We thank Gordon Freeman for providing the anti-PD-L1 blocking antibody. We thank the clinical and laboratory staff at the Massachusetts General Hospital and all study participants for their invaluable role in this project.
This study was supported by the National Institute of Allergy and Infectious Diseases of the National Institutes of Health (PO1 AI-080192; D.E.K), the National Heart Lung and Blood Institute of the National Institutes of Health (RO1 HL-092565; D.E.K). D.E.K is supported by a Research Scholar Career Award of the Quebec Health Research Fund (FRQS). FP is supported by a fellowship grant of the Massachusetts General Hospital Executive Committee on Research and the Harvard Global Health Institute (HGHI).&#160;

1. Depletion and Isolation of PBMCs via Ficoll Separation
<ol>
	<li>Deplete CD8+ T cells by adding Human CD8+ Depletion Cocktail at 50 &#956;l/ml of whole blood.</li>
	<li>Mix well and incubate for 20 min at room temperature (18-25 &#176;C).</li>
	<li>After incubation, mix whole blood with HBSS (Hank&#39;s Balanced Salt Solution without Ca2+ or Mg2+) and layer over Histopaque. Spin at 340 rcf for 30 min (no brake, slow acceleration).</li>
	<li>Collect PBMCs and transfer to a new 50ml conical. Wash 2x with 45 ml RPMI 1640 supplemented with 50 IU Penicillin, 50 &#956;g/ml Streptomycin, 2 mM L-glutamine, and 1% HEPES by spinning for 10 min at 340 rcf.</li>
</ol>
2. Antibody Blockade and Antigen-Specific Stimulation of Cells
<ol>
	<li>Resuspend cells at 2x106 per condition in RPMI 1640 containing 10% Human Serum supplemented with 50 IU Penicillin, 50 &#956;g/ml Streptomycin, 2 mM L-glutamine, and 1% HEPES, accounting for 500 &#956;l per condition.</li>
	<li>Aliquot 500 &#956;l of cell suspension per FACS tube.</li>
	<li>Depending on the pathway investigated, add PD-L1, IL-10R&#945; blocking antibodies and/or isotype controls at 10 &#956;g/ml and incubate for 15 min at 37 &#176;C, 5% CO2.</li>
	<li>Stimulate cells with an HIV-1 Gag peptide pool at 1 &#956;g/ml/peptide final concentration. Also include a &#34;no stimulation&#34; control for each blocking condition. Incubate at 37 &#176;C, 5% CO2 for 48 hr.</li>
</ol>
3. Collection and Analysis of Supernatant
<ol>
	<li>After 48 hr, spin down FACS tubes for 7 min at 340 rcf.</li>
	<li>Carefully collect 2 x 225 &#956;l supernatant in Eppendorf tubes for Luminex bead arrays without disturbing the pellet.</li>
	<li>Inactivate virus in the collected supernatant with 25 &#956;l 0.5% PBS-Tween to give a final concentration of 0.05% PBS-Tween.</li>
	<li>Store collected supernatants that are not immediately used in a -80 &#176;C freezer.</li>
	<li>Measure desired cytokine concentrations using Millipore Luminex kit according to manufacturer&#39;s protocol.</li>
</ol>
4. Collection and Phenotypic Analysis of Cells via Flow Cytometry
<ol>
	<li>After collecting supernatant, wash cells in 3ml PBS. Spin cells for 7 min at 340 rcf and decant excess wash.</li>
	<li>Stain for viability using a LIVE/DEAD Fixable Dead Cell Stain Kit according to manufacturer&#39;s protocol.</li>
	<li>Wash cells in PBS for 7 min at 340 rcf and at 4 &#176;C. Resuspend in 100 &#956;l PBS 1% FBS.</li>
	<li>If staining for monocytes or other antigen presenting cells, block Fc receptors by adding 1.4 &#956;l of FcR blocking reagent and vortex to mix.</li>
	<li>Incubate for 10 min at 4 &#176;C.</li>
	<li>Add surface antibodies, vortex, and incubate for 20 min at 4 &#176;C in the dark.</li>
	<li>Wash cells with PBS 1% FBS, decant excess wash, and add 200 &#956;l 4% paraformaldehyde. Incubate at room temperature&#160;for 20 min in the dark.</li>
	<li>Wash cells with PBS 1% FBS, resuspend in 250 &#956;l PBS 1% FBS, and acquire on a multilaser flow cytometer (e.g.&#160;BD LSRII or Fortessa).</li>
</ol>
5. Analysis of Cells via qRT-PCR
<ol>
	<li>For cells not analyzed via flow cytometry: after supernatant collection, lyse cells in 300 &#956;l Qiagen Buffer RLT containing 1% beta-mercaptoethanol. If not continuing with protocol, cells can be frozen at -80 &#176;C after this point.</li>
	<li>Isolate RNA using an RNA isolation kit following the manufacturer&#39;s protocol.</li>
	<li>Synthesize cDNA from RNA using a cDNA synthesis kit following the manufacturer&#39;s protocol.</li>
	<li>Perform quantitative PCR using SYBR Green technology.</li>
	<li>Create a primer mix for each primer used including housekeeping genes (e.g.&#160;IL-13, IL-10, IFN-&#947;, GAPDH) by adding primers to nuclease-free water to give a final concentration of 10 &#956;M. Keep on ice.</li>
	<li>Create a master mix for each primer by adding 10.5 &#956;l nuclease-free water, 12.5 &#956;l SYBR green, and 1 &#956;l primer mix per plate well. Keep on ice.</li>
	<li>Pipette 24 &#956;l master mix into each well of the plate that will be used.</li>
	<li>Add 1 &#956;l cDNA to each well according to template.</li>
	<li>Cap wells and centrifuge plate for 3 min&#160;at 800 rcf.</li>
	<li>Run plate on a qRT-PCR machine, e.g.&#160;a Stratagene MX3005P instrument.</li>
</ol>
6. Adaptation for Intracellular Cytokine Staining at 48 hr
Add Brefeldin and Monensin 6 hr prior to intracellular cytokine staining. Brefeldin is added at a concentration of 10 &#956;g/ml while Monensin is added according to manufacturer&#39;s instructions. For convenience, Brefeldin can be added 12 hr prior to stain at a concentration of 5 &#956;g/ml.
<ol>
	<li>After surface stain, wash cells with PBS 1% FBS and stain for intracellular cytokines such as IL-12, IFN-&#947;, and TNF-&#945; using a Fixation/Permeabilization Solution kit and protocol.</li>
	<li>Wash cells, resuspend in 250 &#956;l PBS 1% FBS, and run on a multilaser flow cytometer (e.g. BD LSR II or Fortessa).</li>
</ol>
7. Adaptation for Sorting Cells
<ol>
	<li>16 hr after stimulation, stain for viability using LIVE/DEAD Fixable Dead Cell Stain Kit according to manufacturer&#39;s protocol. Keep cells on ice during entire procedure.</li>
	<li>Wash cells with PBS for 7 min at 340 rcf and at 4 &#176;C. Resuspend in 100 &#956;l PBS 1% FBS.</li>
	<li>Add surface antibodies, vortex to mix, and incubate cells on ice in the dark for 20 min.</li>
	<li>Wash cells with PBS 1% FBS at 340 rcf and at 4 &#176;C and resuspend in 500 &#956;l cold RPMI 1640 containing 10% Fetal Bovine Serum supplemented with 50 IU Penicillin, 50 &#956;g/ml Streptomycin, 2 mM L-glutamine, and 1% HEPES.</li>
	<li>Filter cells using 5 ml Polystyrene Round-Bottom Tube with Cell-Strainer cap.</li>
	<li>Prepare collection tubes for sort by adding 200 &#956;l RPMI 1640 containing 10% Fetal Bovine Serum supplemented with 50 IU Penicillin, 50 &#956;g/ml Streptomycin, 2 mM L-glutamine, and 1% HEPES to each tube. Keep all tubes on ice during sort.</li>
	<li>Live sort the cell subsets of interest on an instrument (e.g.&#160;BD FACS Aria II) located in a facility equipped for biohazardous material.</li>
	<li>After cells have been sorted, place cells back in the incubator for desired amount of time and follow with supernatant collection/Luminex analysis and cell pellet collection/PCR analysis.</li>
</ol>

