이 작품은 이스라엘 과학 재단 부여 514415 (대표)와 BSF NSF (MCB) 그랜트 2016707 (대표)에 의해 지원 되었다. 지 그 프 리드와 Irma Ullman 교수의 자 (제) 또한 인정에서 지원 합니다.

1. 조사 설계
참고:이 프로토콜 이미 fluorophores 태그로 상용 oligonucleotide 프로브를 사용 합니다. 프로브는 특정 시퀀스를 대상으로 보완 집합의 구성 mRNA, 단 하나 형광 성 분자를 활용 되 고 각 프로브. 또는,5,16설명 되어 있는 대로 프로브를 형광 마커를 연결 가능 하다.
<ol>
	<li>디자인 smFISH 프로브 Arjun Raj (밴 Oudenaarden 연구소, 매사 추세 츠 공대);에 의해 개발 된 프로브 디자이너16 알고리즘을 사용 하 시퀀스 smFISH 프로브이 원고에 사용 되는 재료의 테이블에 나열 됩니다. 참고: 최소 감지 신호에 대 한 집합에 프로브 수 ~ 30입니다. 정확한 숫자는 매우 짧은 성적 측정 하는 경우에 특히 관심의 유전자에 따라 달라질 수 있습니다.</li>
	<li>광 설치에 맞는 염료를 선택 (재료의 표 참조). 참고: Cy3 염료 또는 사진 표백 낮은 민감도와 광학 동일한 염료가 좋습니다. 듀얼 라벨에 대 한 후보는 Cy5 또는 광학 동일한 염료 (재료의 표 참조). 레이블이 지정 된 mRNA의 폭풍 이미징에 대 한 적합 한 염료 형광 방출의 여러 사이클에 대 한 그들의 능력에 의해 특징. 일부 smFISH 염료를 사용할 수 있는 스톰 이미징 (재료의 표 참조). 두 가지 (또는 그 이상) 성적표 같은 셀에 서로 다른 유전자에 해당 이미지를 하나 그 스펙트럼이 거의 없거나 전혀 없는 중복 염료를 활용 하는 oligonucleotide 프로브를 선택 해야 합니다.</li>
</ol>
2. 시 약 준비
참고: 필터링 된 피 펫 팁 등 튜브, RNase 무료 소모품을 사용 하 여 샘플 RNAse 무료를 유지 하 고 모든 작업 환경을 깨끗 하 게 유지 하는 것이 중요입니다. 대상 성적 저하를 방지 하려면 셀 고정 다음 사용 하는 모든 시 약 nuclease 무료 되어야 합니다 (재료의 표 참조) 또는 diethylpyrocarbonate (DEPC)-치료 및 살 균.
<ol>
	<li>SmFISH에 대 한 버퍼
	<ol>
		<li>1 x PBS RNase 무료 (버퍼링 인산 염, 인산 염 버퍼 농도 0.01 M의와 염화 나트륨 농도 0.154 m, (pH 7.4) 솔루션)을 준비 합니다. 10 x PBS RNase 무료 희석 (재료의 표 참조) nuclease 무료 물 (재료의 표 참조)에 1시 10분 v/v 비율.<ol>
			<li>DEPC 처리 1을 준비 또는 PBS x.</li>
		</ol>
		</li>
		<li>RNase 무료 준비 2 x SSC (염 분 나트륨 구 연산 염 버퍼, 0.03 M 나트륨 시트르산, (pH 7.0)에 0.3 M NaCl). RNase 무료 희석 20 x SSC (재료의 표 참조) nuclease 무료 물 1:10 v/v 비율.<ol>
			<li>DEPC 처리 2를 준비 하는 또는 x SSC.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Oligonucleotide 조사 재고 솔루션입니다.
	<ol>
		<li>다시 25 µ M. 프로브 재고를 만들려고 테 버퍼 (10 mM Tris HCl, 1 mM EDTA, pH 8.0)의 200 µ L에 말린된 oligonucleotide 조사 조화 분해를 위아래로 pipetting 다음 소용돌이 그리고 짧게 원심 분리기에 의해 잘 믹스.</li>
		<li>동결 및 재고 솔루션 튜브의 해빙을 방지 하려면 단일 실험 실행에 사용 될 것으로 예상 하는 금액을 해당 재고 솔루션의 여러 aliquots를 확인 합니다. -20 ° C에 또는 아래 재고 솔루션을 저장 하 고 빛 으로부터 보호. 참고: 5 nmol의 프로브 세트 최대 250 교 잡 반응을 제공할 수 있습니다.</li>
	</ol>
	</li>
	<li>교 잡 버퍼 (다음 스키 너 외. 7 ):
	<ol>
		<li>50ml 폴 리 프로필 렌 원뿔 하단 튜브를 nuclease 무료 물 5 mL를 추가 합니다. 물 1 g dextran 황산의 추가 하 고 활발 한 vortexing에 의해 해산. 거품 (~ 30 분) 사라질 때까지 궤도 셰이 커에 내용을 혼합.</li>
		<li>20x SSC의 1 mL, 200mm vanadyl ribonucleoside 복합물의 100 µ L, 50 mg/mL BSA의 40 µ L 이온된 formamide, 대장균 tRNA의 10 mg의 솔루션 3,530 µ L를 추가 합니다. 최종 볼륨을 가져올 10 mL DEPC 처리 물 또는 nuclease 무료 물, 그리고 소용돌이의 추가 의해 솔루션 동 질 때까지. 참고: 동결과 솔루션의 해빙을 방지 하려면 단일 실험 실행에 사용 될 것으로 예상 하는 금액을 해당 재고 솔루션의 여러 aliquots 확인 합니다. -20 ° c.에 재고 솔루션 저장 병을 열기 전에 formamide 실내 온도에 온난 하 게 해야 합니다. 백그라운드를 줄이기 위해, 그것은 최적의 formamide 농도 (10-40 %v / v 비율)을 보정 하기 위해 좋습니다. 
		주의: 경고! Formamide은 매우 독성이 고 알려진된 기형 발생 물질. 눈 또는 피부, 흡입 또는 섭취와 접촉을 하지 마십시오. 연기 후드 랩 코트와 보호 장갑을 착용 하는 동안 처리 합니다.</li>
		<li>0.22 μ m 필터를 통해 그것을 전달 하 여 솔루션을 소독. Aliquots에서 유지 하 고 1 년에-20 ° C에서 저장.</li>
	</ol>
	</li>
	<li>1 x PBS를 37% 포름알데히드 (v/v)을 추가 하 여 고정 버퍼 (1 x PBS에 4.6% 포름알데히드) 준비 (2.1.1 참조)는 1:8 비율 v/v와 소용돌이에. 주의: 경고! 포름알데히드는 매우 독성이 고 알려진된 발암 물질. 연기 후드 랩 코트와 보호 장갑을 착용 하는 동안 처리 합니다.</li>
	<li>SmFISH 워시 버퍼 준비 (2에서 20% formamide x SSC) 2 하 이온된 formamide를 추가 하 여 x SSC (2.1.2 참조) 1:4 비율 v/v 및 소용돌이.</li>
	<li>5mm 시스테 및 산소 청소부 (7 µ M 포도 당 산화 효소, 56 nM catalase 및 10% 포도 당 (w/v)) 워시 버퍼를 추가 하 여 이미지 버퍼 smFISH에 대 한 준비 (2에서 20% formamide x SSC)</li>
	<li>폭풍에 대 한 버퍼
	<ol>
		<li>50 mM Tris HCl과 10 mM NaCl nuclease 무료 물에 추가 하 여 버퍼 A를 준비 합니다. 참고: 저장소 년 RT에서.</li>
		<li>Nuclease 무료 물 포도 당 50 mM Tris HCl, 10 mM NaCl, 그리고 10 %w / v를 추가 하 여 버퍼 B을 준비 합니다. 참고: 저장소 최대 1 년에 4 ° C에서.</li>
		<li>77 mg 시스테 버퍼 A (은 1 M 솔루션)의 1 mL에 용 해 하 여 MEA 버퍼를 준비 합니다. 참고: 그것은 저장할 수 있습니다 4 ° C에서 1 개월.</li>
		<li>Gloxy 버퍼 8,440 AU (임의의 단위) 포도 당 산화 효소를 추가 하 여 준비 하 고 1 ml 70,200 AU catalase 버퍼 a. 참고: 재고 솔루션 x 50은 1 개월 4 ° C에서 저장 될 수 있다.</li>
		<li>50mm MEA 버퍼와 버퍼를 버퍼 B에 Gloxy x 1을 추가 하 여 이미지 버퍼 폭풍우를 위한 준비 참고: 폭풍에 대 한 이미징 버퍼 5mm 시스테, 10 mm NaCl, 50 mm Tris 산소 청소부 (7 µ M 포도 당 산화 효소와 56 nM catalase) 및 10% 포도 당 pH 8.0에서 구성 됩니다. 바로 영상 전에 준비, 저장 고 약 2 시간에 대 한 RT에 사용 될 수 있습니다.</li>
	</ol>
	</li>
</ol>
3. 샘플 고정
<ol>
	<li>세균성 세포 (예를들면, E. 성장</li></ol>대장균 MG1655) 선택 (예를 들어, 파운드 매체) 하룻밤 inan 궤도 흔드는 260 rpm 및 37 ° c.의 성장 매체에 참고: 확인 하려면 조사의 일반적인 바인딩 인해 배경에 있는 관심사의 유전자 삭제 된 스트레인 측정 실시 해야, (Δgalk 에 그림 1 과 ΔsodB 에서 참조 하는 동일한 절차에 따라 그림 2)입니다.
	<li>신선한 매체에 하룻밤 문화 1: 100 희석 하 고 그것의 광학 밀도 (OD600) 분 광 광도 계는 0.2-까지 모든 ~ 1 h에서 측정 0.4; 4 mL 문화 충분 해야 한다입니다. 참고: 선택한 현미경 단계 대조 또는 차동 간섭 콘트라스트 기능 없는 경우 대장균 외부 막 수 표시 2 μ M 닥터지 형광 표시와 함께 (재료의 표 참조)에 추가 해야 하는 세균 현 탁 액 고정17전에 20 분. 고정 및 추가 치료는 아래 설명 된 대로 수행 됩니다. 형광 마커 표시 프로브 세트와 스펙트럼 중복을 최소화 하기 위해 다른 방출 스펙트럼을 데 주의 해야 합니다.</li>
	<li>4 ° c.에 4, 500 g에 5 분 동안 원심 분리 하 여 펠 릿 셀 모든 튜브에서에서 상쾌한을 제거 합니다.</li>
	<li>각 관 1 x PBS의 1 mL을 추가 하 고 셀 셀 집계를 최소화 하기 위해 펠 렛 resuspend. 부드럽게 고정 버퍼와 소용돌이의 4 mL를 추가 합니다.</li>
	<li>24 ° c.에 30 분 동안 260 rpm에서 궤도 통에 샘플을 품 어</li>
	<li>10 분, 1000 g, 4 ° c.에 대 한 원심 분리 하 여 펠 릿 셀 상쾌한을 제거 합니다. 1 mL 1 x PBS를 추가 합니다.</li>
	<li>1.8 µ L 원뿔 아래쪽 마이크로 원심 관 (재료의 표 참조)에 정지를 전송 하 고 단계 3.6를 두 번 반복 합니다.</li>

