회절 데이터 동남 지역 공동 액세스 팀 (SER-고양이) 22-ID와 22-BM beamlines에서 고급 광자 소스 (AP), Argonne 국립 연구소에서 수집 했다. SAXS 데이터 SIBYLS beamline에 사전 빛 소스 (ALS), 로렌스 버클리 국립 연구소에 수집 되었다. 우리는 직원에 대 한 그들의 원격 데이터 수집 및 처리 SIBYLS beamline에 감사 하 고 싶습니다. 우리는 국립 연구소의 환경 건강 과학 (NIEHS) 질량 분석 연구 및 지원 그룹 단백질 도메인 경계를 결정 하는 도움을 위한 감사. 이 작품으로 미국 국립 연구소의 건강 교내 연구 프로그램; 지원 미국 국립 연구소의 환경 건강 과학 (NIEHS)의 (R. E. S. 지아 ES103247)와 건강 연구 (CIHR, M.C.P에 146626)의 캐나다 학회. AP의 사용을 지원 했다 미국 에너지 부, 과학의 사무실, 사무실의 기본적인 에너지 과학 계약 번호에서 W-31-109-잉글랜드-38. 사용 고급 라이트 소스 (ALS)의 감독, 과학의 사무실, 사무실의 기본적인 에너지 과학, 계약 번호에서 미국 에너지 부의에 의해 지원 되었다 드-AC02-05CH11231입니다. 추가 지원 SIBYLS SAXS beamline 건강의 국립 연구소에서 유래에 대 한 프로젝트 노스 (R01GM105404)와 하이 엔드 계측 그랜트 S10OD018483. 우리는 또한이 원고에의 그들의 중요 한 독서에 대 한 안드레아 달과 박사 새 라 안 드레를 감사 하 고 싶습니다.

저자는 공개 없다.

이 프로토콜을 사용 하 여, S. cerevisiae 에서 재조합 Nsa1 엑스레이 결정학 및 SAXS에 의해 구조 연구에 대 한 생성 되었습니다. Nsa1은 솔루션에서 품행 되었고 여러 크리스탈 형태로 결정. 이러한 결정의 최적화 하는 동안 Nsa1의 C-말단 효소 저하에 과민 했다 발견 했다. 높은 해상도, orthorhombic 크리스탈 형태로 수만 중복 될 가능성이 Nsa1의 C-터미널 잘림 변형 Nsa1의 유연한 C terminus 크리스탈 패킹?...