<ol>
	<li>Zajac, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+immune+evasion+due+to+persistence+of+activated+T+cells+without+effector+function.">Viral immune evasion due to persistence of activated T cells without effector function.</a> J. Exp. Med. 188, 2205-2213 (1998).</li><li>Wherry, E. J., Blattman, J. N., Murali-Krishna, K., vander Most, R., Ahmed, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+persistence+alters+CD8+T-cell+immunodominance+and+tissue+distribution+and+results+in+distinct+stages+of+functional+impairment.">Viral persistence alters CD8 T-cell immunodominance and tissue distribution and results in distinct stages of functional impairment.</a> J. Virol. 77, 4911-4927 (2003).</li><li>Kwon, D. S., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+and+detrimental+roles+of+IL-10+in+HIV+pathogenesis.">Protective and detrimental roles of IL-10 in HIV pathogenesis.</a> Eur. Cytokine Netw. 21, 208-214 (2010).</li><li>Porichis, F., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+PD-1+in+HIV+pathogenesis+and+as+target+for+therapy.">Role of PD-1 in HIV pathogenesis and as target for therapy.</a> Curr. HIV/AIDS Rep. 9, 81-90 (2012).</li><li>Wherry, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cell+exhaustion.">T cell exhaustion.</a> Nat. 12, 492-499 (2011).</li><li>Trautmann, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Upregulation+of+PD-1+expression+on+HIV-specific+CD8++T+cells+leads+to+reversible+immune+dysfunction.">Upregulation of PD-1 expression on HIV-specific CD8+ T cells leads to reversible immune dysfunction.</a> Nat. Med. 12, 1198-1202 (2006).</li><li>Day, C. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+expression+on+HIV-specific+T+cells+is+associated+with+T-cell+exhaustion+and+disease+progression.">PD-1 expression on HIV-specific T cells is associated with T-cell exhaustion and disease progression.</a> Nature. 443, 350-354 (2006).</li><li>Brockman, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-10+is+up-regulated+in+multiple+cell+types+during+viremic+HIV+infection+and+reversibly+inhibits+virus-specific+T+cells.">IL-10 is up-regulated in multiple cell types during viremic HIV infection and reversibly inhibits virus-specific T cells.</a> Blood. 114, 346-356 (2009).</li><li>Barber, D. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restoring+function+in+exhausted+CD8+T+cells+during+chronic+viral+infection.">Restoring function in exhausted CD8 T cells during chronic viral infection.</a> Nature. 439, 682-687 (2006).</li><li>Zhang, J. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+up-regulation+is+correlated+with+HIV-specific+memory+CD8++T-cell+exhaustion+in+typical+progressors+but+not+in+long-term+nonprogressors.">PD-1 up-regulation is correlated with HIV-specific memory CD8+ T-cell exhaustion in typical progressors but not in long-term nonprogressors.</a> Blood. 109, 4671-4678 (2007).</li><li>Ndhlovu, Z. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-dimensional+immunomonitoring+models+of+HIV-1-specific+CD8+T-cell+responses+accurately+identify+subjects+achieving+spontaneous+viral+control.">High-dimensional immunomonitoring models of HIV-1-specific CD8 T-cell responses accurately identify subjects achieving spontaneous viral control.</a> Blood. 121, 801-811 (2013).</li><li>Porichis, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Responsiveness+of+HIV-specific+CD4+T+cells+to+PD-1+blockade.">Responsiveness of HIV-specific CD4 T cells to PD-1 blockade.</a> Blood. 118, 965-974 (2011).</li><li>Kwon, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD4++CD25++regulatory+T+cells+impair+HIV-1-specific+CD4+T+cell+responses+by+upregulating+interleukin-10+production+in+monocytes.">CD4+ CD25+ regulatory T cells impair HIV-1-specific CD4 T cell responses by upregulating interleukin-10 production in monocytes.</a> 86, 6586-6594 (2012).</li></ol>