4. 샘플 Permeabilization
<ol>
	<li>매우 신중 하 게 상쾌한을 제거 합니다. 작은 볼륨 펫을 사용 하 여 펠 릿 밖에 서 모든 액체를 제거 하는 데 필요한 경우.</li>
	<li>300 µ L DEPC 처리 물 또는 nuclease 무료 물 resuspend. 350 µ L 고급 절대 에탄올 (99%)를 추가 하 고 부드럽게 튜브를 거꾸로 하 여 혼합. 에탄올과 혼합 다시, 70% (v/v 비율)의 최종 에탄올 농도 도달의 또 다른 350 µ L를 추가 합니다. 주의: 경고! 에탄올은 가연성 이다.</li>
	<li>(RT), 실 온에서 1 h 20 rpm에서 튜브 회전자와 함께 샘플을 회전 또는 4 ° C에서 하룻밤. 샘플 4 ° C에서 1 주일에 저장할 수 있습니다.</li>
</ol>
5입니다. 교 잡
<ol>
	<li>7 분, 750 x g, 4 ° c.에 대 한 원심 분리 하 여 펠 릿 셀 상쾌한을 제거 합니다.</li>
	<li>1 mL 20% 샘플에 버퍼를 세척 하 고 두고 서 몇 분, 또는 펠 릿을 완전히 해산 피 펫에 대 한 추가 합니다.</li>
	<li>750 x g, 4 ° c.에 7 분 동안 원심 분리 하 여 펠 릿 셀</li>
	<li>매우 부드럽게 pipetting 여는 상쾌한을 제거 합니다. 작은 볼륨 펫을 사용 하 여 펠 릿 밖에 서 모든 액체를 제거 하는 데 필요한 경우.</li>
	<li>Oligonucleotide 조사 최종 oligonucleotide 농도 250 교 잡 버퍼 약 수를 재고 솔루션 설정 추가 nM; 소용돌이 적극적으로. 참고: 하나의 동일한 셀에 한 번에 두 개 이상의 다른 대상 mRNAs 레이블을 수 있습니다. 교 잡 버퍼를 두 대상의 프로브 세트를 추가 합니다. 염료 (예를 들어, Cy3와 Cy5) 스펙트럼 오버랩을 최소화 하기 위해 다른 방출 스펙트럼을가지고 선택할 수 주의 해야 합니다. 폭풍 이미징을 위한 샘플 스톰 (예를 들면, 자료의 테이블에서)에 대 한 적합 한 염료와 활용을 설정 하는 oligonucleotide 프로브 때 교배는 다는 것을 확인 하십시오.</li>
	<li>거품 (솔루션은 아주 점성)의 생성을 피하는 동안 oligonucleotide 조사를 포함 하는 50 µ L 교 잡 버퍼에 샘플 (단계 5.4 참조)를 일시 중단 합니다.</li>
	<li>어둠 속에서 30 ° C에서 뜨거운 블록에 샘플을 하룻밤 둡니다. 참고:이 다음 샘플 저장 될 수 있습니다 4 ° c.에서 최대 6 개월까지</li>
</ol>
6입니다. 세척
<ol>
	<li>1 새로운 microcentrifuge 튜브를 사용 하 여 이미지에 각 샘플에 대 한. 1 mL 워시 버퍼를 추가 합니다.</li>
	<li>워시 버퍼와 혼합/소용돌이 포함 하는 새 튜브를 교배 시킨된 견본에서 10-15 µ L를 추가 합니다.</li>
	<li>7 분 동안 원심 분리, 4 ° c.에 750 x g 펠 릿 셀 상쾌한을 제거 합니다. 참고: 배경을 줄이기 위해, 품 어 1 h 30 ° c.에 대 한</li>
	<li>두 번 더 세척 (1 mL 워시 버퍼에서 resuspend, 원심 및 펠 릿을 제거).</li>
	<li>25 µ L 워시 버퍼에 resuspend. 참고: 사진 표백 한 줄이기 위해 추가할 수 워시 버퍼에 단일 분자 형광 실험6염료 안정성 향상을 위해 시스템 (2.6) 청소는 산소.</li>
</ol>
7입니다. 영상에 대 한 샘플의 준비
참고: 셀 형광 및 위상 대비 현미경 적절 한 이미징 할 수 있도록 움직일 필요가 있다. 다음 방법 다른 초점 비행기에서 보기의 다른 분야 수 군데 샘플 준비를 사용할 수 있습니다.
<ol>
	<li>Agarose 젤 준비
	<ol>
		<li>10 mL 2 x SSC 버퍼에 150mg agarose를 추가 합니다. 2를 추가 하지 마십시오 x SSC agarose, 아니면 그것을 제대로 분해 되지 것입니다.</li>
		<li>10-15 s 큰 거품 형태로 시작 될 때까지 각 시간에 대 한 전자 렌지. 몇 분 동안 냉각을 정해.</li>
		<li>슬라이드의 센터 노출 되도록 슬라이드에 분리 실리콘 프레임을 놓습니다.</li>
		<li>슬라이드의 중심에서 10 m m 와이드 (1-2 m m 두께) 엄밀한 반지를 놓고 씰링에, 젤의 작은 금액을 입금 합니다. 강화에 그것에 대 일 분 정도 기다립니다.</li>
		<li>높은 돔 모양 형성 될 때까지 더 많은 젤을 추가 합니다. 강화 하 고, 그것을 위해 10 분을 기다려 하 고 (를 사용 하 여 정밀한 핀셋 또는 다른 방법) 반지를 제거.</li>
		<li>젤에 #0 coverslip 슬라이드 인감 (6.5 참조) 씻어 세균 세포의 ~ 10 μ를 입금.</li>
	</ol>
	</li>
	<li>SmFISH에 대 한 챔버 샘플 준비
	<ol>
		<li>또는 (단계로 7.1) immobilizing 씻어 세균 세포 (6.5 참조) 폴 리 D-라이 신-코팅 유리 하단 일회용 플라스틱 접시에 의해 이미징에 대 한 샘플을 준비.</li>
		<li>어둠 속에서, 실내 온도에, 하룻밤 시각화 표면에 세포의 접착을 허용 하기 전에 샘플을 품 어. 시각화 하기 전에 세척 한 번 워시 버퍼 (. 5); 예제 smFISH (2.6)에 대 한 세척 buffer(2.5) 또는 이미징 버퍼와 젖은 유지.</li>
	</ol>
	</li>
	<li>폭풍에 대 한 챔버 샘플 준비
	<ol>
		<li>폴 리 D-라이 신-코팅 유리 하단 일회용 플라스틱 접시에 이미징에 대 한 폭풍에 대 한 샘플을 준비 합니다.</li>
		<li>하룻밤에 RT, 어둠 속에서 샘플을 품 어. 워시 버퍼 smFISH (2.5);에 대 한 시각화 세척 한 번 하기 전에 고 스톰 (2.7.5)에 대 한 이미징 버퍼를 추가 합니다.</li>
	</ol>
	</li>
</ol>
8입니다.대 본 시각화
<ol>
	<li>전동된 스테이지를 갖춘 넓은 필드 형광 현미경으로 세포를 이미지 (자료의 표 참조). 참고: 폭풍 수정에 대 한 염료 형광 방출의 여러 사이클의 가능으로 표시 하는 셀을 사용 합니다. 3D 슈퍼 해상도 이미징 시스템을 사용 하 여 샘플 이미지 (예를 들어, 재료의 표 참조).</li>
	<li>사용 (권장)를 한다 x 60-100 &#62; 1.3 기름 침수 단계 대비 목표 렌즈는 강한 광원, 수은 또는 금속 할로겐 램프; 광원 LED 기반은 또한 것이 좋습니다.</li>
	<li>사용 표준 냉각 CCD 카메라, 이상적으로 낮은 조명 수평 영상 보다는 속도 (우리 16 µ m 픽셀 크기와 카메라를 사용)에 대 한 최적화 (재료의 표 참조). 참고: 사용 냉각된 EMCCD (전자 멀티 충전 결합 장치)의 카메라 CCD 카메라는 특히 단일 분자의 검출을 방지 하는 열 잡음을 줄이기 위해 필요 하다.</li>
	<li>사용 필터 설정 선택한 fluorophores에 적합 합니다.</li>
	<li>셀 경계를 제대로 확인 하려면 각 샘플 단계 대조 광학, 또는 라벨 붙일 외부 세포 막에서에서 보기의 다른 분야의 이미지를 취득 합니다. 모든 채널에 대 한 서로 다른 초점 평면 (z-스택)에서 이미지 (보통 13 조각 구분 기준: 250 nm 촬영). 참고: 필터 집합 및 현미경의 전동된 스테이지 상업에 의해 제어 해야한다 (재료의 표 참조) 또는 사내 소프트웨어를 순서 대로 스택 이미지를 캡처할 수 있습니다.</li>
</ol>
9. 데이터 분석
<ol>
	<li>이미지 스택 데이터 분석에 대 한 적합 한 형식으로 변환 합니다.</li>
	<li>대상의 복사본 수를 추정 mRNA 아닌 셀에 형광 foci의 총 강도에서 다른 현재 사용할 수 있는 프로토콜에서 이산 '관광 명소' 세.</li>
	<li>오픈 소스 소프트웨어18 또는 사용자 프로그램 이미지 분석을 실시 합니다. 자세한 내용은 데이터의 이미징 및 분석 참조 스키 너 외. 7</li>
</ol>