리보솜 큰 ribonucleoprotein 기계 모든 살아있는 세포에 있는 단백질으로 번역 하는 mRNA의 필수적인 역할을 수행 하는. 리보솜 속1,2,,34나 복잡 한 과정에서 생산 되는 2 개의 소 단위 리보솜 구성 됩니다. 진 핵 리보솜 어셈블리 필수 ribosomal 어셈블리 요소2,,35의 수백의 도움에 의존합니다. Nsa1 (Nop7 관련 1)6큰 ribosomal 소 단위 생산에는 진 핵 리보솜 어셈블리 요소 이며 WD-반복으로 알려진 74 (WDR74) 더 높은 유기 체7에 포함 된입니다. WDR74 쥐8에서 blastocyst 형성에 필요한 것을 보여줘 왔다 그리고 WDR74 발기인은 자주 암 세포9에 돌연변이. 그러나, 함수 및 리보솜 어셈블리에 Nsa1/WDR74의 정확한 메커니즘 여전히 크게 불명 하다. 진 핵 리보솜 성숙 하는 동안 Nsa1/WDR74의 역할을 밝히기 시작, 여러 구조 분석 x 선 결정학 및 작은 각 엑스레이 뿌리기 (SAXS)10를 포함 하 여 수행 했다.
엑스레이 결정학, 핵 자기 공명 (NMR) 분광학, 전자 현미경, 고 SAXS 고분자 구조 공부를 위한 모든 중요 한 기술이 있습니다. 그러나 크기, 모양, 가용성, 및 구조 생물학 메서드는 특정 고분자 최고의 될 것입니다 적합 한 고분자 영향의 안정성, 지 고는 소위 "잡종" 접근 방식을 통해 여러 기술을 결합 한 점점 더 유익한 도구11. 특히 x 선 결정학 및 SAXS 고분자12의 구조 결정에 대 한 강력 하 고 상호 보완적인 방법이 있습니다.
결정학 고해상도 원자 구조 작은 분자에서 리보솜와 같은 큰 셀룰러 기계에 이르기까지 제공 하 고 단백질 등의 생물 학적 기능을 이해에서 수많은 혁신을 주도하 고 있다 고분자13. 또한, 구조 기반 약물 설계 약물 발견과 개발14에 중요 한 차원을 추가 하는 계산 방법으로 분자 도킹을 위한 크리스탈 구조의 힘을 하네스 랑. 그것의 광범위 한 적용에도 불구 하 고 유연 하 고 무질서 시스템은 결정학 크리스탈 패킹을 방해 수 있습니다 또는 전자 밀도 지도 완료 수 있습니다 이후 또는 품질의 평가에 도전. 반대로, SAXS 솔루션 기반 및 저해상도 구조적 접근 무질서 루프와 테르미니에서 본질적으로 무질서 단백질12,,1516에 이르기까지 유연한 시스템을 설명 하 수 이다. 그것은 광범위 한 입자 크기12와 호환을 고려, SAXS 작업할 수 있습니다 synergistically 결정학 구조 연구에 의해 해결 될 수 있는 생물 학적 질문의 범위를 확장.
Nsa1는 기능, 하지만 유연한 C-말단 엑스레이 결정학 방법을 의무가 아니다 뒤 체계적인된 WD40 도메인을 포함 하기 때문에 혼합 구조 방식을 위해 적당 하다. 다음은 복제, 표현, 그리고 하이브리드 구조 결정 엑스레이 결정학에 의해에 대 한 S. cerevisiae Nsa1 및 SAXS의 정화에 대 한 프로토콜. 이 프로토콜 순서와 무질서 지역 조합 구성 하는 다른 단백질의 구조 연구에 적응 될 수 있다.