The authors declare that they have no competing financial interests.

Supernatant collection is an imperative part of this experimental design. When harvesting supernatants for the Luminex assay, aliquots were made and kept at -80 &#176;C to prevent protein degradation due to freeze-thaw cycles. Freezing and thawing can be harsh processes for proteins, and by minimizing freeze-thaws, signal will be maximized in assays. Therefore, it is easier to obtain repeatable and more accurate data when working from aliquots that have been freeze-thawed the same number of times.
<p class="jove_cont...

During persistent viral infections, virus specific-T cells acquire functional defects in a process known as T cell exhaustion. Early in vivo studies in the murine LCMV model of chronic viral infection indicated that exhausted virus-specific T cells have reduced cytolytic function against virally infected cells, lose their ability to proliferate and have reduced capacity to produce cytokines such as IL-2, TNF-&#945; and IFN-&#947;1,2. A complex network of immunoregulatory pathways, such as PD-1 and IL-10, are upregulated during chronic infections and contribute to T cell dysfunction (reviewed in3,4). In vivo administration of blocking antibodies against these inhibitory pathways in the LCMV mouse model restored function of exhausted virus-specific T cells and enhanced viral clearance, indicating that T cell exhaustion is a partially reversible phenomenon (reviewed in 5).
Findings on the LCMV model were quickly extended to human chronic viral infections such as HBV, HCV and HIV5. In chronic HIV-1 infection, PD-1 and IL-10 pathways are upregulated in infected subjects and correlate with parameters of disease progression, directly with the viral load and inversely with the CD4 count6-8. Antibody blockade of the PD-1 or IL-10 pathways in vitro restored proliferation of HIV-specific CD4 and CD8 T cells indicating that, similar to the LCMV mouse model, T cell exhaustion in humans is a partially reversible phenomenon. However, due to the delicate nature of experiments on human samples as well as limitations in the sensitivity of in vitro assays, thorough investigation of the functional restoration profiles achieved by these interventions is strikingly absent. Proliferation assays have been, so far, the only reliable in vitro assay tested in most studies, yet there is a remarkable lack of evidence on the impact of these interventions on: 1) the killing capacity of cytotoxic T cells, 2) the antiviral effect of T cells on viral replication, 3) the cytokine secretion profile, and 4) the effect on CD4 T cell help on other cell subsets.
Intracellular cytokine staining (ICS) is a very useful and widely used flow cytometry based assay that is used to detect production of cytokines in various cell types in both mice and humans. It has also been used to investigate the effect of antibody blockade of inhibitory pathways. In ICS assays, cytokine secretion is blocked by the addition of Brefeldin and/or Monensin. Cytokines trapped inside the cells are then detected with fluorescent antibodies using polychromatic flow cytometry. The duration of the assay is usually limited to 6 or 12 hr after antigen stimulation since both Brefeldin and Monensin, which are typically added within 2 hr&#160;of antigen addition, are toxic to the cells. The ICS assay is a powerful technique that has been useful in the investigation of the effect of in vivo administration of blocking antibody intervention in mice where cells were extracted after a certain period of time after antibody exposure9. However, there are several limitations for the application of this experimental approach to evaluate the impact of blockade of inhibitory receptors in human samples. When performing antibody interventions of inhibitory pathways in a 6 or 12 hr stimulation in vitro (typically the case with human samples), blockade of inhibitory receptors in most cases does not alter the frequency of responding antigen-specific T cells as measured by standard ICS assays6, 7 . Measurements of per-cell cytokine production as measured by mean or median fluorescence intensity have given inconsistent results6, 7, 10. On the other hand, when ICS is performed at a late time point after stimulation (i.e. six days), changes in the number of cytokine-secreting cells can be observed. The differences are a combined effect of altered proliferation, survival, and changes in effector function that accumulate over the specified period of time6. One way to partially overcome these limitations is to incubate for longer periods of time (e.g. 36 hr, 60 hr, etc.) with the antigen before the addition of the cytokine secretion blocker without waiting for proliferation to occur. We have successfully used this method to determine the kinetics of cytokine secretion by HIV-specific CD4 and CD8 T cells11,12; however, this approach is not able to detect small responses and will not give an integrated result of the total cytokine secretion occurring since stimulation. Therefore, ICS is not a sensitive enough method to detect the impact of blockade of inhibitory pathways on the quantity of cytokines produced by activated T cells compared with cytokine mRNA quantitation or measurements of cytokine secretion in the supernatant at the same time points. Additionally, most of the cytokines produced by activated T cells act in autocrine fashion by contributing to either positive or negative feedback loops through interaction with antigen presenting cells. Therefore, addition of Brefeldin or Monensin during the ICS assay prevents cytokine secretion and thus stimulation of T cells is not optimal. Finally, detection of multiple cytokines with ICS is limited by the availability and sensitivity of antibodies for detection of cytokines with flow cytometry as well as by constraints in the number of fluorochromes that can be used simultaneously in any given panel.
We developed a highly sensitive in vitro experimental approach to evaluate the impact of immunoregulatory pathways in regulating cytokine secretion by HIV-specific CD4 T cells and subsequently CD4 help to antigen presenting cells (APCs) and natural killer cells (NK cells). This method can also be used to evaluate the impact of blockade of inhibitory molecules on CD8 T cell function by depleting the CD4 T cells from PBMCs or by stimulating with optimal peptides that are recognized only by CD8 T cells. In contrast to intracellular cytokine staining assays, we decided not to interfere with the cytokine secretion by HIV-specific CD4 T cells in order to be able to: 1) perform a more accurate quantification of the cytokine levels produced; 2) investigate a broader panel of cytokines or effector molecules; and 3) evaluate the impact of cytokines produced by HIV-specific CD4 T cells on other cell subsets. We stimulate CD8 depleted PBMCs with an HIV-1 Gag peptide pool in the presence of blocking antibodies for the immunoregulatory pathway of interest. After the desired time of incubation, usually 48 hr, we collect the supernatants to measure cytokine secretion with bead arrays and collect the cell pellets either for phenotypic analysis of the different cell subsets or for transcriptional analysis. Of note, at this 48 hr time point, we do not detect a significant population of proliferating T cells12. This is a flexible approach and several adaptations of this design can be applied to address different hypotheses. For example, the individual cell subsets (such as HIV-specific CD4 T cells or PD-1 high CD4 T cells, etc.) can be sorted after 12 hr of incubation before further incubation for 36 hr followed by collection of supernatants and cell pellets to investigate more specifically the impact of blockade interventions on cytokine secretion by defined subpopulations of PBMCs.

