이 작품은 이스라엘 과학 재단 (그랜트 748/14) 지원, 마리 퀴리 통합 부여 (CIG)-FP7 명 20013 CIG 618763와 난 코어 프로그램의 계획 및 예산 위원회와 이스라엘 과학 재단 부여 번호 41/11.

모든 절차의 바 Ilan 대학 기관 검토 위원회에 의해 승인 및 프로토콜 실험 승인 위원회에서 제공 하는 지침을 따릅니다.
 1. 정화의 순진한 사람의 CD4 + 세포 및 T 도우미 1 (Th1), Th2 세포 분극 참고: 우리가 냉동된 인간 주변 혈액 단 세포 (PBMCs)에서 시작 하는 절차를 설명 하는 여기. 첫 번째 단계는 CD4 + 세포 microbeads를 사용 하 여 격리 이루어져 있고 열 일반적으로 CD4 + 세포의 95% 보다 더 우리에 게. 그러나,이 단계는 각 실험실에서 기본 프로토콜에 따라 달라질 수 있습니다. T 세포 활성화와 양극 화에 대 한 프로토콜 Jenner 외에서 수정 된 (2009 년) 18. 절연의 CD4 + 세포 10 백만 PBMCs 제공에서 CD4 + 세포의 4-6 백만에 상승. 두 개의 플라스 크에 분할 Th1 아래 성장와 저조한 3-5 백만 Th1 및 Th2 세포 단지 1 주일 이내 조건 Th2 편광.
 참고: 시작 하기 전에 4 ° c 원심 분리기 진정.
<li>녹여 1 mL 인간 PBMCs의 <ol>(10 7 세포) 포함 하는 보충 1% 페니실린 스, 2 mM L-글루타민, 10% 열 비활성화 태아 둔감 한 혈 청 RPMI 매체의 10 mL 50 mL 튜브에. 500 x g 5 분 제거는 상쾌한에 centrifuge 고 보충된 RPMI 매체의 15 mL의 멸 균 25 mL 피 펫 셀 resuspend. T75 문화 플라스 크 (살 균 25 mL 피 펫)와 셀 전송.</li>
	<li>셀 (37 ° C, 5% CO 2) 습도 인큐베이터에 하룻밤 둡니다.</li>
	<li>50 mL 튜브에 살 균 25 mL 피 펫과 부동 셀을 전송합니다. Trypan 블루 제외 하 여 휴대폰 번호와 생존 확인.</li>
	<li>격리 CD4 + 세포 10 백만에서 라이브 CD4 + microbeads 제조 업체에 따라 열을 사용 하 여 긍정적인 선택에 의해 비 점착 PBMCs &#39; s 추천 (테이블의 재료/장비 참조) 다음으로 수정: 10 7 PBMCs 30 µ L의 PBS에 0.5 %BSA 120 µ L에서 CD4 microbeads 표시 됩니다.</li>
	<li>는 RhIL-2 (10 ng/mL), 플레이트-바인딩 안티-CD3 (5 µ g/mL) 및 수용 성 안티-CD28 (2 µ g/mL) 72 h에 대 한 CD4 + T 세포를 활성화합니다. Th1 분극에 대 한 rhIL-12 (20 ng/mL)와 안티-일리노이-4 (10 µ g/mL)를 추가 합니다. Th2 분극에 대 한 추가 rhIL-4 (40 ng/mL)와 안티-IFN-γ (10 µ g/mL).</li>
	<li>셀 추가 7 일 rhIL-2 (10 ng/mL)의 존재와 동일한 편광 cytokines (rhIL-12 Th1 및 Th2 rhIL-4)에 대 한 문화.</li>
</ol> 2. 핵 격리 참고: ATAC seq 그대로 핵 하 여 수행 됩니다. 세포의 용 해 버퍼 포함 0.05 %nonylphenyl 폴 리 에틸렌 글리콜 기본 인간 Th1 및 Th2 세포에서 핵을 격리 하기 위한 보정 되었다 (참조 테이블의 재료/장비). 이 단계는 실험실 시 약 및 셀 보정 하는 것이 좋습니다. 부족 한 세제에서 그대로 세포의 과잉 이항 반응의 효율성을 줄인다. 세포 세포의 용 해 효율 셀의 총 수를 기준으로 핵 (trypan 블루 긍정적인 세포)의 수에 의해 결정 됩니다. 
참고: 세포의 용 해 버퍼 (10 mM Tris HCl, pH 7.5, 10 m m NaCl, 3 m m MgCl 2)를 준비 합니다. 4 스윙 물통 회전자는 원심 분리기에 진정 ° C. 판 고정된 각도 원심 분리기 대신 스윙 양동이 원심 분리기에 셀 셀/핵 손실을 감소. 핵 또는 셀 손실, 삭제는 상쾌한 때에 신중 하 게 피펫으로 피하려고.
<li>추가 <ol>신선한 nonylphenyl 폴 리 에틸렌 글리콜 (0.05%의 최종 농도) 하 고 protease 억제제 (1 x의 최종 농도)을 사용 하기 전에 즉시 차가운 세포의 용 해 버퍼를 x 100. 얼음에 버퍼를 유지</li>
	<li>그들의 양과 trypan 블루 메서드를 사용 하 여 생존 능력 결정 하 수 T 세포. 더 높은 일반적인 소화에 90%의 결과 보다 낮은 생존.</li>
	<li>1.5 mL microtubes 전송 0.5 x 10 6 T 세포 (Th1 또는 Th2). 4에서 5 분 동안 500 x g에서 스핀 다운 ° c.</li>
	<li>찬 인산 버퍼 (PBS) 염의 1 mL에 셀 펠 릿을 resuspend. 4에서 5 분 동안 500 x g에서 스핀 다운 ° c.</li>
	<li>감기 resuspend 셀 펠 릿 1 mL에 lysis 버퍼 (nonylphenyl 폴 리 에틸렌 글리콜 및 protease 억제제 포함). 얼음에 튜브를 유지. 핵을 방해 하지 않으려면 부드럽게 피 펫.</li>
	<li>신속 하 게 10 µ L을 자동된 셀 카운터 셀 개수 구하기 lysed 세포 microtube 얼음에 있는 동안. 이 단계는 핵의 손상을 방지 하려면 5 분을 넘지 말아야 한다. 셀의 최소 80 %lysed 한다.</li>
	<li>계속 이항 반응으로 즉시입니다. 얼음에 준비 된 핵을 계속</li>
</ol> 3. 이항 반응 참고:이 단계에서 격리 된 핵은 알을 품을 간결한 Tn5 transposase (TDE1) 로드 NGS 시퀀싱에 대 한 어댑터와 함께. 활동적인 Tn5는 동시에 DNA를 조각 하 고 게놈 (tagmentation 프로세스)의 접근 가능한 지역으로 어댑터를 ligates. 핵 및 Tn5 transposase 사이의 비율은 액세스할 수 chromatin에서 우선 분열에 대 한 중요 합니다. 이 프로토콜은 100 μ 반응 볼륨에 100000 핵에 대 한 보정 됩니다. 그러나, 반응 확장할 수 있습니다.
<ol><li>37 열 통에 온도 설정 ° c.</li>
	<li>1.5 mL microtube 전송 100000 핵.</li>
	<li>부드럽게와 4 ° C에서 10 분 동안 500 x g에서 원심 분리기는 상쾌한 제거.</li>