<table><tbody><tr><td>&lt;strong&gt;Molecular Cloning of Nsa1&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>pMBP2 parallel vector</td><td>Sheffield et al, Protein Expression and Purification 15, 34-39 (1999)</td><td></td><td>We used a modified version of pMBP2 which included an N-terminal His-tag (pHMBP)</td></tr><tr><td>S. cerevisiae genomic DNA</td><td>ATCC</td><td>204508D-5</td><td></td></tr><tr><td>&lt;strong&gt;Primers for cloning Nsa1&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>SC_Nsa1_FLFw</td><td>IDT</td><td></td><td>CGC CAA AGG CCT&lt;br/&gt; ATGAGGTTACTAGTCAGCTGTGT&lt;br/&gt; GGATAG</td></tr><tr><td>SC_Nsa1_FLRv</td><td>IDT</td><td></td><td>AATGCAGCGGCCGCTCAAATTTT&lt;br/&gt; GCTTTTCTTACTGGCTTTAGAAGC&lt;br/&gt; AGC</td></tr><tr><td>SC_Nsa1_DeltaCFw</td><td>IDT</td><td></td><td>GGGCGCCATGGGATCCATGAGG&lt;br/&gt; TTACTAGTCAGCTGTGTGG</td></tr><tr><td>SC_Nsa1_DeltaCRv</td><td>IDT</td><td></td><td>GATTCGAAAGCGGCCGCTTAAAC&lt;br/&gt; CTTCCTTTTTTGCTTCCC</td></tr><tr><td>&lt;strong&gt;Recombinant Protein Production and Purification of Nsa1&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Escherichia coli BL21 (DE3) Star Cells</td><td>Invitrogen</td><td>C601003</td><td></td></tr><tr><td>pMBP- NSA1 and various truncations</td><td>Lo et al., 2017</td><td></td><td></td></tr><tr><td>Selenomethionine</td><td>Molecular Dimensions</td><td>MD12-503B</td><td></td></tr><tr><td>IPTG, Dioxane-Free</td><td>Promega</td><td>V3953</td><td></td></tr><tr><td>EDTA Free Protease Inhibitor Cocktail</td><td>Sigma-Aldrich</td><td>4693159001</td><td></td></tr><tr><td>Sodium Chloride</td><td>Caledon Laboratory Chemicals</td><td>7560-1-80</td><td></td></tr><tr><td>Magnesium Chloride hexahydrate</td><td>Sigma-Aldrich</td><td>M2670</td><td></td></tr><tr><td>Tris Buffer, 1 M pH7.5</td><td>KD Medical</td><td>RGF-3340</td><td></td></tr><tr><td>Glycerol</td><td>Invitrogen</td><td>15514-029</td><td></td></tr><tr><td>beta-mercaptoethanol</td><td>Sigma</td><td>M6250</td><td></td></tr><tr><td>1M Imidazole, pH 8.0</td><td>Teknova</td><td>I6980-06</td><td></td></tr><tr><td>Talon Affinity Resin</td><td>Clonetech</td><td>635503</td><td></td></tr><tr><td>Amicon Ultra 15 mL Centrifugal Filter (MWCO 10K)</td><td>Millipore</td><td>UFC901024</td><td></td></tr><tr><td>HiLoad 16/600 Superdex 200 Prep Grade Gel Filtration Column</td><td>GE-Healthcare</td><td>28989335</td><td></td></tr><tr><td>TEV Protease</td><td>Prepared by NIEHS Protein Expression Core</td><td>Expression plasmid provided by NCI (Tropea et al. Methods Mol Biology, 2009)</td><td></td></tr><tr><td>4-15% Mini-PROTEAN TGX Precast Protein Gels</td><td>BioRad</td><td>456-8056</td><td></td></tr><tr><td>&lt;strong&gt;Crystallization, Proteolytic Screening&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Crystal Screen</td><td>Hampton Research</td><td>HR2-110</td><td></td></tr><tr><td>Crystal Screen 2</td><td>Hampton Research</td><td>HR2-112</td><td></td></tr><tr><td>Salt Rx</td><td>Hampton Research</td><td>HR2-136</td><td></td></tr><tr><td>Index Screen</td><td>Hampton Research</td><td>HR2-144</td><td></td></tr><tr><td>PEG/Ion Screen</td><td>Hampton Research</td><td>HR2-139</td><td></td></tr><tr><td>JCSG+</td><td>Molecular Dimensions</td><td>MD1-37</td><td></td></tr><tr><td>Wizard Precipitant Synergy</td><td>Molecular Dimensions</td><td>MD15-PS-T</td><td></td></tr><tr><td>Swissci 96-well 3-drop UVP sitting drop plates</td><td>TTP Labtech</td><td>4150-05823</td><td></td></tr><tr><td>3inch Wide Crystal Clear Sealing Tape</td><td>Hampton Research</td><td>HR4-506</td><td></td></tr><tr><td>Proti-Ace Kit</td><td>Hampton Research</td><td>HR2-429</td><td></td></tr><tr><td>PEG 1500</td><td>Molecular Dimensions</td><td>MD2-100-6</td><td></td></tr><tr><td>PEG 400</td><td>Molecular Dimensions</td><td>MD2-100-3</td><td></td></tr><tr><td>HEPES/sodium hydroxide pH 7.5</td><td>Molecular Dimensions</td><td>MD2-011-</td><td></td></tr><tr><td>Sodium Citrate tribasic</td><td>Molecular Dimensions</td><td>MD2-100-127</td><td></td></tr><tr><td>22 mm x 0.22 mm Siliconized Coverslides</td><td>Hampton Research</td><td>HR3-231</td><td></td></tr><tr><td>24 Well Plates with sealant (VDX Plate with Sealant)</td><td>Hampton Research</td><td>HR3-172</td><td></td></tr><tr><td>18 mM Mounted Nylon Loops (0.05 mm to 0.5 mM)</td><td>Hampton Research</td><td>HR4-945, HR4-947, HR4-970, HR4-971</td><td></td></tr><tr><td>Seed Bead Kit</td><td>Hampton Research</td><td>HR2-320</td><td></td></tr><tr><td>Magnetic Crystal Caps</td><td>Hampton Research</td><td>HR4-779</td><td></td></tr><tr><td>Magnetic Cryo Wand</td><td>Hampton Research</td><td>HR4-729</td><td></td></tr><tr><td>Cryogenic Foam Dewar</td><td>Hampton Research</td><td>HR4-673</td><td></td></tr><tr><td>Crystal Puck System</td><td>MiTeGen</td><td>M-CP-111-021</td><td></td></tr><tr><td>Full Skirt 96 well Clear Plate</td><td>VWR</td><td>10011-228</td><td></td></tr><tr><td>AxyMat Sealing Mat</td><td>VWR</td><td>10011-130</td><td></td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>UVEX-m</td><td>JAN Scientific, Inc.</td><td></td><td></td></tr><tr><td>Nanodrop Lite Spectrophotometer</td><td>Thermo-Fisher</td><td></td><td></td></tr><tr><td>Mosquito Robot</td><td>TTP Labtech</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Software/Websites&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>HKL2000</td><td>Otwinoski and Minor, 1997</td><td></td><td></td></tr><tr><td>Phenix</td><td>Adams et al., 2010</td><td></td><td></td></tr><tr><td>Coot</td><td>Emsley et al., 2010</td><td></td><td></td></tr><tr><td>ATSAS</td><td>Petoukhov et al., 2012</td><td></td><td>https://www.embl-hamburg.de/biosaxs/atsas-online/</td></tr><tr><td>Scatter</td><td>Rambo and Tainer, 2013</td><td></td><td></td></tr><tr><td>Pymol</td><td>The PyMOL Molecular Graphics System, Version 1.8 Schr&amp;ouml;dinger, LLC.</td><td></td><td></td></tr><tr><td>BUNCH</td><td>Petoukhov and Svergun, 2005</td><td></td><td></td></tr><tr><td>CRYSOL</td><td>Svergun et al, 1995</td><td></td><td></td></tr><tr><td>PRIMUS</td><td>Konarev et al, 2003</td><td></td><td></td></tr><tr><td>EOM</td><td>Tria et al, 2015</td><td></td><td></td></tr></tbody></table>