<ol>
	<li>Tsimring, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Noise+in+biology.">Noise in biology.</a> Reports Prog. Phys. 77 (2), 26601 (2014).</li><li>Arbel-Goren, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcript+degradation+and+noise+of+small+RNA-controlled+genes+in+a+switch+activated+network+in+Escherichia+coli.">Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli.</a> Nucleic Acids Res. 44 (14), 6707-6720 (2016).</li><li>Arbel-Goren, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+post-transcriptional+regulation+on+phenotypic+noise+in+Escherichia+coli.">Effects of post-transcriptional regulation on phenotypic noise in Escherichia coli.</a> Nucleic Acids Res. 41 (9), 4825-4834 (2013).</li><li>van Gijtenbeek, L. A., Robinson, A., van Oijen, A. M., Poolman, B., Kok, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+Spatial+Organization+of+mRNA,+Plasmids,+and+Ribosomes+in+a+Bacterial+Host+Overexpressing+Membrane+Proteins.">On the Spatial Organization of mRNA, Plasmids, and Ribosomes in a Bacterial Host Overexpressing Membrane Proteins.</a> PLOS Genet. 12 (12), e1006523 (2016).</li><li>Raj, A., vanden Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+individual+mRNA+molecules+using+multiple+singly+labeled+probes.">Imaging individual mRNA molecules using multiple singly labeled probes.</a> Nat. Methods. 5 (10), 877-879 (2008).</li><li>Raj, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+individual+endogenous+RNA+transcripts+in+situ+using+multiple+singly+labeled+probes.">Detection of individual endogenous RNA transcripts in situ using multiple singly labeled probes.</a> Methods Enzymol. 472 (10), (2010).</li><li>Skinner, S. O., La Sep&#250;lveda, ., Xu, H., Golding, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+mRNA+copy+number+in+individual+Escherichia+coli+cells+using+single-molecule+fluorescent+in+situ+hybridization.">Measuring mRNA copy number in individual Escherichia coli cells using single-molecule fluorescent in situ hybridization.</a> Nat. Protoc. 8 (6), 1100-1113 (2013).</li><li>Barakat, T. S., Gribnau, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combined+DNA-RNA+fluorescent+in+situ+hybridization+(FISH)+to+study+X+chromosome+inactivation+in+differentiated+female+mouse+embryonic+stem+cells.">Combined DNA-RNA fluorescent in situ hybridization (FISH) to study X chromosome inactivation in differentiated female mouse embryonic stem cells.</a> J. Vis. Exp. (88), e51628 (2014).</li><li>Chen, K. H., Boettiger, A. N., Moffitt, J. R., Wang, S., Zhuang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+imaging.+Spatially+resolved,+highly+multiplexed+RNA+profiling+in+single+cells.">RNA imaging. Spatially resolved, highly multiplexed RNA profiling in single cells.</a> Science. 348 (6233), aaa6090 (2015).</li><li>van Gijtenbeek, L. A., Kok, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Illuminating+messengers:+An+update+and+outlook+on+RNA+visualization+in+bacteria.">Illuminating messengers: An update and outlook on RNA visualization in bacteria.</a> Front. Microbiol. 8, 1-19 (2017).</li><li>Fei, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+in+vivo+target+search+kinetics+of+regulatory+noncoding+RNA.">Determination of in vivo target search kinetics of regulatory noncoding RNA.</a> Science. 347 (6228), 1371-1374 (2015).</li><li>Moffitt, J. R., Pandey, S., Boettiger, A. N., Wang, S., Zhuang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+organization+shapes+the+turnover+of+a+bacterial+transcriptome.">Spatial organization shapes the turnover of a bacterial transcriptome.</a> Elife. 5, 1-22 (2016).</li><li>Ong, W. Q., Citron, Y. R., Sekine, S., Huang, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live+Cell+Imaging+of+Endogenous+mRNA+Using+RNA-Based+Fluorescence+"Turn-On"+Probe.">Live Cell Imaging of Endogenous mRNA Using RNA-Based Fluorescence "Turn-On" Probe.</a> ACS Chem. Biol. , (2016).</li><li>Golding, I., Paulsson, J., Zawilski, S. M., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+kinetics+of+gene+activity+in+individual+bacteria.">Real-time kinetics of gene activity in individual bacteria.</a> Cell. 123 (6), 1025-1036 (2005).</li><li>Golding, I., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+8+Spatiotemporal+Dynamics+in+Bacterial+Cells:+Real-Time+Studies+with+Single-Event+Resolution.">Chapter 8 Spatiotemporal Dynamics in Bacterial Cells: Real-Time Studies with Single-Event Resolution.</a> Methods Cell Biol. 89 (8), (2008).</li><li>So, L. H., Ghosh, A., Zong, C., Sepulveda, L. A., Segev, R., Golding, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+properties+of+transcriptional+time+series+in+Escherichia+coli.">General properties of transcriptional time series in Escherichia coli.</a> Nat. Genet. 43 (6), 554-560 (2011).</li><li>Spahn, C., Endesfelder, U., Heilemann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Super-resolution+imaging+of+Escherichia+coli+nucleoids+reveals+highly+structured+and+asymmetric+segregation+during+fast+growth.">Super-resolution imaging of Escherichia coli nucleoids reveals highly structured and asymmetric segregation during fast growth.</a> J. Struct. Biol. 185 (3), 243-249 (2014).</li><li>Sliusarenko, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbetracker+software.">Microbetracker software.</a> Mol Microbiol. 80 (3), 612-627 (2012).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, 8 (2006).</li><li>Arbel-Goren, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcript+degradation+and+noise+of+small+RNA-controlled+genes+in+a+switch+activated+network+in+Escherichia+coli.">Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli.</a> Nucleic Acids Res. 44 (14), 6707-6720 (2016).</li><li>Brandt, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+two-state+stabilization-change+mechanism+for+proton-pumping+complex+I.">A two-state stabilization-change mechanism for proton-pumping complex I.</a> Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1807 (10), 1364-1369 (2011).</li></ol>