	<li>에 지정 된 표 1 핵 전위 반응 구성 요소를 추가.</li>
	<li>부드러운 pipetting으로 resuspend.</li>
	<li>부드러운 떨고 (500 rpm)와 함께 30 분 동안 37 ° C에서 열 통에 이항 반응을 품 어. 
	참고: DNA 정리 고체 상 가역 immobilization 구슬 19에 의해 수행 됩니다 (참조 테이블의 재료/장비) 또는 PCR 정화 열. 정리의 끝에, 10 mM Tris HCl, pH 8의 20 µ L에 DNA 파편을 elute. 차입 버퍼에 EDTA를 방지.</li>
</ol> 4. ATAC seq 라이브러리의 PCR 농축 참고:이 단계 삽입 어댑터 ATAC seq 라이브러리 즉, DNA 파편을 증폭 하는 목적 이다. 같은 차세대 시퀀싱 레인에서 여러 ATAC seq 라이브러리의 혼합 수 있도록 (&#34; 멀티플렉싱 &#34;) 사용 unindexed 모든 샘플에 대 한 입문서 1 (Ad1_noMx) 1와 다른 색인 (바코드) 뇌관 2 (광고 2.1-2.24) 각 샘플에 대 한 1. 뇌관 시퀀스 테이블의 재료/장비 보충된 제공 됩니다.
<ol><li>초기 PCR 증폭 참고: 뇌관 1 (Ad1_noMx) 및 뇌관 2 작업 농도 25 µ M. 모든 프라이 머는 25 µ m에서 100 µ M의 원래 재고 희석. PCR 반응의 모든, 뇌관 1 (Ad1_noMx) 및 인덱싱된 뇌관 2 중 하나만 사용 합니다.
	<ol><li>추가할 PCR 반응의 구성 요소에 지정 된 표 2로 살 균 PCR 튜브.</li>
		<li>장소 PCR 열 cycler에 튜브와 표 3에 사이클링 조건을 사용 하 여 PCR 증폭을 수행.</li>
	</ol></li> <li>추가 확대 주기의 수의 평가 참고: 추가 PCR 주기 수 도서관 조각 f의 충분 한 금액을 산출 해야 한다또는 성공적인 차세대 시퀀싱 실행, GC를 방지 하 고 바이어스 20 크기를 최소화 하는 동안. 최적의 라이브러리 단편 증폭에 필요한 PCR 주기 (N)의 수의 결심 정량 PCR (정량)에 의해 이루어집니다.
	<ol><li>희석 뇌관 1 (Ad1_noMx)과 2 (초기 라이브러리 증폭에 사용) 25 µ M에서 6.25 µ m.</li>
		<li>표 4에서 제시 된 대로 광학 PCR 튜브 또는 접시에 구성 요소 추가.</li>
		<li>정량 악기과 사이클에 지정 된 테이블 5.</li>
		<li>추가 확대 주기 (N)의 필요한 수를 예상 하려면 x 축 및 y 축에 상대 형광 (RFU)에 주기 수 플롯.</li>
		<li>추가 확대의 수 주기 (N)를 정량 반응에 고원에 도달 하는 사이클의 수의 1/3 이다. 그림 2는 RFU (두꺼운 녹색 선) ~ 2,350 상대 형광 단위, 정점에 도달 하는 3 개의 ATAC seq 라이브러리에 대 한 예제를 제공 합니다. 최대 금액 (783 RFU, y 축에 표시 된)의 1/3은 증폭 된다 PCR 주기 수 8 사이클 라이브러리 (빨간색과 파란색 증폭 곡선)의 두 및 9 PCR 주기 세 번째 라이브러리 (분홍색)에 해당.</li>
	</ol></li> <li>최종 PCR 증폭 <ol><li>PCR 반응의 나머지 45 µ L를 증폭. 증폭 반응 단계 4.1.2 열 cycler에서에서를 포함 하는 PCR 튜브를 놓습니다. 표 6에 설명 된 PCR 프로그램을 실행 합니다. 증폭 사이클 (N)의 이전 결정된 (단계 4.2.5) 번호를 사용 하 여.</li>
	</ol></li></ol> 5. ATAC Seq 라이브러리 선택 크기 참고: 우리의 경험, 증폭된 ATAC seq 라이브러리의 크기 선택 향상 차세대 시퀀싱 결과 그것에서 높은 분자량 도서관 파편을 제거 하기 때문에 최종 ATAC seq 라이브러리. 
참고: 실 온 사용 하기 전에 30 분 따뜻한 자석 구슬 수. 
신선한 70% 에탄올 nuclease 무료 물에 준비.
<ol><li>혼합 하 여 자석 구슬 resuspend.</li>
	<li>Nuclease 무료 물 ATAC seq 라이브러리 (단계 4.3.1에서에서 얻은)에 추가 하 고 최대 100 µ L를가지고.</li>
	<li>추가 50 µ L (0.5 x) resuspended DNA 바인딩 자석 구슬 증폭된 라이브러리의 100 µ L의. 적어도 10 배를 위아래로 pipetting으로 혼합. 실 온에서 5 분에 대 한 샘플을 품 어. 필요한 경우, 신속 하 게는 microtubes 아래로 회전.</li>
	<li>는 상쾌한 자석 구슬 구분 2 분에 대 한 적절 한 마그네틱 스탠드에 튜브를 놓습니다. 2 분 후에 상쾌한 새로운 microtube 전송.</li>
	<li>Pipetting는 상쾌한의 볼륨을 측정 하 고 자석 구슬의 0.7 x를 추가 합니다. 10 번 이상 아래로 pipetting으로 믹스.</li>
	<li>실 온에서 5 분을 품 어. 2 분에 대 한 마그네틱 스탠드에</li>
	<li>후 2 분 외피는 상쾌한을 삭제 합니다. 추가 200 µ L 갓 만든 70% 에탄올 튜브 마그네틱 스탠드에 있는 동안 구슬 씻어.</li>
	<li>계속 30에 대 한 자석에 microtube s 고 삭제 에탄올. 반복 단계 5.7.for 2 개의 최종 에탄올 세척.</li>
	<li>완전히 제거 나머지 에탄올 튜브 자석에은 구슬 5 분 동안 건조 하자. 필요한 경우, 짧게는 microtube 스핀. P10 피 펫 팁과 에탄올의 흔적 제거.</li>
	<li>자석에서는 microtube를 제거 하 고 22 µ L 10 mM Tris HCl, pH 8의 추가. EDTA를 포함 하는 버퍼에서 ATAC seq 라이브러리 elute 하지 마십시오.</li>
	<li>실 온에서 2 분 동안 튜브를 품 어 그리고 마그네틱 스탠드에 장소.</li>
	<li>솔루션은 분명 때 새로운 살 균 microtube eluted 라이브러리의 20 µ L 전송.</li>
	<li>저장소 크기 선택 ATAC seq 라이브러리-20에 ° c.</li>