combining x-ray crystallography with small angle x-ray scattering to model unstructured regions of nsa1 from s. cerevisiae

리보솜 어셈블리 요소 Nsa1 Saccharomyces cerevisiae (S. cerevisiae) 에서 전체 길이 구조 결정은 무질서 때문에 도전 이다 고 정한 효소 단백질의 C-터미널. 이 원고는 엑스레이 결정학 및 SAXS에 의해 구조 분석에 대 한 S. cerevisiae 에서 재조합 Nsa1 정화 방법을 설명 합니다. X 선 결정학은 Nsa1의 정돈된 N 맨끝 WD40 도메인의 구조를 해결 하기 위해 활용 하 고 있다 그리고 SAXS 솔루션에서 Nsa1의 C-말단의 구조를 해결 하기 위해 사용 되었다. 솔루션 분산 데이터 솔루션에서 전체 길이 Nsa1에서 수집 되었다. 이론적인 산란 진폭 WD40 도메인의 고해상도 결정 구조에서 계산 그리고 경직 된 몸과 ab initio 모델링의 조합 Nsa1의 C-터미널. 이 하이브리드 접근 방식을 통해 전체 단백질의 제 사기 구조 개축 되었다. 여기에 제시 된 방법의 구조화 및 구조화 되지 않은 도메인의 혼합으로 구성 된 다른 단백질의 하이브리드 구조 결정에 대 한 일반적으로 적용 해야 합니다.

Nsa1 PCR S. cerevisiae genomic DNA에서 증폭 하 고 MBP와 TEV 프로 테아 제 사이트는 N 맨끝 6 x-히스티딘 선호도 태그를 포함 하는 벡터에 subcloned 이었다. Nsa1 대장균 BL21(DE3) 세포로 변형 되었다 고 단백질 식의 높은 수율 IPTG로 유도 및 25 ° C에서 하룻밤 (그림 1A) 성장을 가져온. Nsa1 고정된 코발트 선호도 수 지, TEV protease와 MBP 분열에 의해 그리고 ?...

Watch this Scientific Journal Video about Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae at JoVE.com

Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

이 방법은 엑스레이 결정학 및 소 각 x 선 산란 (SAXS), 복제, 표현, 및 구조 결심을 위한 재조합 Nsa1의 정화를 설명 하 고 다른 단백질의 하이브리드 구조 분석에 대 한 적용 둘 다를 포함 하는 주문 하 고 도메인을 난잡.