저자는 공개 없다.

우리 smFISH 방법2를 사용 하 여 대장균 세포에 다른 유전자의 사본 수 우리의 실험실에서 측정 했습니다. 간단히,이 절차는 다음 단계로 구성 됩니다: 셀 고정, 프로브 삽입을 허용 하는 세포 막의 permeabilization 교 잡, 프로브 및 영상 표준 형광 현미경을 사용 하 여 샘플. 이 절차는 일부 수정6,,716게시 했?...

Stochasticity는 유전자 발현의 근본적이 고 피할 수 없는 측면 이며 셀 셀이1, 성적 및 단백질2,3의 수준에서 모두 증가 제공 합니다. 잘 정의 된 조건 하에서 세포 사이 가변성을 측정 독특한 창 유전자 발현 및 그것의 규칙의 기반이 되는 기본 프로세스에 제공 합니다. 셀이 박테리아에의 한 중요 한 소스는 transcriptional 수준에서 일어난다. 사본 숫자 규정 등 post-transcriptional 프로세스 뿐만 아니라 전사의 stochasticity 때문에 뿐만 아니라 작은 RNAs 및 RNAases2마다 다릅니다. 양적 패션에서이 성분에 직접 액세스 하는 한 가지 방법은 붙일 smFISH에 주어진된 유전자의 개별 성적표를 태그입니다. 이 방법론 검색 및 특정 RNA 분자의 subcellular 지 방화, 개별 박테리아 세포4고정 수 있습니다. mRNAs는 붙일 표시 된 관심5,6의 성적표에 선택적으로 바인딩할 디자인 된 ~ 20 자료-긴 oligonucleotides의 세트로 때 교배. 여러 라벨 배경 형광, 위에 검출 및 개별 mRNA 분자 형광 현미경7 (참조 그림 1) 회절 제한 된 반점으로 나타납니다. MRNA 분자, 상호 보완적인 올리고 머 프로브 보조 붙일 레이블 기자 기법8을 사용 하 여 검색 된 활용된 haptens (예를 들어, biotin 또는 digoxigenin)를가지고 라벨에 대 한 다른 접근이 있다.
SmFISH 이외에 성적에 대 한 정량적 인 정보를 제공 하는 다른 방법이 있다. 북부 등 일부 오 점 또는 양이 많은 PCR 일괄 프로브 따라서 mRNA 사본의 수 없으며 개별 셀에서 그들의 위치를 측정할 수 있습니다. 따라서 이러한 방법은 셀 변화 척도를 적합 하지 않습니다. 최근 이미지 기반 기술은 모두 세포 내 RNAs의 복사본 수로 라는 그들의 세포내 위치의 정량화 다중화 오류 강력한 형광 제자리에서 교 잡 (MERFISH)에 대 한 수 있도록 개발 되었습니다. MERFISH 고정된 개수의 붙일 레이블 oligonucleotide 조사에서 정의 된 조합으로 구성 된 고유 바코드의 할당을 기반으로 합니다. 이러한 바코드는 smFISH 측정의 순차적 라운드에서 밖으로 읽힌다, photobleaching와 함께 다음 각 교 잡, 두 배나9,10처리량 증가의. 이 기술은 시스템 및 프로브 세트의 적절 한 디자인 처리는 자동화 된 유체를 필요로 합니다.
해상도에 ten-fold 증가 있습니다 여러 형광 라벨 확률적 광학 재건 현미경 (폭풍)11, 같은 소설 슈퍼 해상도 기술 함께 개별 성적표의의 subcellular 국산화 성적 증명서 폭풍, 형광 프로브 및 이미징 버퍼의 적당 한 조합 당 (깜박이) 프로브 분자 형광 방출의 여러 사이클에 대 한 수 있습니다. 폭풍은 대장균 transcriptome 이미지 및 관심12의 동시에 모든 성적 증명서를 라벨에 의해 RNA의 게놈 넓은 공간 조직 관찰에 사용할 수 있습니다.
위에 검토 하는 모든 단일 셀 방법 고정된 셀에 녹취 록을 이미징 기반으로 합니다. 따라서, 그들은 세포 내에서 성적 운동 속성에 관한 모든 정보를 제공 하지 않습니다. 라이브 셀13에서 성적에 따라, mRNAs 사이트 바인딩 배열에 관심사의 유전자의 융합에 의해 표시 수 있습니다. 이 후자는 다음에 의해 인식 같은 살 균 소 MS2 외 투 단백질, 녹색 형광 단백질 (GFP)10,,1415등 형광 단백질을 융합 한 RNA 의무적인 단백질.
여기는 특히 대장균에 놓여있는지 표시 된 DNA 프로브, smFISH 실험에 사용 하기 위해 집합으로 개별 mRNAs를 라벨에 대 한 방법에 설명 합니다. 또한, 우리는 동일한 라벨 체계 사소한 수정 폭풍 측정을 위해 사용 될 수 있습니다 보여줍니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr >
			<td >Dextran sulfate sodium salt</td>
			<td >Sigma-Aldrich</td>
			<td >D8906</td>
			<td ></td>
		</tr>
		<tr >
			<td >Pure Ethanol, 99.5%, ACS reagent, absolute</td>
			<td >Mallinckrodt Baker - Avantor</td>
			<td >8025.25</td>
			<td ></td>
		</tr>
		<tr >
			<td >Diethylpyrocarbonate (DEPC)</td>
			<td >Sigma-Aldrich</td>
			<td >D5758</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free 20X SSC</td>
			<td >Life Technologies/Ambion</td>
			<td >AM9763</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free 10X PBS</td>
			<td >Life Technologies/Ambion</td>
			<td >AM9625</td>
			<td ></td>
		</tr>
		<tr >
			<td >TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) BioUltra, for molecular biology</td>
			<td >Sigma-Aldrich</td>
			<td >93283</td>
			<td ></td>
		</tr>
		<tr >
			<td >nuclease-free water</td>
			<td >Thermo Fisher Scientific</td>
			<td >10977035</td>
			<td ></td>
		</tr>
		<tr >
			<td >Formaldehyde solution for molecular biology, 36.5-38% in water</td>
			<td >Sigma-Aldrich</td>
			<td >F8775</td>
			<td ></td>
		</tr>
		<tr >
			<td >Deionized formamide, nuclease free</td>
			<td >Thermo Fisher Scientific/Ambion</td>
			<td >AM9342</td>
			<td ></td>
		</tr>
		<tr >
			<td >E. coli tRNA (ribonucleic acid, transfer type xx from escherichia)</td>
			<td >Sigma-Aldrich</td>
			<td >R1753-500UN</td>
			<td ></td>
		</tr>
		<tr >
			<td >UltraPure BSA (50mg/ml)</td>
			<td >Thermo Fisher Scientific/Ambion</td>
			<td >AM2616</td>
			<td ></td>
		</tr>
		<tr >
			<td >Vanadyl-ribonucleoside complex,VRC, 200 mM</td>
			<td >New England Biolab</td>
			<td >S1402S</td>
			<td ></td>
		</tr>
		<tr >
			<td >Poly-L-Lysine</td>
			<td>Sigma</td>
			<td >P4707</td>
			<td ></td>
		</tr>
		<tr >
			<td >Cysteamine and oxygen</td>
			<td >Sigma-Aldrich</td>
			<td >30070</td>
			<td ></td>
		</tr>
		<tr >
			<td >Glucose Oxidase from Aspergillus niger, Type VII, 50KU</td>
			<td >Sigma-Aldrich</td>
			<td >G2133</td>
			<td ></td>
		</tr>
		<tr >
			<td >Catalase</td>
			<td >Sigma-Aldrich</td>
			<td >C40</td>
			<td ></td>
		</tr>
		<tr >
			<td >D-glucose</td>
			<td >Sigma-Aldrich</td>
			<td >G8270</td>
			<td ></td>
		</tr>
		<tr >
			<td >D-fucose</td>
			<td >Sigma-Aldrich</td>
			<td >F8150</td>
			<td ></td>
		</tr>
		<tr >
			<td >Vybrant DiO Cell-Labeling Solution</td>
			<td >Life Technologies</td>
			<td >V2286</td>
			<td ></td>
		</tr>
		<tr >
			<td >Agarose,low melting reagent</td>
			<td >Sigma-Aldrich</td>
			<td >A9414</td>
			<td ></td>
		</tr>
		<tr >
			<td >Adhesive silicone isolator 24-2mm Dia. X 1.8 mm depth JTR24R-A2-2.0</td>
			<td >Grace Bio-Labs</td>
			<td >JTR24R-A2-2.0 666208</td>
			<td ></td>
		</tr>
		<tr >
			<td >poly-D-lysine-coated glass bottom Glass Bottom Culture Dishes</td>
			<td >MatTek Corporation</td>
			<td >P35GC-1.5-14-C</td>
			<td ></td>
		</tr>
		<tr >
			<td >Super life nitrile powder free examination gloves</td>
			<td >Supermax</td>
			<td >TC-N-9889</td>
			<td ></td>
		</tr>
		<tr >
			<td >Brand sterilization incubator tape</td>
			<td >Sigma-Aldrich</td>
			<td >BR61750</td>
			<td ></td>
		</tr>
		<tr >
			<td >Microcentrifuge tubes (1.8 ml)</td>
			<td >Axygen - Corning Life Sciences</td>
			<td >MCT-175C</td>
			<td ></td>
		</tr>
		<tr >
			<td >Falcon round-bottom polypropylene tubes (14 ml)</td>
			<td >BD Biosciences</td>
			<td >352059</td>
			<td ></td>
		</tr>
		<tr >
			<td >Conical-bottom centrifuge polypropylene tubes (50 ml)</td>
			<td >Corning</td>
			<td >430828</td>
			<td ></td>
		</tr>
		<tr >
			<td >Serological pipettes (Corning 5 ml)</td>
			<td >Corning Life Sciences</td>
			<td >4051</td>
			<td ></td>
		</tr>
		<tr >
			<td >Serological pipettes (Corning 10 ml)</td>
			<td >Corning Life Sciences</td>
			<td >4488</td>
			<td ></td>
		</tr>
		<tr >
			<td >Serological pipettes (Corning 25 ml)</td>
			<td >Corning Life Sciences</td>
			<td >4251</td>
			<td ></td>
		</tr>
		<tr >
			<td >Spectrophotometer cuvettes</td>
			<td >Sarstedt</td>
			<td >67.742</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free pipette tips 0.2 - 20 &#956;l</td>
			<td >FroggaBio</td>
			<td >FT20</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free pipette tips 10 - 200 &#956;l</td>
			<td >Axigene/corning</td>
			<td >TF-200</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free pipette tips 100 - 1000 &#956;l</td>
			<td >FroggaBio</td>
			<td >FT1000</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free pipette tips 100 - 1000 &#956;l</td>
			<td>Sorenson</td>
			<td >14200</td>
			<td ></td>
		</tr>
		<tr >
			<td >Syringe disposile 10 mL needle G-21</td>
			<td>Becton Dickinson, Biosciences</td>
			<td >BD-309643</td>
			<td ></td>
		</tr>
		<tr >
			<td >Minisart 0.2 um Syringe Filter</td>
			<td >Sartorius</td>
			<td >16534 K</td>
			<td ></td>
		</tr>
		<tr >
			<td >Nikon instruments microscope type A immersion oil A, 8cc</td>
			<td >Nikon</td>
			<td >MXA20233</td>
			<td ></td>
		</tr>
		<tr >
			<td >Microscope slides 76 x26, 3&#34;x1&#34;x1mm</td>
			<td >Thermo Fisher Scientific</td>
			<td >421-004ET</td>
			<td ></td>
		</tr>
		<tr >
			<td >#0 coverslip slide 24x60</td>
			<td >Thermo Fisher Scientific/Menzel</td>
			<td >BNBB024060A0</td>
			<td ></td>
		</tr>
		<tr >
			<td >Orbital shaker</td>
			<td >M.R.C</td>
			<td >TOU-50</td>
			<td ></td>
		</tr>
		<tr >
			<td >Hot block</td>
			<td >M.R.C</td>
			<td ></td>
			<td ></td>
		</tr>
		<tr >
			<td >Vortex</td>
			<td >Fried Electric Company</td>
			<td >G-560-E</td>
			<td ></td>
		</tr>
		<tr >
			<td >Microcentrifuge</td>
			<td >Eppendorf</td>
			<td >5427R</td>
			<td ></td>
		</tr>
		<tr >
			<td >Centrifuge</td>
			<td >Eppendorf</td>
			<td >5810R</td>
			<td ></td>
		</tr>
		<tr >
			<td >Portable Pipet-Aid XP2, Pipette Controller</td>