</ol> 6. ATAC Seq 라이브러리의 품질 분석 <ol><li>실시간 PCR에 의해 ATAC seq 라이브러리의 품질의 유효성 검사 참고: 신호 대 소음 비의 다음-세대 이전 ATAC seq 라이브러리를 평가 하는 것이 중요 하다 시퀀싱. 이렇게 양이 많은 PCR (정량)를 사용 하 여 접근 가능 하 고 액세스할 수 loci에서 DNA 파편의 상대적인 양을 결정 합니다. 액세스할 수 없는 loci (부정적인 제어, chr1:48, 137, 860-48,137,934 및 chr1:193, 093, 748-193,093,827) 뇌관 쌍 1와 2에 의해 증폭 됩니다. 액세스 가능한 loci (긍정적인 제어, chr19:30, 336, 166-30,336,253와 chr19:11546154-11546237) 뇌관 쌍 3와 4에 의해 증폭 됩니다. 긍정적이 고 부정적인 loci 인간의 CD4 + 세포 (인코딩 accessions ENCSR000EQE 및 ENCSR000EQG)의 chromatin 접근성 (국토 안보 부-seq) 프로필에서 정의 되었다. 네거티브 뇌관 1 큰 heterochromatic intergenic 지역 (230 kb TRADB2와 FOXD2에서 88 킬로바이트)에 위치 해 있습니다. 부정적인 통제 지역 2 CDC73 유전자의 첫 번째 intron 이내입니다. 뇌관 쌍 3는 오픈 chromatin 지역 내 긍정적인 긍정적인 뇌관 쌍 4 동안  E (CCNE1) 유전자의 하류 중심 이다 단백질 키 니 아 제 C 기판 80 K-H (PRKCSH)의 발기인 내. 중요 한 것은, 이러한 제어 loci 인코딩 프로젝트 3에서 그들은 광범위 한 종류의 인간 세포에서에서 ATAC seq 라이브러리 모니터링에 적용할 수 있는 제안 다른 인간 세포 종류에 접근의 유사한 패턴을 표시 합니다. 뇌관 효율성과 모든 뇌관 쌍의 특이성은 정량 (인간의 Th 세포)에서 게놈 DNA의 직렬 희석 및 획득된 증폭된 제품의 녹는 곡선 분석에 의해 확인 했습니다.
	<ol><li>게놈 DNA를 상업적으로 사용할 수를 사용 하 여 격리 (참조 테이블의 재료/장비) 키트.</li>
		<li>증폭된 ATAC seq 희석 도서관 1:10 (1 µ L 도서관 + nuclease 무료 물 9 µ L)와 ~ 5 ng / µ L을 genomic DNA.</li>
		<li>반응 혼합물 (표 7) 3 중에서 반응을 수행 하는 계정으로 각 긍정적이 고 부정적인 제어 뇌관 쌍에 대 한 준비.</li>
		<li>정량 마스터 혼합 공급 업체에서 권장 하는 프로토콜에 따라 정량 Pcr 열 cycler에서 품.</li>
		<li>분석 정량 악기에 결과 &#39; s 소프트웨어 (테이블의 재료/장비 참조). 컨트롤 샘플으로 게놈 DNA를 선택 합니다. 얻은 값 액세스할 수 영역 (긍정적인 제어 뇌관에 의해 증폭)의 농축을 나타냅니다. 예를 들어 표 8에 표시 됩니다. 
		참고: 평균 라이브러리 크기와 농도의 추정: ATAC seq 라이브러리에서 DNA 파편의 크기 분포는 제조 업체에 따라 높은 감도 자동된 전기 영동 시스템에 의해 결정 됩니다 &#39; s 지시. 그것은 dsDNA 고감도 키트 및 각 DNA 샘플의 2 µ L를 사용 하 여 fluorometer에 샘플 농도 측정 하는 것이 좋습니다. 
		참고: 다음-세대 시퀀싱-수식을 사용 하 여 각 ATAC seq 라이브러리의 몰 라이브러리 멀티플렉싱, 이전 계산: (ng / µ L x 10 6) / (평균 라이브러리 x 660 조각 길이). 목표로 &#62; 오픈 chromatin를 평가 하기 위해 각 ATAC seq 라이브러리의 30 백만 읽기 인간의 샘플의 영역입니다. 라이브러리 NGS 시퀀싱을 위해 충분히 좋은 인지 확인 하려는 경우 처음 10 백만 ~ 읽기 (빠른 실행된 모드에서 DNA 시퀀싱 장비에서 시퀀싱 레인의 5%)을 목표로 합니다. 유추 nucleosome 위치, 쌍-엔드 시퀀싱은 필요 1.</li>
	</ol></li></ol> 7. 얻은 다음-세대 시퀀싱 결과 분석 <ol><li>별도로 모든 라이브러리에 대 한 FastQC 파일을 검사 하 여 시퀀싱 읽기의 품질을 유추할.</li>
	<li>는 Bowtie 21 소프트웨어를 사용 하 여 유닉스/리눅스 환경에서 인간의 참조 게놈 (hg19 어셈블리)을 읽기를 맞춥니다. 명령은 &#39; bowtie-m 1-q-S 게놈 디렉터리 reads.fastq output_aligned.sam &#39;. 게놈 디렉터리 Bowtie의 게놈 인덱스 저장 되는 폴더에 대 한 의미 합니다. 매개 변수-m 1의 게놈에 있는 하나 이상의 장소에 맞춤을 허용 하지입니다-q fastq 형식 이어야 하는 입력된 파일에 대 한,-S는 샘 형식 출력.</li>
	<li>중복 읽기 SAMtools 22 rmdup 옵션을 사용 하 여 유닉스/리눅스 환경에서 제거 합니다. 명령은 &#39; samtools 볼-S output_aligned.sam b | samtools 정렬-o-output_aligned &#62; output_aligned.bam &#39;, samtools rmdup-s output_aligned.bam output_aligned _rmdup.bam &#39;. 첫 번째 명령은, 보기, 정렬 다음 BAM 형식으로 샘 포맷을 변경 합니다. Rmdup 옵션이 정렬 된 BAM 파일에 적용 됩니다. 원래 ATAC seq 종이 1에 설명 된 대로 필요에 따라 하나 transposon 삽입 사이트에 대 한 읽기를 조정할 수 있습니다. 이렇게 BEDtools를 사용 하 여 명령 유닉스/리눅스 환경에서 23. 명령은 &#39; bamToBed-i output_aligned _rmdup.bam &#62; output_aligned _rmdup.bed &#39;, &#39; shiftBed-i output_aligned _rmdup.bed-p 4 m-5-g 게놈 &#62; output_aligned _rmdup_adjusted.bed &#39;. 첫 번째 명령은, bamTobed, shiftBed 명령에 대 한 사용할 수 있는 침대 형식으로 BAM 포맷을 변경 합니다. 게놈 파일은 게놈에 있는 각 염색체의 길이 포함 하는 탭 구분된 파일이입니다. 파일은 일반적으로 BEDtools 디렉터리에 추가 됩니다.</li>
	<li>수행 피크 전화 칩 seq (MACS2) 24 소프트웨어의 모델 기반 분석을 사용 하 여 다음 매개 변수는 이동된 침대 파일에 유닉스/리눅스 환경에서:-nomodel-extsize-75-30을 이동. 이러한 매개 변수는 transposon 삽입 사이트는 각 연속 읽기는 읽기를 조정 하는 데 사용 됩니다.</li>
</ol>