S. Cerevisiae 에서 Nsa1의 구조화 되지 않은 영역을 모델링 하는 데 작은 각 x 선 산란 된 x-선 결정학을 결합

Determination of the full-length structure of ribosome assembly factor Nsa1 from Saccharomyces cerevisiae (S. cerevisiae) is challenging because of the ...

combining-x-ray-crystallography-with-small-angle-x-ray-scattering-to

Universidad de Cartagena UDEC

Research

JoVE Journal

Biochemistry

Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

9.8K 조회수.  National Institutes of Health. 이 방법은 엑스레이 결정학 및 소 각 x 선 산란 (SAXS), 복제, 표현, 및 구조 결심을 위한 재조합 Nsa1의 정화를 설명 하 고 다른 단백질의 하이브리드 구조 분석에 대 한 적용 둘 다를 포함 하는 주문 하 고 도메인을 난잡.

비디오: Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

Online Size-exclusion and Ion-exchange Chromatography on a SAXS Beamline

Biological small angle X-ray scattering (BioSAXS) is a powerful technique in molecular and structural biology used to determine solution structure, particle size and shape, and surface-to-volume ratio of macromolecules. The technique is applicable to a very wide variety of solution conditions spanning a broad range of concentrations, pH values, ionic strengths, temperatures, additives, etc., but the sample is required to be monodisperse. This caveat led to the implementation of liquid chromatography systems on SAXS beamlines. Here, we describe the upstream integration of size-exclusion (SEC) and ion-exchange chromatography (IEC) on a beamline, different methods for optimal background subtraction, and data reduction. As an example, we describe how we use SEC- and IEC-SAXS on a fragment of the essential vaccinia virus protein D5, consisting of a D5N helicase domain. We determine its overall shape and molecular weight, showing the hexameric structure of the protein.

The determination of the solution structure of a protein by small angle X-ray scattering (SAXS) requires monodisperse samples. Here, we present two possibilities to ensure minimal delays between sample preparation and data acquisition: online size-exclusion chromatography (SEC) and online ion-exchange chromatography (IEC).

SAXS 빔라인에 온라인 크기 배제 및 이온 교환 크로마토 그래피

Biological small angle X-ray scattering (BioSAXS) is a powerful technique in molecular and structural biology used to determine solution structure, ...

연구

생화학

Combining Wet and Dry Lab Techniques to Guide the Crystallization of Large Coiled-coil Containing Proteins

Obtaining crystals for structure determination can be a difficult and time consuming proposition for any protein. Coiled-coil proteins and domains are found throughout nature, however, because of their physical properties and tendency to aggregate, they are traditionally viewed as being especially difficult to crystallize. Here, we utilize a variety of quick and simple techniques designed to identify a series of possible domain boundaries for a given coiled-coil protein, and then quickly characterize the behavior of these proteins in solution. With the addition of a strongly fluorescent tag (mRuby2), protein characterization is simple and straightforward. The target protein can be readily visualized under normal lighting and can be quantified with the use of an appropriate imager. The goal is to quickly identify candidates that can be removed from the crystallization pipeline because they are unlikely to succeed, affording more time for the best candidates and fewer funds expended on proteins that do not produce crystals. This process can be iterated to incorporate information gained from initial screening efforts, can be adapted for high-throughput expression and purification procedures, and is augmented by robotic screening for crystallization.

We describe a framework incorporating straightforward biochemical and computational analysis to guide the characterization and crystallization of large coiled-coil domains. This framework can be adapted for globular proteins or extended to incorporate a variety of high-throughput techniques.

습식 및 건식 연구소의 기술을 결합하면 대형 코일 코일 포함하는 단백질의 결정화를 안내합니다

Obtaining crystals for structure determination can be a difficult and time consuming proposition for any protein. Coiled-coil proteins and domains are ...

Atomic Scale Structural Studies of Macromolecular Assemblies by Solid-state Nuclear Magnetic Resonance Spectroscopy

Supramolecular protein assemblies play fundamental roles in biological processes ranging from host-pathogen interaction, viral infection to the propagation of neurodegenerative disorders. Such assemblies consist in multiple protein subunits organized in a non-covalent way to form large macromolecular objects that can execute a variety of cellular functions or cause detrimental consequences. Atomic insights into the assembly mechanisms and the functioning of those macromolecular assemblies remain often scarce since their inherent insolubility and non-crystallinity often drastically reduces the quality of the data obtained from most techniques used in structural biology, such as X-ray crystallography and solution Nuclear Magnetic Resonance (NMR). We here present magic-angle spinning solid-state NMR spectroscopy (SSNMR) as a powerful method to investigate structures of macromolecular assemblies at atomic resolution. SSNMR can reveal atomic details on the assembled complex without size and solubility limitations. The protocol presented here describes the essential steps from the production of 13C/15N isotope-labeled macromolecular protein assemblies to the acquisition of standard SSNMR spectra and their analysis and interpretation. As an example, we show the pipeline of a SSNMR structural analysis of a filamentous protein assembly.