			<td >Drummond Scientific Company</td>
			<td >4-000-501-I</td>
			<td ></td>
		</tr>
		<tr >
			<td >OD600 Spectrophotometer for Bacterial Growth Rates DiluPhotometer</td>
			<td >Midsci</td>
			<td >OD600-10</td>
			<td ></td>
		</tr>
		<tr >
			<td >iXon X3 EMCCD camera</td>
			<td >Andor</td>
			<td >DU-897E-CS0-#BV</td>
			<td > </td>
		</tr>
		<tr >
			<td >Eclipse Ti microscope</td>
			<td >Nikon</td>
			<td >MEA53100</td>
			<td > </td>
		</tr>
		<tr >
			<td >CFI plan apochromat DM 100X oil objective lambda PH-3 N.A 1.45 WD 0.13</td>
			<td >Nikon</td>
			<td >MRD31905</td>
			<td > </td>
		</tr>
		<tr >
			<td >Filter set (TRITC/CY3): EX - ET545/30X; EM - ET620/60M; BS - T570LP</td>
			<td >Nikon</td>
			<td >49005</td>
			<td > </td>
		</tr>
		<tr >
			<td >Filter set (CY5): EX - ET640/30X; EM - ET690/50M; BS - T660P</td>
			<td >Nikon</td>
			<td >49009</td>
			<td > </td>
		</tr>
		<tr >
			<td >Nis-elements AR auto reaserch software</td>
			<td >Nikon</td>
			<td >MQS31000</td>
			<td > </td>
		</tr>
		<tr >
			<td >STORM microscope</td>
			<td >Vutara</td>
			<td >SR-200</td>
			<td > </td>
		</tr>
		<tr >
			<td >NA 1.2 water immersion objective </td>
			<td >Olympus</td>
			<td > </td>
			<td > </td>
		</tr>
		<tr >
			<td >SRX image acquisition and analysis software</td>
			<td >Vutara</td>
			<td ></td>
			<td ></td>
		</tr>
		<tr >
			<td >Evolve 512 EMCCD camera</td>
			<td >Photometrics</td>
			<td ></td>
			<td ></td>
		</tr>
		<tr >
			<td >Stellaris&#174; FISH Probes, Custom Assay with CAL Fluor&#174; Red 590 Dye</td>
			<td >Biosearch Technologies Inc</td>
			<td >SMF-1083-5</td>
			<td ></td>
		</tr>
		<tr >
			<td >Probe Sequence for galK mRNA:</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtgttttttctttcagactc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tagccaaatgcgttggcaaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ctgaatggtgtgagtggcag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >caccaatcaaattcacgcgg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acgaaaccgtcgttgtagtc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgataatcaatcgcgcaggg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtggtgcacaactgatcacg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acgcgaactttacggtcatc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gctgattttcataatcggct</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gcatcgagggaaaactcgtc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gttttcatgtgcgacaatgg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >cacgccacgaacgtagttag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttacgcagttgcagatgttt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tccagtgaagcggaagaact</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgctgcaatacggttccgac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtccagcggcagatgataaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgaccgttaagcgcgatttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >agcctacaaactggttttct</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gcggaaattagctgatccat</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >aaggcatgatctttcttgcc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >cagtgagcggcaatcgatca</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgggcatggaaactgctttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gatgatgacgacagccacac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gggtacgtttgaagttactg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtgttgtattcgctgccaac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggtttcgcactgttcacgac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tggctgctggaagaaacgcg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttcaatggtgacatcacgca</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >catgcgcaacagcgttgaac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggcgttttcagtcagtatat</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >atacgtttcaggtcgccttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgagactccgccatcaactc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gaaatcatcgcgcatagagg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >caatttgcggcacggtgatt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttgacgatttctaccagagt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acctttgtcgccaatcacag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggatcagcgcgacgatacag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >atattgttcagcgacagctt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtctctttaatacctgtttt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ctccttgtgatggtttacaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >Stellaris&#174; FISH Probes, Custom Assay with Quaser Fluor&#174; Red 670 Dye</td>
			<td >Biosearch Technologies Inc</td>
			<td >SMF-1083-5</td>
			<td ></td>
		</tr>
		<tr >
			<td >Probe Sequence for sodB mRNA:</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtgttttttctttcagactc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tagccaaatgcgttggcaaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ctgaatggtgtgagtggcag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >caccaatcaaattcacgcgg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acgaaaccgtcgttgtagtc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgataatcaatcgcgcaggg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtggtgcacaactgatcacg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acgcgaactttacggtcatc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gctgattttcataatcggct</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gcatcgagggaaaactcgtc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gttttcatgtgcgacaatgg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >cacgccacgaacgtagttag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttacgcagttgcagatgttt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tccagtgaagcggaagaact</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgctgcaatacggttccgac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtccagcggcagatgataaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgaccgttaagcgcgatttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >agcctacaaactggttttct</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gcggaaattagctgatccat</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >aaggcatgatctttcttgcc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >cagtgagcggcaatcgatca</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgggcatggaaactgctttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gatgatgacgacagccacac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gggtacgtttgaagttactg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtgttgtattcgctgccaac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggtttcgcactgttcacgac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tggctgctggaagaaacgcg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttcaatggtgacatcacgca</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >catgcgcaacagcgttgaac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggcgttttcagtcagtatat</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >atacgtttcaggtcgccttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgagactccgccatcaactc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gaaatcatcgcgcatagagg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >caatttgcggcacggtgatt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttgacgatttctaccagagt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acctttgtcgccaatcacag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggatcagcgcgacgatacag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >atattgttcagcgacagctt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtctctttaatacctgtttt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ctccttgtgatggtttacaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
	</tbody>
</table>