<ol>
	<li>Buenrostro, J. D., Giresi, P. G., Zaba, L. C., Chang, H. Y., Greenleaf, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposition+of+native+chromatin+for+fast+and+sensitive+epigenomic+profiling+of+open+chromatin,+DNA-binding+proteins+and+nucleosome+position.">Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position.</a> Nat Methods. 10 (12), 1213-1218 (2013).</li><li>Buenrostro, J. D., Wu, B., Chang, H. Y., Greenleaf, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATAC-seq:+A+method+for+assaying+chromatin+accessibility+genome-wide.">ATAC-seq: A method for assaying chromatin accessibility genome-wide.</a> Curr Protoc Mol Biol. , 21.29.1-21.29.9 (2015).</li><li>Thurman, R. E., Rynes, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+accessible+chromatin+landscape+of+the+human+genome.">The accessible chromatin landscape of the human genome.</a> Nature. 489 (7414), 75-82 (2012).</li><li>Song, L., Crawford, G. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNase-seq:+a+high-resolution+technique+for+mapping+active+gene+regulatory+elements+across+the+genome+from+mammalian+cells.">DNase-seq: a high-resolution technique for mapping active gene regulatory elements across the genome from mammalian cells.</a> Cold Spring Harb Protoc. (2), (2010).</li><li>Simon, J. M., Giresi, P. G., Davis, I. J., Lieb, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+formaldehyde-assisted+isolation+of+regulatory+elements+(FAIRE)+to+isolate+active+regulatory+DNA.">Using formaldehyde-assisted isolation of regulatory elements (FAIRE) to isolate active regulatory DNA.</a> Nat Protoc. 7 (2), 256-267 (2012).</li><li>Cui, K., Zhao, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-Wide+Approaches+to+Determining+Nucleosome+Occupancy+in+Metazoans+Using+MNase-Seq.">Genome-Wide Approaches to Determining Nucleosome Occupancy in Metazoans Using MNase-Seq.</a> Methods Mol Biol. 833, 413-419 (2012).</li><li>Qu, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Individuality+and+Variation+of+Personal+Regulomes+in+Primary+Human+T+Cells.">Individuality and Variation of Personal Regulomes in Primary Human T Cells.</a> Cell Syst. 1 (1), 51-61 (2015).</li><li>Scharer, C. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATAC-seq+on+biobanked+specimens+defines+a+unique+chromatin+accessibility+structure+in+na&#239;ve+SLE+B+cells.">ATAC-seq on biobanked specimens defines a unique chromatin accessibility structure in na&#239;ve SLE B cells.</a> Sci Rep. 6, 27030 (2016).</li><li>Seb&#233;-Pedr&#243;s, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Dynamic+Regulatory+Genome+of+Capsaspora+and+the+Origin+of+Animal+Multicellularity.">The Dynamic Regulatory Genome of Capsaspora and the Origin of Animal Multicellularity.</a> Cell. 165 (5), 1224-1237 (2016).</li><li>Lu, Z., Hofmeister, B. T., Vollmers, C., DuBois, R. M., Schmitz, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combining+ATAC-seq+with+nuclei+sorting+for+discovery+of+cis-regulatory+regions+in+plant+genomes.">Combining ATAC-seq with nuclei sorting for discovery of cis-regulatory regions in plant genomes.</a> Nucleic Acids Res. 45 (6), e41 (2016).</li><li>Davie, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+Transcription+Factors+and+Regulatory+Regions+Driving+In+Vivo+Tumor+Development+by+ATAC-seq+and+FAIRE-seq+Open+Chromatin+Profiling.">Discovery of Transcription Factors and Regulatory Regions Driving In Vivo Tumor Development by ATAC-seq and FAIRE-seq Open Chromatin Profiling.</a> PLOS Genet. 11 (2), (2015).</li><li>Villar, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancer+Evolution+across+20+Mammalian+Species.">Enhancer Evolution across 20 Mammalian Species.</a> Cell. 160 (3), 554-566 (2015).</li><li>Lara-Astiaso, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+state+dynamics+during+blood+formation.">Chromatin state dynamics during blood formation.</a> Science. 345 (6199), 943-949 (2014).</li><li>Prescott, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancer+Divergence+and+cis-Regulatory+Evolution+in+the+Human+and+Chimp+Neural+Crest.">Enhancer Divergence and cis-Regulatory Evolution in the Human and Chimp Neural Crest.</a> Cell. 163 (1), 68-83 (2015).</li><li>Wu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+landscape+of+accessible+chromatin+in+mammalian+preimplantation+embryos.">The landscape of accessible chromatin in mammalian preimplantation embryos.</a> Nature. 534 (7609), 652-657 (2016).</li><li>Buenrostro, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+chromatin+accessibility+reveals+principles+of+regulatory+variation.">Single-cell chromatin accessibility reveals principles of regulatory variation.</a> Nature. 523 (7561), 486-490 (2015).</li><li>Corces, M. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lineage-specific+and+single-cell+chromatin+accessibility+charts+human+hematopoiesis+and+leukemia+evolution.">Lineage-specific and single-cell chromatin accessibility charts human hematopoiesis and leukemia evolution.</a> Nat Genet. 48 (10), 1193-1203 (2016).</li><li>Jenner, R. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factors+T-bet+and+GATA-3+control+alternative+pathways+of+T-cell+differentiation+through+a+shared+set+of+target+genes.">The transcription factors T-bet and GATA-3 control alternative pathways of T-cell differentiation through a shared set of target genes.</a> Proc Natl Acad Sci USA. 106 (42), 17876-17881 (2009).</li><li>DeAngelis, M. M., Wang, D. G., Hawkins, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solid-phase+reversible+immobilization+for+the+isolation+of+PCR+products.">Solid-phase reversible immobilization for the isolation of PCR products.</a> Nucleic Acids Res. 23 (22), 4742-4743 (1995).</li><li>Aird, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analyzing+and+minimizing+PCR+amplification+bias+in+Illumina+sequencing+libraries.">Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries.</a> Genome Biol. 12 (2), R18 (2011).</li><li>Langmead, B., Trapnell, C., Pop, M., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrafast+and+memory-efficient+alignment+of+short+DNA+sequences+to+the+human+genome.">Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.</a> Genome Biol. 10 (3), R25 (2009).</li><li>Li, H., Handsaker, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Quinlan, A. R., Hall, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BEDTools:+a+flexible+suite+of+utilities+for+comparing+genomic+features.">BEDTools: a flexible suite of utilities for comparing genomic features.</a> Bioinformatics. 26 (6), 841-842 (2010).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+Analysis+of+ChIP-Seq+(MACS).">Model-based Analysis of ChIP-Seq (MACS).</a> Genome Biol. 9 (9), R137 (2008).</li><li>Meyer, C. A., Shirley Liu, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identifying+and+mitigating+bias+in+next-generation+sequencing+methods+for+chromatin+biology.">Identifying and mitigating bias in next-generation sequencing methods for chromatin biology.</a> Nat Rev Genet. 15 (11), 709-721 (2014).</li><li>He, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Refined+DNase-seq+protocol+and+data+analysis+reveals+intrinsic+bias+in+transcription+factor+footprint+identification.">Refined DNase-seq protocol and data analysis reveals intrinsic bias in transcription factor footprint identification.</a> Nat Methods. 11 (1), 73-78 (2013).</li><li>Madrigal, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+Accounting+for+Sequence-Specific+Bias+in+Genome-Wide+Chromatin+Accessibility+Experiments:+Recent+Advances+and+Contradictions.">On Accounting for Sequence-Specific Bias in Genome-Wide Chromatin Accessibility Experiments: Recent Advances and Contradictions.</a> Front Bioeng Biotechnol. 3, 1-4 (2015).</li><li>Qin, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChiLin:+a+comprehensive+ChIP-seq+and+DNase-seq+quality+control+and+analysis+pipeline.">ChiLin: a comprehensive ChIP-seq and DNase-seq quality control and analysis pipeline.</a> BMC Bioinformatics. 17 (1), (2016).</li><li>Bao, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+ATAC-seq+approach+reveals+lineage-specific+reinforcement+of+the+open+chromatin+landscape+via+cooperation+between+BAF+and+p63.">A novel ATAC-seq approach reveals lineage-specific reinforcement of the open chromatin landscape via cooperation between BAF and p63.</a> Genome Biol. 16 (1), 284 (2015).</li><li>Maurano, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+localization+of+common+disease-associated+variation+in+regulatory+DNA.">Systematic localization of common disease-associated variation in regulatory DNA.</a> Science. 337 (6099), 1190-1195 (2012).</li></ol>