Structures of supramolecular protein assemblies at atomic resolution are of high relevance because of their crucial roles in a variety of biological phenomena. Herein, we present a protocol to perform high-resolution structural studies on insoluble and non-crystalline macromolecular protein assemblies by magic-angle spinning solid-state nuclear magnetic resonance spectroscopy (MAS SSNMR).

Supramolecular protein assemblies play fundamental roles in biological processes ranging from host-pathogen interaction, viral infection to the ...

Microcrystallography of Protein Crystals and In Cellulo Diffraction

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in their largest dimension, which used to represent a challenge. We present two alternative workflows for the structure determination of protein microcrystals by X-ray crystallography with a particular focus on crystals grown in vivo. The microcrystals are either extracted from cells by sonication and purified by differential centrifugation, or analyzed in cellulo after cell sorting by flow cytometry of crystal-containing cells. Optionally, purified crystals or crystal-containing cells are soaked in heavy atom solutions for experimental phasing. These samples are then prepared for diffraction experiments in a similar way by application onto a micromesh support and flash cooling in liquid nitrogen. We briefly describe and compare serial diffraction experiments of isolated microcrystals and crystal-containing cells using a microfocus synchrotron beamline to produce datasets suitable for phasing, model building and refinement.
These workflows are exemplified with crystals of the Bombyx mori cypovirus 1 (BmCPV1) polyhedrin produced by infection of insect cells with a recombinant baculovirus. In this case study, in cellulo analysis is more efficient than analysis of purified crystals and yields a structure in ~8 days from expression to refinement.

Microcrystallography of Protein Crystals and In Cellulo Diffraction

A protocol is presented for X-ray crystallography using protein microcrystals. Two examples analyzing in vivo-grown microcrystals after purification or in cellulo are compared.

단백질 결정의 미세 결정학 및<em&gt; 셀룰로에서</em&gt; 회절

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in ...

Biochemical and Structural Characterization of the Carbohydrate Transport Substrate-binding-protein SP0092

Development of new antimicrobials and vaccines for Streptococcus pneumoniae (pneumococcus) are necessary to halt the rapid rise in multiple resistant strains. Carbohydrate substrate binding proteins (SBPs) represent viable targets for the development of protein-based vaccines and new antimicrobials because of their extracellular localization and the centrality of carbohydrate import for pneumococcal metabolism, respectively. Described here is a rationalized integrated protocol to carry out a comprehensive characterization of SP0092, which can be extended to other carbohydrate SBPs from the pneumococcus and other bacteria. This procedure can aid the structure-based design of inhibitors for this class of proteins. Presented in the first part of this manuscript are protocols for biochemical analysis by thermal shift assay, multi angle light scattering (MALS), and size exclusion chromatography (SEC), which optimize the stability and homogeneity of the sample directed to crystallization trials and so enhance the probability of success. The second part of this procedure describes the characterization of the SBP crystals using a tunable wavelength anomalous diffraction synchrotron beamline, and data collection protocols for measuring data that can be used to resolve the crystallized protein structure.

A streamlined protocol for performing an extensive biochemical and structural characterization of a carbohydrate substrate binding protein from Streptococcus pneumoniae is presented.

탄수화물 전송 기질 바인딩 단백질 SP0092의 생 화 학적 및 구조적 특성

Development of new antimicrobials and vaccines for Streptococcus pneumoniae (pneumococcus) are necessary to halt the rapid rise in multiple resistant ...