method for labeling transcripts in individual escherichia coli cells for single-molecule fluorescence in situ hybridization experiments

고정된 박테리아 대장균에 있는 단일 분자 형광 제자리에서 교 잡 (smFISH) 실험에 사용 하기 위해 성적 증명서 개별 메신저 RNA (mRNA)를 라벨에 대 한 방법을 설명 합니다. smFISH는 성적 증명서의 subcellular 위치 뿐 아니라 관심의 유전자의 mRNA 사본 수에 셀 다양성의 측정을 허용 한다. 주요 단계는 세균성 세포 배양의 고정, 세포 막의 permeabilization 및 상업적으로 사용 가능한 짧은 붙일 레이블 oligonucleotide 조사 세트와 함께 대상 증명서의 교 잡. smFISH는 다른 형광 마커 사이의 스펙트럼 중복에 의해 부과 된 제한 같은 셀에 여러 유전자의 성적 이미지를 허용할 수 있습니다. 아래 설명 하는 프로토콜의 완료, 다음 셀 수 있을 쉽게 몇 군데 낮은 강도의 형광을 위해 적당 한 카메라와 함께 결합 하는 현미경을 사용 하 여. 셀 윤곽선 세분화 단계 대비 프레임, 또는 세포 막 얼룩에서 함께 이러한 이미지 오픈 소스 또는 사용자 작성 소프트웨어를 사용 하 여 셀의 샘플의 mRNA 사본 숫자 분포의 계산을 허용 한다. 여기 설명 하는 표기 방법은 확률적 광학 재건 현미경 (스톰)와 성적 증명서 이미지에 적용할 수 있습니다.

우리는 대장균 세포에 galK 및 sodB 내용은의 smFISH 측정에 실시 한다. 녹취 록은 특정 시퀀스 단 하나 형광 성 분자를 활용 되 고 각 조사 대상 시퀀스를 보완의 세트로 때 교배 (재료의 표 참조). 형광 및 위상 대비 MG1655 야생-타입의 이미지 E. 콜라이 긴장 (WT) 또는 JW0740 (게이오 컬렉션)19 galK 삭제 긴장 (ΔgalK) 2 m m D-fucose 그...

Watch this Scientific Journal Video about Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments at JoVE.com

Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

단일 분자 형광 제자리에서 교 잡 실험에 대 한 개별 대장균 세포에 성적표를 라벨에 대 한 방법

이 원고 붙일 표시 된 DNA 프로브, 대장균에 있는 단일 분자 형광 제자리에서 교 잡 (smFISH) 실험에 사용 하기 위해 개별 메신저 RNA (mRNA) 성적표를 라벨에 대 한 방법을 설명 합니다. smFISH 동시 탐지, 지역화, 고 고정된 개별 셀에 단일 mRNA 분자의 정량화를 허용 하는 시각화 방법입니다.