저자는 공개 없다.

여기에 설명 된 ATAC seq 프로토콜은 성공적으로 고용 되었다 액세스할 수 chromatin의 분석에 대 한 1 차 셀에서 (인간의 Th1, Th2 세포와 B 세포) 교양된 셀 라인 (MCF10A 인간의 유방암 세포와 U261 세포종 세포) 뿐만 아니라. 다른 세포 유형 ATAC seq 적용 일부 프로토콜 최적화, 특히 세포 단계에서에서 필요할 수 있습니다. 비 이온 세제의 농도가 너무 높은 경우에, 높은 비율의 미토 콘 드리 아 DNA 오염 수 있?...

ATAC seq1,2 규제3 오픈 chromatin 지역과 nucleosome 포지셔닝의 식별을 가능 하 게 하는 강력한 방법입니다. 이 정보는 위치, id, 및 녹음 방송 요인의 활동을 유추 적용 됩니다. Chromatin 구조 양적 변화를 측정 하기 위한 방법의 감도 chromatin 요인, RNA 중 합 효소 II1의 transcriptional 활동 뿐만 아니라 chromatin remodelers 및 한정자를 포함 하 여 활동의 연구 수 있습니다. 따라서 ATAC seq 모든 세포 유형의 관심에 transcriptional 규칙을 제어 하는 메커니즘을 해독에 대 한 강력 하 고 공평한 접근을 제공 합니다. 우리는 기본 인간의 Th1 및 Th2 세포 ATAC seq의 적응을 설명합니다.
ATAC seq에 활동적인 Tn5 transposase 어댑터 (즉, "tagmentation" 과정)1DNA의 태그와 차세대 시퀀싱 (NGS) 커플 DNA 파편에 대 한 어댑터 로드. PCR 증폭, 다음 결과 DNA 라이브러리는 다음-세대 시퀀싱 (그림 1)에 대 한 준비가 됩니다. 액세스할 수 chromatin의 우선 tagmentation는 ATAC seq 시퀀싱 읽기의 지역 농축의 분석에 의해 검출 된다.
짧은 실험 절차와 chromatin 접근성 및 DNase seq4, 시 키-seq5, MNase-seq6, 등 nucleosomal 위치를 측정 하기 위한 다른 방법에 상대적으로 더 적은 시작 물자에 대 한 요구는 여러 생물 학적 시스템 등 인간의 기본 셀1,7 및 임상 샘플8, 단 세포 유기 체9,10, 식물 과일 파리11에서에서 ATAC seq의 사용을 추진 , 그리고 다양 한 포유류12.
녹음 방송 요인 접근 가능한 loci에 바인딩되는 chromatin immunoprecipitation (칩) 뒤에 높은 처리량 DNA 시퀀싱 (ATAC seq 결합 또는 그들의 바인딩 시퀀스 모티프의 농축을 분석 하 여 발견 될 수 있다의 정체성 ChIP-seq). 이 방법은 마우스13조에 대 한 중요 한 계보 특정 녹음 방송 요인의 식별을 사용할 수 있습니다. ATAC seq의 공평 하 고 글로벌 자연 유기 체는 칩 분석에 대 한 항 체 등 시 약은 사용할 수 없습니다에 있는 유전자 규칙을 공부 하 고 있습니다. Cis진화 변화 예를 들어-두개골 신경 크레스트 셀에서 인간과 침팬지14, 초기 마우스 동안 규제 요소 발달 변화를 공부 하 여 규제 지역 확인 되었습니다 embryogenesis15, 단 세포 C. owzarzaki의 라이프 사이클 동안 규제에 변경9및 발기인 및 20 포유동물 종12에서 강화의 진화.
ATAC seq도 따라서 공개 변화 세포 인구에서 일반적으로 게놈 넓은 연구7,16evades는 단일 셀에 chromatin 접근성을 측정 하기 위한 수단이 되었습니다. 또한, ATAC seq DNA 샘플 드물다 질병 조건에서 규제 지역에서 발생 하는 변화를 공부 하 사용할 수 있습니다. ATAC seq 급성 골수성 백혈병 (AML)17 또는 Ras의 발병 기간 동안 규정에 변화를 공부 하는 예를 들어-발암11을 구동.