Small and Wide Angle X-Ray Scattering Studies of Biological Macromolecules in Solution

In this paper, Small and Wide Angle X-ray Scattering (SWAXS) analysis of macromolecules is demonstrated through experimentation. SWAXS is a technique where X-rays are elastically scattered by an inhomogeneous sample in the nm-range at small angles (typically 0.1 - 5&deg;) and wide angles (typically &gt; 5&deg;). This technique provides information about the shape, size, and distribution of macromolecules, characteristic distances of partially ordered materials, pore sizes, and surface-to-volume ratio. Small Angle X-ray Scattering (SAXS) is capable of delivering structural information of macromolecules between 1 and 200 nm, whereas Wide Angle X-ray Scattering (WAXS) can resolve even smaller Bragg spacing of samples between 0.33 nm and 0.49 nm based on the specific system setup and detector. The spacing is determined from Bragg's law and is dependent on the wavelength and incident angle.
In a SWAXS experiment, the materials can be solid or liquid and may contain solid, liquid or gaseous domains (so-called particles) of the same or another material in any combination. SWAXS applications are very broad and include colloids of all types: metals, composites, cement, oil, polymers, plastics, proteins, foods, and pharmaceuticals. For solid samples, the thickness is limited to approximately 5 mm.
Usage of a lab-based SWAXS instrument is detailed in this paper. With the available software (e.g., GNOM-ATSAS 2.3 package by D. Svergun EMBL-Hamburg and EasySWAXS software) for the SWAXS system, an experiment can be conducted to determine certain parameters of interest for the given sample. One example of a biological macromolecule experiment is the analysis of 2 wt% lysozyme in a water-based aqueous buffer which can be chosen and prepared through numerous methods. The preparation of the sample follows the guidelines below in the Preparation of the Sample section. Through SWAXS experimentation, important structural parameters of lysozyme, e.g. the radius of gyration, can be analyzed.

The demonstration of the small and wide angle X-ray scattering (SWAXS) procedure has become instrumental in the study of biological macromolecules. Through the use of the instrumentation and procedures of specific angle methods and preparation, the experimental data from the SWAXS displays the atomic and nano-scale characterization of macromolecules.

솔루션의 생물 고분자의 작은 및 와이드 앵글 X-레이 산란 연구

In this paper, Small and Wide Angle X-ray Scattering (SWAXS) analysis of macromolecules is demonstrated through experimentation. SWAXS is a technique ...

생체공학

Contrast-Matching Detergent in Small-Angle Neutron Scattering Experiments for Membrane Protein Structural Analysis and Ab Initio Modeling

The biological small-angle neutron scattering instrument at the High-Flux Isotope Reactor of Oak Ridge National Laboratory is dedicated to the investigation of biological materials, biofuel processing, and bio-inspired materials covering nanometer to micrometer length scales. The methods presented here for investigating physical properties (i.e., size and shape) of membrane proteins (here, MmIAP, an intramembrane aspartyl protease from Methanoculleus marisnigri) in solutions of micelle-forming detergents are well-suited for this small-angle neutron scattering instrument, among others. Other biophysical characterization techniques are hindered by their inability to address the detergent contributions in a protein-detergent complex structure. Additionally, access to the Bio-Deuteration Lab provides unique capabilities for preparing large-scale cultivations and expressing deuterium-labeled proteins for enhanced scattering signal from the protein. While this technique does not provide structural details at high-resolution, the structural knowledge gap for membrane proteins contains many addressable areas of research without requiring near-atomic resolution. For example, these areas include determination of oligomeric states, complex formation, conformational changes during perturbation, and folding/unfolding events. These investigations can be readily accomplished through applications of this method.

Contrast-Matching Detergent in Small-Angle Neutron Scattering Experiments for Membrane Protein Structural Analysis and Ab Initio Modeling

This protocol demonstrates how to obtain a low-resolution ab initio model and structural details of a detergent-solubilized membrane protein in solution using small-angle neutron scattering with contrast-matching of the detergent.

막 단백질 구조 분석 및 Ab 론 적 모델링 작은 각 중성자 산란 실험에서 일치 하는 대비 세제

The biological small-angle neutron scattering instrument at the High-Flux Isotope Reactor of Oak Ridge National Laboratory is dedicated to the ...