A method is described for labeling individual messenger RNA (mRNA) transcripts in fixed bacteria for use in single-molecule fluorescence in situ ...

method-for-labeling-transcripts-individual-escherichia-coli-cells-for

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

8.1K 조회수.  Weizmann Institute of Science. 이 원고 붙일 표시 된 DNA 프로브, 대장균에 있는 단일 분자 형광 제자리에서 교 잡 (smFISH) 실험에 사용 하기 위해 개별 메신저 RNA (mRNA) 성적표를 라벨에 대 한 방법을 설명 합니다. smFISH 동시 탐지, 지역화, 고 고정된 개별 셀에 단일 mRNA 분자의 정량화를 허용 하는 시각화 방법입니다.

비디오: Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

Pyrosequencing: A Simple Method for Accurate Genotyping

Pharmacogenetic research benefits first-hand from the abundance of information provided by the completion of the Human Genome Project. With such a tremendous amount of data available comes an explosion of genotyping methods. Pyrosequencing(R) is one of the most thorough yet simple methods to date used to analyze polymorphisms. It also has the ability to identify tri-allelic, indels, short-repeat polymorphisms, along with determining allele percentages for methylation or pooled sample assessment. In addition, there is a standardized control sequence that provides internal quality control. This method has led to rapid and efficient single-nucleotide polymorphism evaluation including many clinically relevant polymorphisms. The technique and methodology of Pyrosequencing is explained.


Pyrosequencing(R) is one of the most thorough yet simple methods to date used to analyze polymorphisms. This method has led to rapid and efficient single-nucleotide polymorphism evaluation including many clinically relevant polymorphisms. The technique and methodology of Pyrosequencing is explained.

Pyrosequencing : 정확한 Genotyping을위한 간단한 방법

Pharmacogenetic research benefits first-hand from the abundance of information provided by the completion of the Human Genome Project. With such a ...

연구

생물학

Double Whole Mount in situ Hybridization of Early Chick Embryos

The chick embryo is a valuable tool in the study of early embryonic development. Its transparency, accessibility and ease of manipulation, make it an ideal tool for studying  gene expression in brain, neural tube, somite and heart primordia formation. This video demonstrates the different steps in 2-color whole mount in situ hybridization; First, the embryo is dissected from the egg and fixed in paraformaldehyde. Second, the embryo is processed for prehybridization. The embryo is then hybridized with two different probes, one coupled to DIG, and one coupled to FITC.  Following overnight hybridization, the embryo is incubated with DIG coupled antibody. Color reaction for DIG substrate is performed, and the region of interest appears blue. The embryo is then incubated with FITC coupled antibody. The embryo is processed for color reaction with FITC, and the region of interest appears red. Finally, the embryo is fixed and processed for phtograph and sectioning. A troubleshooting guide is also presented.

This video demonstrates 2-color whole mount in situ hybridization, a method by which the spatial and temporal expression pattern of 2 different genes can be visualized in young chick embryos. This method was originally introduced by David Wilkinson, Domingos Henrique, Phil Ingham and David Ish -Horowicz.

조기 칙 태아의 현장 하이브리드화에서 더블 전체 산

The chick embryo is a valuable tool in the study of early embryonic development. Its transparency, accessibility and ease of manipulation, make it an ...

Fluorescence in situ hybridization (FISH) Protocol in Human Sperm

Aneuploidies are the most frequent chromosomal abnormalities in humans. Most of these abnormalities result from meiotic errors during the gametogenic process in the parents. In human males, these errors can lead to the production of spermatozoa with numerical chromosome abnormalities which represent an increased risk of transmitting these anomalies to the offspring.
For this reason, the technique of fluorescence in situ hybridization (FISH) on sperm nuclei has become a protocol widely incorporated in the context of clinical diagnosis. This practice provides an estimate of the frequencies of numerical chromosome abnormalities in the gametes of the patients that seek for genetic reproductive advice.
To date, the chromosomes most frequently included in sperm FISH analysis are chromosomes X, Y, 13, 18 and 21.
This video-article describes, step by step, how to process and fix a human semen sample, how to decondense and denature the sperm chromatin, how to proceed to obtain sperm FISH preparations, and how to visualize the results at the microscope. Special remarks of the most relevant steps are given to achieve the best results.

Fluorescence in situ hybridization FISH Protocol in Human Sperm

This video-article describes, step by step, how to process a semen sample to achieve good-quality fluorescence in situ hybridization on human spermatozoa. Preparations obtained can be used for aneuploidy screening in the context of clinical diagnosis.

형광 현장에서</em인간의 정자에서> 하이브리드화 (물고기) 프로토콜

Aneuploidies are the most frequent chromosomal abnormalities in humans. Most of these abnormalities result from meiotic errors during the gametogenic ...

Automated System for Single Molecule Fluorescence Measurements of Surface-immobilized Biomolecules

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, such as nucleic acids and proteins. Single molecule FRET (sm-FRET) measurements on immobilized molecules permit long observations of the system -effectively until both dyes photobleach- resulting in time-traces that report on biomolecular dynamics with a broad range of timescales from milliseconds to minutes. To facilitate the acquisition of large number of traces for statistical analyses, the process must be automated and the sample environment should be tightly controlled over the entire measurement time (~12 hours). This is accomplished using an automated scanning confocal microscope that allows the interrogation of thousands of single molecules overnight, and a microfluidic cell that permits the controlled exchange of buffer, with restricted oxygen content and maintains a constant temperature throughout the entire measuring period. Here we show how to assemble the microfluidic device and how to activate its surface for DNA immobilization. Then we explain how to prepare a buffer to maximize the photostability and lifetime of the fluorophores. Finally, we show the steps involved in preparing the setup for the automated acquisition of time-resolved single molecule FRET traces of DNA molecules.

In this article we describe how we obtain FRET traces from individual DNA molecules immobilized to a surface using an automated scanning confocal microscope.

표면 고정화 Biomolecules의 단일 분자 형광 측정을위한 자동화된 시스템

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, ...

In Situ Hybridization for the Precise Localization of Transcripts in Plants

With the advances in genomics research of the past decade, plant biology has seen numerous studies presenting large-scale quantitative analyses of gene expression. Microarray and next generation sequencing approaches are being used to investigate developmental, physiological and stress response processes, dissect epigenetic and small RNA pathways, and build large gene regulatory networks1-3. While these techniques facilitate the simultaneous analysis of large gene sets, they typically provide a very limited spatiotemporal resolution of gene expression changes. This limitation can be partially overcome by using either profiling method in conjunction with lasermicrodissection or fluorescence-activated cell sorting4-7. However, to fully understand the biological role of a gene, knowledge of its spatiotemporal pattern of expression at a cellular resolution is essential. Particularly, when studying development or the effects of environmental stimuli and mutants can the detailed analysis of a gene's expression pattern become essential. For instance, subtle quantitative differences in the expression levels of key regulatory genes can lead to dramatic phenotypes when associated with the loss or gain of expression in specific cell types. 
Several methods are routinely used for the detailed examination of gene expression patterns. One is through analysis of transgenic reporter lines. Such analysis can, however, become time-consuming when analyzing multiple genes or working in plants recalcitrant to transformation. Moreover, an independent validation to ensure that the transgene expression pattern mimics that of the endogenous gene is typically required. Immunohistochemical protein localization or mRNA in situ hybridization present relatively fast alternatives for the direct visualization of gene expression within cells and tissues. The latter has the distinct advantage that it can be readily used on any gene of interest. In situ hybridization allows detection of target mRNAs in cells by hybridization with a labeled anti-sense RNA probe obtained by in vitro transcription of the gene of interest. 
Here we outline a protocol for the in situ localization of gene expression in plants that is highly sensitivity and specific. It is optimized for use with paraformaldehyde fixed, paraffin-embedded sections, which give excellent preservation of histology, and DIG-labeled probes that are visualized by immuno-detection and alkaline-phosphatase colorimetric reaction. This protocol has been successfully applied to a number of tissues from a wide range of plant species, and can be used to analyze expression of mRNAs as well as small RNAs8-14.

In Situ Hybridization for the Precise Localization of Transcripts in Plants

The in situ hybridization protocol described here allows a direct localization of mRNA and small RNA expression at the cellular level with high sensitivity and specificity. The procedure is optimized for paraffin-embedded plant tissue sections, is applicable to a wide range of plants and tissues, and can be completed within ten days.