<table><tbody><tr><td>Hanks Balanced Salt Solution without Ca&lt;sup&gt;2+&lt;/sup&gt; or Mg&lt;sup&gt;2+&lt;/sup&gt;</td><td>Sigma</td><td>H9394</td><td></td></tr><tr><td>RPMI 1640</td><td>Sigma</td><td>R0883</td><td></td></tr><tr><td>Histopaque-1077</td><td>Sigma</td><td>10771</td><td></td></tr><tr><td>Human Serum AB</td><td>Gemini BioProducts</td><td>100-512</td><td></td></tr><tr><td>Penicillin/Streptomycin</td><td>Mediatech</td><td>30 001 CI</td><td></td></tr><tr><td>L-glutamine</td><td>Mediatech</td><td>25 005 CI</td><td></td></tr><tr><td>HEPES buffer</td><td>Mediatech</td><td>25060CI</td><td></td></tr><tr><td>FcR blocking reagent, human</td><td>Miltenyi</td><td>130-059-901</td><td></td></tr><tr><td>RosetteSep Human CD8+ Depletion Cocktail </td><td>Stem Cell</td><td>15663</td><td></td></tr><tr><td>LIVE/DEAD Fixable Dead Cell Stain Kit, for UV excitation</td><td>Invitrogen</td><td>L23105</td><td></td></tr><tr><td>Rneasy Mini Kit</td><td>Qiagen</td><td>74104</td><td></td></tr><tr><td>Improm-II Reverse Transcription System</td><td>Promega</td><td>A3800</td><td></td></tr><tr><td>Brilliant II SYBR qPCR Low Rox Master Mix</td><td>Agilent</td><td>600830</td><td></td></tr><tr><td>BD Cytofix/Cytoperm Fixation/Permeabilization Solution Kit</td><td>BD</td><td>554714</td><td></td></tr><tr><td>Tween-20</td><td>Fisher</td><td>BP337100</td><td></td></tr><tr><td>IFN-&amp;#947; primer</td><td>Invitrogen</td><td></td><td>FOR: CGAGATGACTTCGAAAAGCTGA REV: TCTTCGACCTCGAAACAGCA</td></tr><tr><td>GAPDH primer</td><td>Invitrogen</td><td></td><td>FOR: TCATCATCTCTGCCCCCTCT REV: AGTGATGGCATGGACTGTGG</td></tr></tbody></table>

in vitro assay to evaluate the impact of immunoregulatory pathways on hiv-specific cd4 t cell effector function

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are upregulated upon this ongoing antigen exposure and contribute to loss of proliferation, reduced cytolytic function, and impaired cytokine production by CD4 and CD8 T cells. In the murine model of LCMV infection, administration of blocking antibodies against these two pathways augmented T cell responses. However, there is currently no in vitro assay to measure the impact of such blockade on cytokine secretion in cells from human samples. Our protocol and experimental approach enable us to accurately and efficiently quantify the restoration of cytokine production by HIV-specific CD4 T cells from HIV infected subjects.
Here, we depict an in vitro experimental design that enables measurements of cytokine secretion by HIV-specific CD4 T cells and their impact on other cell subsets. CD8 T cells were depleted from whole blood and remaining PBMCs were isolated via Ficoll separation method. CD8-depleted PBMCs were then incubated with blocking antibodies against PD-L1 and/or IL-10R&#945; and, after stimulation with an HIV-1 Gag peptide pool, cells were incubated at 37 &#176;C, 5% CO2. After 48 hr, supernatant was collected for cytokine analysis by beads arrays and cell pellets were collected for either phenotypic analysis using flow cytometry or transcriptional analysis using qRT-PCR. For more detailed analysis, different cell populations were obtained by selective subset depletion from PBMCs or by sorting using flow cytometry before being assessed in the same assays. These methods provide a highly sensitive and specific approach to determine the modulation of cytokine production by antigen-specific T-helper cells and to determine functional interactions between different populations of immune cells.