<table><tbody><tr><td>50 mL tubes</td><td>Lumitron</td><td>LUM-CFT011500-P</td><td>Can be from other vendors.</td></tr><tr><td>Microtubes</td><td>Axygen Inc</td><td>MCT-175-C</td><td>Can be from other vendors.</td></tr><tr><td>25 mL serological pipettes</td><td>Corning Costar</td><td>4489</td><td>Can be from other vendors.</td></tr><tr><td>Tissue culture flask</td><td>Lumitron</td><td>LUM-TCF-012-250-P</td><td>Can be from other vendors.</td></tr><tr><td>Countes Automated Cell Counter</td><td>Invitrogen</td><td>C10227</td><td></td></tr><tr><td>NucleoSpin Tissue</td><td>MACHEREY-NAGEL</td><td>740952.5</td><td></td></tr><tr><td>Peripheral blood mononuclear cells&amp;nbsp;(PBMC)</td><td>ATCC</td><td>&amp;nbsp;PCS&amp;shy;800&amp;shy;011</td><td>Can be from other vendors.</td></tr><tr><td>RPMI 1640 Medium</td><td>Biological Industries</td><td>01-103-1A</td><td>Can be from other vendors.</td></tr><tr><td>L-Glutamine Solution (200 mM)</td><td>Biological Industries</td><td>03-020-1B</td><td>Can be from other vendors.</td></tr><tr><td>Penicillin-Streptomycin</td><td>Biological Industries</td><td>03-031-1B</td><td>Can be from other vendors.</td></tr><tr><td>Fetal Bovine Serum (FBS),&amp;nbsp;Heat Inactivated, European Grade</td><td>Biological Industries</td><td>04-127-1</td><td>Can be from other vendors.</td></tr><tr><td>MACS CD4 microbeads, human</td><td>Miltenyi Biotec</td><td>130-045-101</td><td></td></tr><tr><td>MACS MS columns</td><td>Miltenyi Biotec</td><td>130-042-201</td><td></td></tr><tr><td>Anti-Human CD4 FITC</td><td>Biogems</td><td>06121-50</td><td></td></tr><tr><td>Mouse IgG1 Isotype Control FITC</td><td>Biogems</td><td>44212-50</td><td></td></tr><tr><td>Anti-Human CD3 (OKT3)</td><td>Tonbo biosciences</td><td>40-0037</td><td></td></tr><tr><td>Anti-Human CD28 SAFIRE Purified</td><td>Biogems</td><td>10311-25</td><td></td></tr><tr><td>Recombinant Human IL2</td><td>Peprotech</td><td>200-02</td><td></td></tr><tr><td>Recombinant Human IL4</td><td>Peprotech</td><td>200-04</td><td></td></tr><tr><td>Recombinant Human IL12 p70</td><td>Peprotech</td><td>200-12</td><td></td></tr><tr><td>In Vivo Ready Anti-Human IL-4 (MP4-25D2)</td><td>Tonbo</td><td>40-7048</td><td></td></tr><tr><td>LEAF&amp;nbsp;Purified anti-human IFN-&amp;gamma;</td><td>BioLegend</td><td>506513</td><td></td></tr><tr><td>NaCl, analytical grade</td><td>Carlo Erba</td><td>479687</td><td>Can be from other vendors.</td></tr><tr><td>Magnesium chloride, Hexahydrate, molecular biology grade</td><td>Calbiochem</td><td>442611</td><td>Can be from other vendors.</td></tr><tr><td>EDTA</td><td>MP Biomedicals</td><td>800682</td><td>Can be from other vendors.</td></tr><tr><td>Tris, ultra pure, 99.9% pure</td><td>MP Biomedicals</td><td>819620</td><td>Can be from other vendors.</td></tr><tr><td>NP-40 alternative (Nonylphenyl Polyethylene Glycol)</td><td>Calbiochem</td><td>492016</td><td>Can be from other vendors.</td></tr><tr><td>Protease Inhibitors</td><td>Sigma</td><td>P2714</td><td>this protease inhibitor coctail is a powder. To make 100 x solution dilute in 1 mL of molecular-biology grade water.</td></tr><tr><td>Magnetic solid phase reverse immobilization beads: AMPure XP beads</td><td>Beckman</td><td>63881</td><td></td></tr><tr><td>PCR purification kit</td><td>HyLabs</td><td>EX-GP200</td><td>Can be from other vendors.</td></tr><tr><td>Nextera DNA Library Preparation Kit (TDE1 transposase and TD buffer)</td><td>Illumina</td><td>FC-121-1030</td><td></td></tr><tr><td>NEBNext High-Fidelity 2 x PCR Master Mix</td><td>New England BioLabs</td><td>M0541</td><td></td></tr><tr><td>NEBNext Q5 Hot Start HiFi PCR Master Mix</td><td>New England BioLabs</td><td>M0543</td><td></td></tr><tr><td>SYBR Green I&amp;nbsp;</td><td>Invitrogen</td><td>S7585</td><td></td></tr><tr><td>&amp;nbsp;CFX Connect Real-Time PCR&amp;nbsp;Detection&amp;nbsp;System</td><td>Bio-rad</td><td>185-5200</td><td>Can be from other vendors.</td></tr><tr><td>CFX Manager Software</td><td>Bio-rad</td><td>1845000</td><td></td></tr><tr><td>master mix for qPCR: iTaq Universal SYBR Green Supermix</td><td>Bio-rad</td><td>172-5124</td><td>Can be from other vendors.</td></tr><tr><td>Qubit fluorometer 2.0</td><td>Invitrogen</td><td>Q32866</td><td></td></tr><tr><td>Qubit dsDNA HS Assay Kit</td><td>Invitrogen</td><td>Q32854</td><td></td></tr><tr><td>Magnet for eppendorf tubes</td><td>Invitrogen</td><td>12321D</td><td>Can be from other vendors.</td></tr><tr><td>Swing bucket cooling centrifuge with the buckets for 15 mL falcon tubes and eppendorf tubes</td><td>Thermo Scientific</td><td>75004527</td><td>Could be from other vendors. It is important that it has buckets for eppendorf tubes.</td></tr><tr><td>Thermo-shaker</td><td>MRC</td><td></td><td>Can be from other vendors.