rapid Assembly of Multi-Gene Constructs using Modular Golden Gate Cloning

Soybean Hairy Root Transformation for the Analysis of Gene Function

Efficient Agroinfiltration of Plants for High-level Transient Expression of Recombinant Proteins

Plant Promoter Analysis: Identification and Characterization of Root Nodule Specific Promoter in the Common Bean

An Efficient and Reproducible Method for Producing Composite Plants by Agrobacterium rhizogenes-Based Hairy Root Transformation