When performing cytokine measurements using this in vitro system, it is essential to be able to distinguish the antigen-specific responses compared to the no stimulation control. In general, we considered positive responses as any values of the antigenic stimulation that give at least three-fold increase in cytokine levels compared to the no stimulation control and which were within the linear range of the assay. We are using high sensitivity bead array assays that can detect concentrations of cytokines as low a...

Watch this Scientific Journal Video about In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function at JoVE.com

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

We developed an in vitro assay to investigate the role of immunoregulatory pathways in the regulation of cytokine secretion by HIV-specific CD4 T cells.

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are ...

in-vitro-assay-to-evaluate-impact-immunoregulatory-pathways-on-hiv

Universidad de Cartagena UDEC

Research

JoVE Journal

Immunology and Infection

14.0K Views.  The Ragon Institute of MGH, MIT and Harvard. We developed an in vitro assay to investigate the role of immunoregulatory pathways in the regulation of cytokine secretion by HIV-specific CD4 T cells.

Video: In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

Preparation and Use of HIV-1 Infected Primary CD4+ T-Cells as Target Cells in Natural Killer Cell Cytotoxic Assays

Natural killer (NK) cells are a vital component of the innate immune response to virus-infected cells. It is important to understand the ability of NK cells to recognize and lyse HIV-1 infected cells because identifying any aberrancy in NK cell function against HIV-infected cells could potentially lead to therapies that would enhance their cytolytic activity. There is a need to use HIV-infected primary T-cell blasts as target cells rather then infected-T-cell lines in the cytotoxicity assays. T-cell lines, even without infection, are quite susceptible to NK cell lysis. Furthermore, it is necessary to use autologous primary cells to prevent major histocompatibility complex class I mismatches between the target and effector cell that will result in lysis. Early studies evaluating NK cell cytolytic responses to primary HIV-infected cells failed to show significant killing of the infected cells 1,2. However, using HIV-1 infected primary T-cells as target cells in NK cell functional assays has been difficult due the presence of contaminating uninfected cells 3. This inconsistent infected cell to uninfected cell ratio will result in variation in NK cell killing between samples that may not be due to variability in donor NK cell function. Thus, it would be beneficial to work with a purified infected cell population in order to standardize the effector to target cell ratios between experiments 3,4. Here we demonstrate the isolation of a highly purified population of HIV-1 infected cells by taking advantage of HIV-1's ability to down-modulate CD4 on infected cells and the availability of commercial kits to remove dead or dying cells 3-6. The purified infected primary T-cell blasts can then be used as targets in either a degranulation or cytotoxic assay with purified NK cells as the effector population 5-7. Use of NK cells as effectors in a degranulation assay evaluates the ability of an NK cell to release the lytic contents of specialized lysosomes 8 called "cytolytic granules". By staining with a fluorochrome conjugated antibody against CD107a, a lysosomal membrane protein that becomes expressed on the NK cell surface when the cytolytic granules fuse to the plasma membrane, we can determine what percentage of NK cells degranulate in response to target cell recognition. Alternatively, NK cell lytic activity can be evaluated in a cytotoxic assay that allows for the determination of the percentage of target cells lysed by release of 51Cr from within the target cell in the presence of NK cells.

Cytotoxicity assays to measure natural killer cell lytic responses to HIV-infected cells is limited by the purity of the target cells. We demonstrate here the isolation of a highly purified population of HIV-1 infected primary T-cell blasts by taking advantage of HIV-1 s ability to down-modulate CD4.

 Natural killer (NK) cells are a vital component of the innate immune response to virus-infected cells. It is important to understand the ability of NK ...

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Regulatory T cells (Tregs) are critical mediators of immune tolerance to self-antigens. In addition, they are crucial regulators of the immune response following an infection. Despite efforts to identify unique surface marker on Tregs, the only unique feature is their ability to suppress the proliferation and function of effector T cells. While it is clear that only in vitro assays can be used in assessing human Treg function, this becomes problematic when assessing the results from cross-sectional studies where healthy cells and cells isolated from subjects with autoimmune diseases (like Type 1 Diabetes-T1D) need to be compared. There is a great variability among laboratories in the number and type of responder T cells, nature and strength of stimulation, Treg:responder ratios and the number and type of antigen-presenting cells (APC) used in human in vitro suppression assays. This variability makes comparison between studies measuring Treg function difficult. The Treg field needs a standardized suppression assay that will work well with both healthy subjects and those with autoimmune diseases. We have developed an in vitro suppression assay that shows very little intra-assay variability in the stimulation of T cells isolated from healthy volunteers compared to subjects with underlying autoimmune destruction of pancreatic &beta;-cells. The main goal of this piece is to describe an in vitro human suppression assay that allows comparison between different subject groups. Additionally, this assay has the potential to delineate a small loss in nTreg function and anticipate further loss in the future, thus identifying subjects who could benefit from preventive immunomodulatory therapy1. Below, we provide thorough description of the steps involved in this procedure. We hope to contribute to the standardization of the in vitro suppression assay used to measure Treg function. In addition, we offer this assay as a tool to recognize an early state of immune imbalance and a potential functional biomarker for T1D.

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Tregs are potent suppressors of the immune system. There is a lack of unique surface markers to define them, hence, definitions of Tregs are primarily functional. Here we describe an optimized in vitro assay capable of identifying immune imbalance in subjects at risk to develop T1D.

Regulatory T cells (Tregs) are critical mediators of immune tolerance to self-antigens. In addition, they are crucial regulators of the immune response ...