</td></tr><tr><td>High Sensitivity D1000 ScreenTape</td><td>Agilent Technologies</td><td>5067-5584</td><td></td></tr><tr><td>High Sensitivity D1000 Reagents</td><td>Agilent Technologies</td><td>5067-5585</td><td></td></tr><tr><td>4200 TapeStation system</td><td>Agilent Technologies</td><td>G2991AA</td><td>Tape-based platform for&amp;nbsp; electrophoresis</td></tr><tr><td>High Sensitivity DNA kit</td><td>Agilent Technologies</td><td>5067-4626</td><td>Reagent for high-sensitivity TapeStation analysis</td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>Primer name and sequence</td><td>Company</td><td></td><td></td></tr><tr><td>Ad1_noMX: 5&#039;-AATGATACGGCGACCACCGAGA&lt;br/&gt; TCTACACTCGTCGGCAGCGTC&lt;br/&gt; AGATGTG-3&#039;</td><td>IDT</td><td></td><td>Ad1-noMx: 5&#039;-P5 sequence-transposase sequence-3&#039;</td></tr><tr><td>Ad2.1_TAAGGCGA: 5&#039;-CAAGCAGAAGACGGCATACGAG&lt;br/&gt; AT[TCGCCTTA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.1_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.2_CGTACTAG: 5&#039;-CAAGCAGAAGACGGCATACGAG&lt;br/&gt; AT[CTAGTACG]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.2_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.3_AGGCAGAA: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[TTCTGCCT]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.3_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.4_TCCTGAGC: 5&#039;-CAAGCAGAAGACGGCATACGAG&lt;br/&gt; AT[GCTCAGGA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.4_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.5_GGACTCCT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[AGGAGTCC]GTCTCGTGGG&lt;br/&gt; CTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.5_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.6_TAGGCATG: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[CATGCCTA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.6_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.7_CTCTCTAC: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[GTAGAGAG]GTCTCGTGGG&lt;br/&gt; CTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.7_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.8_CAGAGAGG: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[CCTCTCTG]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.8_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.9_GCTACGCT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[AGCGTAGC]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.9_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.10_CGAGGCTG: 5&#039;-CAAGCAGAAGACGGCATACG&lt;br/&gt; AGAT[CAGCCTCG]GTCTCGTGG&lt;br/&gt; GCTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.10_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.11_AAGAGGCA: 5&#039;-CAAGCAGAAGACGGCATACG&lt;br/&gt; AGAT[TGCCTCTT]GTCTCGTGGG&lt;br/&gt; CTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.11_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.12_GTAGAGGA: 5&#039;-CAAGCAGAAGACGGCATACG&lt;br/&gt; AGAT[TCCTCTAC]GTCTCGTGGG&lt;br/&gt; CTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.12_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.13_GTCGTGAT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[ATCACGAC]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.13_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.14_ACCACTGT: 5&#039;- CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[ACAGTGGT]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.14_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.15_TGGATCTG: 5&#039;- CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[CAGATCCA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.15_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.16_CCGTTTGT: 5&#039;- CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[ACAAACGG]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.16_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>&amp;nbsp;Ad2.17_TGCTGGGT: 5&#039;- CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[ACCCAGCA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.17_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>&amp;nbsp;Ad2.18_GAGGGGTT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[AACCCCTC]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.18_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.19_AGGTTGGG: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[CCCAACCT]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.19_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>&amp;nbsp;Ad2.20_GTGTGGTG: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[CACCACAC]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.20_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>&amp;nbsp;Ad2.21_TGGGTTTC: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[GAAACCCA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.21_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.22_TGGTCACA: 5&#039;- CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[TGTGACCA]GTCTCGTGGGC&lt;br/&gt;TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.22_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.23_TTGACCCT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[AGGGTCAA]GTCTCGTGGGC&lt;br/&gt;TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.23_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.24_CCACTCCT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[AGGAGTGG]GTCTCGTGGG&lt;br/&gt;CTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.24_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>F1: 5&#039;-CCTTTTTATTTGCCCATACACTC-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>R1: 5&#039;-CCCAGATAGAAAGTTGGAGAGG-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>F2: 5&#039;-TTGAGGGATGCCATAACAGTC-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>R2: 5&#039;-CTGCTGAACAACATCCTTCAC-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>F3: 5&#039;-GGTTTGCAGGTTGCGTTG-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>R3: 5&#039;-AGAGGAATCTGGGAGTGACG-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>F4: 5&#039;-TGCTCATTCCGTTTCCCTAC-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>R4: 5&#039;-AGCCGGAAAGAAAGTTCCTG-3&#039;</td><td>IDT</td><td></td><td></td></tr></tbody></table>

mapping genome-wide accessible chromatin in primary human t lymphocytes by atac-seq