식물의 성적 증명서의 정확한 현지화에 대한 원위치 하이브리드화에서

With the advances in genomics research of the past decade, plant biology has seen numerous studies presenting large-scale quantitative analyses of gene ...

Detection of Viral RNA by Fluorescence in situ Hybridization (FISH)

Viruses that infect cells elicit specific changes to normal cell functions which serve to divert energy and resources for viral replication. Many aspects of host cell function are commandeered by viruses, usually by the expression of viral gene products that recruit host cell proteins and machineries. Moreover, viruses engineer specific membrane organelles or tag on to mobile vesicles and motor proteins to target regions of the cell (during de novo infection, viruses co-opt molecular motor proteins to target the nucleus; later, during virus assembly, they will hijack cellular machineries that will help in the assembly of viruses). Less is understood on how viruses, in particular those with RNA genomes, coordinate the intracellular trafficking of both protein and RNA components and how they achieve assembly of infectious particles at specific loci in the cell. The study of RNA localization began in earlier work. Developing lower eukaryotic embryos and neuronal cells provided important biological information, and also underscored the importance of RNA localization in the programming of gene expression cascades. The study in other organisms and cell systems has yielded similar important information. Viruses are obligate parasites and must utilise their host cells to replicate. Thus, it is critical to understand how RNA viruses direct their RNA genomes from the nucleus, through the nuclear pore, through the cytoplasm and on to one of its final destinations, into progeny virus particles 1.
FISH serves as a useful tool to identify changes in steady-state localization of viral RNA. When combined with immunofluorescence (IF) analysis 22, FISH/IF co-analyses will provide information on the co-localization of proteins with the viral RNA3. This analysis therefore provides a good starting point to test for RNA-protein interactions by other biochemical or biophysical tests 4,5, since co-localization by itself is not enough evidence to be certain of an interaction. In studying viral RNA localization using a method like this, abundant information has been gained on both viral and cellular RNA trafficking events 6. For instance, HIV-1 produces RNA in the nucleus of infected cells but the RNA is only translated in the cytoplasm. When one key viral protein is missing (Rev) 7, FISH of the viral RNA has revealed that the block to viral replication is due to the retention of the HIV-1 genomic RNA in the nucleus 8. 
Here, we present the method for visual analysis of viral genomic RNA in situ. The method makes use of a labelled RNA probe. This probe is designed to be complementary to the viral genomic RNA. During the in vitro synthesis of the antisense RNA probe, the ribonucleotide that is modified with digoxigenin (DIG) is included in an in vitro transcription reaction. Once the probe has hybridized to the target mRNA in cells, subsequent antibody labelling steps (Figure 1) will reveal the localization of the mRNA as well as proteins of interest when performing FISH/IF.

Detection of Viral RNA by Fluorescence in situ Hybridization FISH

A fluorescence in situ hybridization (FISH) method was developed to visually detect viral genomic RNA using fluorescence microscopy. A probe is made with specificity to the viral RNA that can then be identified using a combination of hybridization and immunofluorescence techniques. This technique offers the advantage of identifying the localization of the viral RNA or DNA at steady-state, providing information on the control of intracellular virus trafficking events.

형광에 의한 바이러스성 RNA의 탐지<em&gt; 현장에서</em&gt; 하이브리드화 (물고기)

Viruses  that infect cells elicit specific changes to normal cell functions which serve  to divert energy and resources for viral replication. Many ...

Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae

The Fluorescence in situ Hybridization (FISH) method allows one to detect nucleic acids in the native cellular environment. Here we provide a protocol for using FISH to quantify the number of mRNAs in single yeast cells. Cells can be grown in any condition of interest and then fixed and made permeable. Subsequently, multiple single-stranded deoxyoligonucleotides conjugated to fluorescent dyes are used to label and visualize mRNAs. Diffraction-limited fluorescence from single mRNA molecules is quantified using a spot-detection algorithm to identify and count the number of mRNAs per cell. While the more standard quantification methods of northern blots, RT-PCR and gene expression microarrays provide information on average mRNAs in the bulk population, FISH facilitates both the counting and localization of these mRNAs in single cells at single-molecule resolution.

Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae

This protocol describes an experimental procedure for performing Fluorescence in situ Hybridization (FISH) for counting mRNAs in single cells at single-molecule resolution.

형광을 사용하여 mRNA의 분자의 시각화 및 분석<em&gt; 제자리에서</em에서&gt; 하이브리드<em&gt; 사카 cerevisiae의</em

The Fluorescence in situ Hybridization (FISH) method allows one to detect nucleic acids in the native cellular environment. Here we provide a protocol for ...

MicroRNA In situ Hybridization for Formalin Fixed Kidney Tissues

In this article we describe a method for colorimetric detection of miRNA in the kidney through in situ hybridization with digoxigenin tagged microRNA probes. This protocol, originally developed by Kloosterman and colleagues for broad use with Exiqon miRNA probes1, has been modified to overcome challenges inherent in miRNA analysis in kidney tissues. These include issues such as structure identification and hard to remove residual probe and antibody. Use of relatively thin, 5 mm thick, tissue sections allowed for clear visualization of kidney structures, while a strong probe signal was retained in cells. Additionally, probe concentration and incubation conditions were optimized to facilitate visualization of microRNA expression with low background and nonspecific signal. Here, the optimized protocol is described, covering the initial tissue collection and preparation through the mounting of slides at the end of the procedure. The basic components of this protocol can be altered for application to other tissues and cell culture models.

MicroRNA In situ Hybridization for Formalin Fixed Kidney Tissues

This article describes an in situ hybridization protocol optimized for colormetric detection of microRNA expression in formalin fixed kidney sections.

마이크로 RNA<em&gt; 현장에서</em&gt; 포르말린 고정 신장 조직에 대한 하이브리드

In this article we describe a method for colorimetric detection of miRNA in the kidney through in situ hybridization with digoxigenin tagged microRNA ...

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. coli O157:H7 by targeting ORF Z3276. With this assay, we can detect as low as a few copies of the genome of DNA of E. coli O157:H7. The sensitivity and specificity of the assay were confirmed by intensive validation tests with a large number of E. coli O157:H7 strains (n = 369) and non-O157 strains (n = 112). Furthermore, we have combined propidium monoazide (PMA) procedure with the newly developed qPCR protocol for selective detection of live cells from dead cells. Amplification of DNA from PMA-treated dead cells was almost completely inhibited in contrast to virtually unaffected amplification of DNA from PMA-treated live cells. Additionally, the protocol has been modified and adapted to a 96-well plate format for an easy and consistent handling of a large number of samples. This method is expected to have an impact on accurate microbiological and epidemiological monitoring of food safety and environmental source.

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A qPCR assay was developed for detection of Escherichia coli O157:H7 targeting a unique genetic marker, Z3276. The qPCR was combined with propidium monoazide (PMA) treatment for live cell detection. This protocol has been modified and adapted to a 96-well plate format for easy and consistent handling of numerous samples

라이브의 검출<em&gt; 대장균</em&gt; O157 : PMA-qPCR에 의한 H7 셀

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

정량적 RT-PCR에 의해 개별 인간 배아 줄기 세포를 프로파일 링

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

단일 분자 형광 제자리에서 교 잡 실험에 대 한 개별 대장균 세포에 성적표를 라벨에 대 한 방법

요약

더 많은 비디오 탐색

이 비디오의 챕터

Pyrosequencing : 정확한 Genotyping을위한 간단한 방법

조기 칙 태아의 현장 하이브리드화에서 더블 전체 산

형광 현장에서 하이브리드화 (물고기) 프로토콜

표면 고정화 Biomolecules의 단일 분자 형광 측정을위한 자동화된 시스템

식물의 성적 증명서의 정확한 현지화에 대한 원위치 하이브리드화에서

형광에 의한 바이러스성 RNA의 탐지

형광을 사용하여 mRNA의 분자의 시각화 및 분석

마이크로 RNA

라이브의 검출

정량적 RT-PCR에 의해 개별 인간 배아 줄기 세포를 프로파일 링