Quantitative High-throughput Single-cell Cytotoxicity Assay For T Cells

Cancer immunotherapy can harness the specificity of immune response to target and eliminate tumors. Adoptive cell therapy (ACT) based on the adoptive transfer of T cells genetically modified to express a chimeric antigen receptor (CAR) has shown considerable promise in clinical trials1-4. There are several advantages to using CAR+ T cells for the treatment of cancers including the ability to target non-MHC restricted antigens and to functionalize the T cells for optimal survival, homing and persistence within the host; and finally to induce apoptosis of CAR+ T cells in the event of host toxicity5.
Delineating the optimal functions of CAR+ T cells associated with clinical benefit is essential for designing the next generation of clinical trials. Recent advances in live animal imaging like multiphoton microscopy have revolutionized the study of immune cell function in vivo6,7. While these studies have advanced our understanding of T-cell functions in vivo, T-cell based ACT in clinical trials requires the need to link molecular and functional features of T-cell preparations pre-infusion with clinical efficacy post-infusion, by utilizing in vitro assays monitoring T-cell functions like, cytotoxicity and cytokine secretion. Standard flow-cytometry based assays have been developed that determine the overall functioning of populations of T cells at the single-cell level but these are not suitable for monitoring conjugate formation and lifetimes or the ability of the same cell to kill multiple targets8.
Microfabricated arrays designed in biocompatible polymers like polydimethylsiloxane (PDMS) are a particularly attractive method to spatially confine effectors and targets in small volumes9. In combination with automated time-lapse fluorescence microscopy, thousands of effector-target interactions can be monitored simultaneously by imaging individual wells of a nanowell array. We present here a high-throughput methodology for monitoring T-cell mediated cytotoxicity at the single-cell level that can be broadly applied to studying the cytolytic functionality of T cells.

We describe a single-cell high-throughput assay to measure cytotoxicity of T cells when incubated with tumor target cells. This method employs a dense, elastomeric array of sub-nanoliter wells (~100,000 wells/array) to spatially confine the T cells and target cells at defined ratios and is coupled to fluorescence microscopy to monitor effector-target conjugation and subsequent apoptosis.

Cancer immunotherapy can harness the specificity of  immune response to target and eliminate tumors. Adoptive cell therapy (ACT)  based on the adoptive ...

New Tools to Expand Regulatory T Cells from HIV-1-infected Individuals

CD4+ Regulatory T cells (Tregs) are potent immune modulators and serve an important function in human immune homeostasis. Depletion of Tregs has led to measurable increases in antigen-specific T cell responses in vaccine settings for cancer and infectious pathogens. However, their role in HIV-1 immuno-pathogenesis remains controversial, as they could either serve to suppress deleterious HIV-1-associated immune activation and thus slow HIV-1 disease progression or alternatively suppress HIV-1-specific immunity and thereby promote virus spread. Understanding and modulating Treg function in the context of HIV-1 could lead to potential new strategies for immunotherapy or HIV vaccines. However, important open questions remain on their role in the context of HIV-1 infection, which needs to be carefully studied.
Representing roughly 5% of human CD4+ T cells in the peripheral blood, studying the Treg population has proven to be difficult, especially in HIV-1 infected individuals where HIV-1-associated CD4 T cell and with that Treg depletion occurs. The characterization of regulatory T cells in individuals with advanced HIV-1 disease or tissue samples, for which only very small biological samples can be obtained, is therefore extremely challenging. We propose a technical solution to overcome these limitations using isolation and expansion of Tregs from HIV-1-positive individuals.
Here we describe an easy and robust method to successfully expand Tregs isolated from HIV-1-infected individuals in vitro. Flow-sorted CD3+CD4+CD25+CD127low Tregs were stimulated with anti-CD3/anti-CD28 coated beads and cultured in the presence of IL-2. The expanded Tregs expressed high levels of FOXP3, CTLA4 and HELIOS compared to conventional T cells and were shown to be highly suppressive. Easier access to large numbers of Tregs will allow researchers to address important questions concerning their role in HIV-1 immunopathogenesis. We believe answering these questions may provide useful insight for the development of an effective HIV-1 vaccine.

CD4+ Regulatory T cells are potent immune-modulators and serve important functions in immune homeostasis. The paucity of these cells in peripheral blood makes functional studies challenging, specifically in the context of HIV-1-infection. We here describe a method to isolate and expand functional CD4+ Tregs from peripheral blood from HIV-1-infected individuals.

CD4+ Regulatory T cells (Tregs) are potent immune modulators and serve an important function in human immune homeostasis. Depletion of Tregs has led to ...

Assessing the Innate Sensing of HIV-1 Infected CD4+ T Cells by Plasmacytoid Dendritic Cells Using an Ex vivo Co-culture System.

HIV-1 innate sensing requires direct contact of infected CD4+ T cells with plasmacytoid dendritic cells (pDCs). In order to study this process, the protocols described here use freshly isolated human peripheral blood mononuclear cells (PBMCs) or plasmacytoid dendritic cells (pDCs) to sense infections in either T cell line (MT4) or heterologous primary CD4+ T cells. In order to ensure proper sensing, it is essential that PBMC are isolated immediately after blood collection and that optimal percentage of infected T cells are used. Furthermore, multi-parametric flow cytometric staining can be used to confirm that PBMC samples contain the different cell lineages at physiological ratios. A number of controls can also be included to evaluate viability and functionality of pDCs. These include, the presence of specific surface markers, assessing cellular responses to known agonist of Toll-Like Receptors (TLR) pathways, and confirming a lack of spontaneous type-I interferon (IFN) production. In this system, freshly isolated PBMCs or pDCs are co-cultured with HIV-1 infected cells in 96 well plates for 18-22 hr. Supernatants from these co-cultures are then used to determine the levels of bioactive type-I IFNs by monitoring the activation of the ISGF3 pathway in HEK-Blue IFN-&#945;/&#946; cells. Prior and during co-culture conditions, target cells can be subjected to flow cytometric analysis to determine a number of parameters, including the percentage of infected cells, levels of specific surface markers, and differential killing of infected cells. Although, these protocols were initially developed to follow type-I IFN production, they could potentially be used to study other imuno-modulatory molecules released from pDCs and to gain further insight into the molecular mechanisms governing HIV-1 innate sensing.