Structural Studies of Macromolecules in Solution using Small Angle X-Ray Scattering

Protein-protein interactions involving proteins with multiple globular domains present technical challenges for determining how such complexes form and how the domains are oriented/positioned. Here, a protocol with the potential for elucidating which specific domains mediate interactions in multicomponent system through ab initio modeling is described. A method for calculating solution structures of macromolecules and their assemblies is provided that involves integrating data from small angle X-ray scattering (SAXS), chromatography, and atomic resolution structures together in a hybrid approach. A specific example is that of the complex of full-length nidogen-1, which assembles extracellular matrix proteins and forms an extended, curved nanostructure. One of its globular domains attaches to laminin &#947;-1, which structures the basement membrane. This provides a basis for determining accurate structures of flexible multidomain protein complexes and is enabled by synchrotron sources coupled with automation robotics and size exclusion chromatography systems. This combination allows rapid analysis in which multiple oligomeric states are separated just prior to SAXS data collection. The analysis yields information on the radius of gyration, particle dimension, molecular shape and interdomain pairing. The protocol for generating 3D models of complexes by fitting high-resolution structures of the component proteins is also given.

Here, we present how Small Angle X-Ray Scattering (SAXS) can be utilized to obtain information on low-resolution envelopes representing the macromolecular structures. When used in conjunction with high-resolution structural techniques such as X-Ray Crystallography and Nuclear Magnetic Resonance, SAXS can provide detailed insights into multidomain proteins and macromolecular complexes in-solution.

작은 각 엑스레이 뿌리기를 사용 하 여 솔루션에서 고분자의 구조 연구

Protein-protein interactions involving proteins with multiple globular domains present technical challenges for determining how such complexes form and ...

Structure Solution of the Fluorescent Protein Cerulean Using MeshAndCollect

X-ray crystallography is the major technique used to obtain high resolution information concerning the 3-dimensional structures of biological macromolecules. Until recently, a major requirement has been the availability of relatively large, well diffracting crystals, which are often challenging to obtain. However, the advent of serial crystallography and a renaissance in multi-crystal data collection methods has meant that the availability of large crystals need no longer be a limiting factor. Here, we illustrate the use of the automated MeshAndCollect protocol, which first identifies the positions of many small crystals mounted on the same sample holder and then directs the collection from the crystals of a series of partial diffraction data sets for subsequent merging and use in structure determination. MeshAndCollect can be applied to any type of micro-crystals, even if weakly diffracting. As an example, we present here the use of the technique to solve the crystal structure of the Cyan Fluorescent Protein (CFP) Cerulean.

We present the use of the MeshAndCollect protocol to obtain a complete diffraction data set, for use in subsequent structure determination, composed of partial diffraction data sets collected from many small crystals of the fluorescent protein Cerulean.

MeshAndCollect를 사용 하 여 형광 단백질 리안의 구조 솔루션

X-ray crystallography is the major technique used to obtain high resolution information concerning the 3-dimensional structures of biological ...

Analysis of SEC-SAXS data via EFA deconvolution and Scatter

BioSAXS is a popular technique used in molecular and structural biology to determine the solution structure, particle size and shape, surface-to-volume ratio and conformational changes of macromolecules and macromolecular complexes. A high quality SAXS dataset for structural modeling must be from monodisperse, homogeneous samples and this is often only reached by a combination of inline chromatography and immediate SAXS measurement. Most commonly, size-exclusion chromatography is used to separate samples and exclude contaminants and aggregations from the particle of interest allowing SAXS measurements to be made from a well-resolved chromatographic peak of a single protein species. Still, in some cases, even inline purification is not a guarantee of monodisperse samples, either because multiple components are too close to each other in size or changes in shape induced through binding alter perceived elution time. In these cases, it may be possible to deconvolute the SAXS data of a mixture to obtain the idealized SAXS curves of individual components. Here, we show how this is achieved and the practical analysis of SEC-SAXS data is performed on ideal and difficult samples. Specifically, we show the SEC-SAXS analysis of the vaccinia E9 DNA polymerase exonuclease minus mutant.

SEC-BioSAXS measurements of biological macromolecules are a standard approach for determining solution structure of macromolecules and their complexes. Here, we analyze SEC-BioSAXS data from two types of commonly encountered SEC traces&#8212;chromatograms with fully resolved and partially resolved peaks. We demonstrate the analysis and deconvolution using scatter and BioXTAS RAW.

EFA 감소 및 분산을 통한 SEC-SAXS 데이터 분석

BioSAXS is a popular technique used in molecular and structural biology to determine the solution structure, particle size and shape, surface-to-volume ...