Assessing the Innate Sensing of HIV-1 Infected CD4+ T Cells by Plasmacytoid Dendritic Cells Using an Ex vivo Co-culture System.

Unlike cell-free HIV-1 particles, infected CD4+ T cells are effectively sensed by plasmacytoid dendritic cells (pDCs). This manuscript describes a method where peripheral blood mononuclear cells (PBMCs) or isolated pDCs are co-cultured with HIV-1 infected T cells to evaluate innate sensing by pDCs as assessed by release of type-I IFN.

HIV-1 innate sensing requires direct contact of infected CD4+ T cells with plasmacytoid dendritic cells (pDCs). In order to study this process, the ...

Conformational Evaluation of HIV-1 Trimeric Envelope Glycoproteins Using a Cell-based ELISA Assay

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins are able to fuel the fusion process through their conformational changes could lead to the design of better, more effective immunogens for vaccine strategies. Here we describe a cell-based ELISA assay that allows studying the recognition of trimeric HIV-1 Env by monoclonal antibodies. Following expression of HIV-1 trimeric Env at the surface of transfected cells, conformation specific anti-Env antibodies are incubated with the cells. A horseradish peroxidase-conjugated secondary antibody and a simple chemiluminescence reaction are then used to detect bound antibodies. This system is highly flexible and can detect Env conformational changes induced by soluble CD4 or cellular proteins. It requires minimal amount of material and no highly-specialized equipment or know-how. Thus, this technique can be established for medium to high throughput screening of antigens and antibodies, such as newly-isolated antibodies.

Understanding viral surface antigens conformations is required to evaluate antibody neutralization and guide the design of effective vaccine immunogens. Here we describe a cell-based ELISA assay that allows the study of the recognition of trimeric HIV-1 Env expressed at the surface of transfected cells by specific anti-Env antibodies.

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins ...

An In Vitro Model for Measuring Immune Responses to Malaria in the Context of HIV Co-infection

Malaria and HIV co-infection is a growing health priority. However, most research on malaria or HIV currently focuses on each infection individually. Although understanding the disease dynamics for each of these pathogens independently is vital, it is also important that the interactions between these pathogens are investigated and understood. 
We have developed a versatile in vitro model of HIV-malaria co-infection to study host immune responses to malaria in the context of HIV infection. Our model allows the study of secreted factors in cellular supernatants, cell surface and intracellular protein markers, as well as RNA expression levels. The experimental design and methods used limit variability and promote data reliability and reproducibility. 
All pathogens used in this model are natural human pathogens (Plasmodium falciparum and HIV-1), and all infected cells are naturally infected and used fresh. We use human erythrocytes parasitized with P. falciparum and maintained in continuous in vitro culture. We obtain freshly isolated peripheral blood mononuclear cells from chronically HIV-infected volunteers. Every condition used has an appropriate control (P. falciparum parasitized vs. normal erythrocytes), and every HIV-infected donor has an HIV uninfected control, from which cells are harvested on the same day. This model provides a realistic environment to study the interactions between malaria parasites and human immune cells in the context of HIV infection.

An In Vitro Model for Measuring Immune Responses to Malaria in the Context of HIV Co-infection

Human co-infection is difficult to replicate in vitro. However, human malaria parasites can readily be cultured in vitro, as can freshly isolated human peripheral blood mononuclear cells naturally infected with HIV. This provides an excellent model for studying early immune responses to malaria parasites in the context of HIV co-infection.

Malaria and HIV co-infection is a growing health priority. However, most research on malaria or HIV currently focuses on each infection individually. ...

Phenotypic and Functional Analysis of Activated Regulatory T Cells Isolated from Chronic Lymphocytic Choriomeningitis Virus-infected Mice

Regulatory T (Treg) cells, which express Foxp3 as a transcription factor, are subsets of CD4+ T cells. Treg cells play crucial roles in immune tolerance and homeostasis maintenance by regulating the immune response. The primary role of Treg cells is to suppress the proliferation of effector T (Teff) cells and the production of cytokines such as IFN-&#947;, TNF-&#945;, and IL-2. It has been demonstrated that Treg cells&#39; ability to inhibit the function of Teff cells is enhanced during persistent pathogen infection and cancer development. To clarify the function of Treg cells under resting or inflamed conditions, a variety of in vitro suppression assays using mouse or human Treg cells have been devised. The main aim of this study is to develop a method to compare the differences in phenotype and suppressive function between resting and activated Treg cells. To isolate activated Treg cells, mice were infected with lymphocytic choriomeningitis virus (LCMV) clone 13 (CL13), a chronic strain of LCMV. Treg cells isolated from the spleen of LCMV CL13-infected mice exhibited both the activated phenotype and enhanced suppressive activity compared with resting Treg cells isolated from na&#239;ve mice. Here, we describe the basic protocol for ex vivo phenotype analysis to distinguish activated Treg cells from resting Treg cells. Furthermore, we describe a protocol for the measurement of the suppressive activity of fully activated Treg cells.

Here, we describe a protocol to analyze the phenotype of regulatory T (Treg) cells isolated from na&#239;ve and chronic lymphocytic choriomeningitis virus-infected mice. In addition, we provide a process to evaluate the suppressive activity of the Treg cells.

Regulatory T (Treg) cells, which express Foxp3 as a transcription factor, are subsets of CD4+ T cells. Treg cells play crucial roles in immune tolerance ...

Stem-cell Based Engineered Immunity Against HIV Infection in the Humanized Mouse Model

With the rapid development of stem cell-based gene therapies against HIV, there is pressing requirement for an animal model to study the hematopoietic differentiation and immune function of the genetically modified cells. The humanized Bone-marrow/Liver/Thymus (BLT) mouse model allows for full reconstitution of a human immune system in the periphery, which includes T cells, B cells, NK cells and monocytes. The human thymic implant also allows for thymic selection of T cells in autologous thymic tissue. In addition to the study of HIV infection, the model stands as a powerful tool to study differentiation, development and functionality of cells derived from hematopoietic stem cells (HSCs). Here we outline the construction of humanized non-obese diabetic (NOD)-severe combined immunodeficient (SCID)-common gamma chain knockout (c&#947;-/-)-Bone-marrow/Liver/Thymus (NSG-BLT) mice with HSCs transduced with CD4 chimeric antigen receptor (CD4CAR) lentivirus vector. We show that the CD4CAR HSCs can successfully differentiate into multiple lineages and have anti-HIV activity. The goal of the study is to demonstrate the use of NSG-BLT mouse model as an in vivo model for engineered immunity against HIV. It is worth noting that, because lentivirus and human tissue is used, experiments and surgeries should be performed in a Class II biosafety cabinet in a Biosafety Level 2 (BSL2) with special precautions (BSL2+) facility.

This protocol describes the methods in constructing a humanized bone-marrow/liver/thymus mouse model with stem cell-based engineered immunity against HIV infection.

With the rapid development of stem cell-based gene therapies against HIV, there is pressing requirement for an animal model to study the hematopoietic ...

Medicine

Tailoring In Vivo Cytotoxicity Assays to Study Immunodominance in Tumor-specific CD8+ T Cell Responses

Carboxyfluorescein succinimidyl ester (CFSE)-based in vivo cytotoxicity assays enable sensitive and accurate quantitation of CD8+ cytolytic T lymphocyte (CTL) responses elicited against tumor- and pathogen-derived peptides. They offer several advantages over traditional killing assays. First, they permit the monitoring of CTL-mediated cytotoxicity within architecturally intact secondary lymphoid organs, typically in the spleen. Second, they allow for mechanistic studies during the priming, effector and recall phases of CTL responses. Third, they provide useful platforms for vaccine/drug efficacy testing in a truly in vivo setting. Here, we provide an optimized protocol for the examination of concomitant CTL responses against more than one peptide epitope of a model tumor antigen (Ag), namely, simian virus 40 (SV40)-encoded large T Ag (T Ag). Like most other clinically relevant tumor proteins, T Ag harbors many potentially immunogenic peptides. However, only four such peptides induce detectable CTL responses in C57BL/6 mice. These responses are consistently arranged in a hierarchical order based on their magnitude, which forms the basis for TCD8 &#8220;immunodominance&#8221; in this powerful system. Accordingly, the bulk of the T Ag-specific TCD8 response is focused against a single immunodominant epitope while the other three epitopes are recognized and responded to only weakly. Immunodominance compromises the breadth of antitumor TCD8 responses and is, as such, considered by many as an impediment to successful vaccination against cancer. Therefore, it is important to understand the cellular and molecular factors and mechanisms that dictate or shape TCD8 immunodominance. The protocol we describe here is tailored to the investigation of this phenomenon in the T Ag immunization model, but can be readily modified and extended to similar studies in other tumor models. We provide examples of how the impact of experimental immunotherapeutic interventions can be measured using in vivo cytotoxicity assays.

Tailoring In Vivo Cytotoxicity Assays to Study Immunodominance in Tumor-specific CD8+ T Cell Responses

We describe here a flow cytometry-based in vivo killing assay that enables examination of immunodominance in cytotoxic T lymphocyte (CTL) responses to a model tumor antigen. We provide examples of how this elegant assay may be employed for mechanistic studies and for drug efficacy testing.

Carboxyfluorescein succinimidyl ester (CFSE)-based in vivo cytotoxicity assays enable sensitive and accurate quantitation of CD8+ cytolytic T lymphocyte ...

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Preparation and Use of HIV-1 Infected Primary CD4+ T-Cells as Target Cells in Natural Killer Cell Cytotoxic Assays

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Quantitative High-throughput Single-cell Cytotoxicity Assay For T Cells

New Tools to Expand Regulatory T Cells from HIV-1-infected Individuals

Assessing the Innate Sensing of HIV-1 Infected CD4⁺ T Cells by Plasmacytoid Dendritic Cells Using an Ex vivo Co-culture System.

Conformational Evaluation of HIV-1 Trimeric Envelope Glycoproteins Using a Cell-based ELISA Assay

An In Vitro Model for Measuring Immune Responses to Malaria in the Context of HIV Co-infection

Phenotypic and Functional Analysis of Activated Regulatory T Cells Isolated from Chronic Lymphocytic Choriomeningitis Virus-infected Mice

Stem-cell Based Engineered Immunity Against HIV Infection in the Humanized Mouse Model

Tailoring In Vivo Cytotoxicity Assays to Study Immunodominance in Tumor-specific CD8⁺ T Cell Responses