높은 처리량 시퀀싱 (ATAC-seq) Transposase 액세스할 수 Chromatin에 대 한 분석 결과 chromatin의 오픈 (액세스) 지역의 식별에 사용 되는 방법 이다. 이 지역 규제 DNA 요소를 (예를 들면, 발기인, 증강, 로커 스 제어 영역, 절연체) 요인 바인딩하는 전사를 나타냅니다. 매핑 액세스할 수 chromatin 프리 게놈에서 잠복 활성 규제 요소에 대 한 강력한 접근 이다. 이 정보는 관련 된 녹음 방송 요인의 네트워크 및 유전자 식 프로그램을 제어 하는 chromatin 구조의 메커니즘을 발견에 대 한 편견된 접근 역할을 합니다. ATAC seq는 DNase 강력 하 고 중요 한 대안이 나 과민 증 분석 다음-세대 시퀀싱 (DNase-seq)와 포 름 알 데히드 기반 격리 chromatin의 게놈 넓은 분석에 대 한 규제 요소 (시 키-seq)의 결합 내게 필요한 옵션을 micrococcal nuclease 민감한 사이트 (MNase-seq) nucleosome 위치 결정의 연속. 선물이 상세한 ATAC seq 프로토콜 최적화 된 인간의 기본 면역 세포 즉, CD4 + 세포 (T 도우미 1 (Th1) 및 Th2 세포). 이 포괄적인 프로토콜 셀 수확 시작 chromatin tagmentation, 다음-세대 시퀀싱에 대 한 샘플 준비의 분자 절차에 설명 합니다 그리고 또한 포함 하는 방법 및 전산 분석 하는 데 사용에 대 한 고려 사항 결과 해석 합니다. 또한, 시간과 비용을 절약 하기 위해 우리는 시퀀싱 전에 ATAC seq 라이브러리를 평가 하기 위해 품질 관리 측정을 소개 했다. 중요 한 것은,이 프로토콜에 원리 다른 인간의 면역 및 비 면역 1 차 셀 및 셀 라인에 그것의 적응을 수 있습니다. 이러한 지침은 다음-세대 시퀀싱 방법 숙달 되지 않은 실험실을 위한 또한 유용할 것 이다.

이 프로토콜의 최종 결과 일반적으로 3 ~ 20 ng / µ L의 ATAC seq 라이브러리입니다. DNA 무결성 분석 시스템에서 실행할 때 (참조 테이블의 재료/장비), 그들은 쇼 사다리 같은 모습2 (그림 3A). DNA 파편의 평균 크기는 일반적으로 ~ 450 530 혈압.
차세대 시퀀싱을 수행 하기 전에 ATAC se...

Watch this Scientific Journal Video about Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq at JoVE.com

Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq

높은 처리량 시퀀싱 (ATAC-seq)와 결합 하 여 염색 하는 Transposase 액세스할 수 질에 대 한 분석 결과 액세스할 수 chromatin를 폭로 하는 게놈 넓은 방법입니다. 이 인간의 세포 (Th1/Th2)에 최적화 된 최종 계산 분석, 분자에서 단계별 ATAC seq 프로토콜입니다. 이 프로토콜 차세대 시퀀싱 방법 사전 경험 없이 연구자에 의해 채택 될 수 있다.

ATAC Seq에 의해 기본 인간 T 림프 톨에 게놈 넓은 접근 Chromatin 매핑

Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq) is a method used for the identification of open (accessible) regions ...

mapping-genome-wide-accessible-chromatin-primary-human-t-lymphocytes

Universidad de Cartagena UDEC

Research

JoVE Journal

Genetics

17.9K 조회수.  Bar-Ilan University. 높은 처리량 시퀀싱 (ATAC-seq)와 결합 하 여 염색 하는 Transposase 액세스할 수 질에 대 한 분석 결과 액세스할 수 chromatin를 폭로 하는 게놈 넓은 방법입니다. 이 인간의 세포 (Th1/Th2)에 최적화 된 최종 계산 분석, 분자에서 단계별 ATAC seq 프로토콜입니다. 이 프로토콜 차세대 시퀀싱 방법 사전 경험 없이 연구자에 의해 채택 될 수 있다.

비디오: Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq

An Integrated Platform for Genome-wide Mapping of Chromatin States Using High-throughput ChIP-sequencing in Tumor Tissues

Histone modifications constitute a major component of the epigenome and play important regulatory roles in determining the transcriptional status of associated loci. In addition, the presence of specific modifications has been used to determine the position and identity non-coding functional elements such as enhancers. In recent years, chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq) has become a powerful tool in determining the genome-wide profiles of individual histone modifications. However, it has become increasingly clear that the combinatorial patterns of chromatin modifications, referred to as Chromatin States, determine the identity and nature of the associated genomic locus. Therefore, workflows consisting of robust high-throughput (HT) methodologies for profiling a number of histone modification marks, as well as computational analyses pipelines capable of handling myriads of ChIP-Seq profiling datasets, are needed for comprehensive determination of epigenomic states in large number of samples. The HT-ChIP-Seq workflow presented here consists of two modules: 1) an experimental protocol for profiling several histone modifications from small amounts of tumor samples and cell lines in a 96-well format; and 2) a computational data analysis pipeline that combines existing tools to compute both individual mark occupancy and combinatorial chromatin state patterns. Together, these two modules facilitate easy processing of hundreds of ChIP-Seq samples in a fast and efficient manner. The workflow presented here is used to derive chromatin state patterns from 6 histone mark profiles in melanoma tumors and cell lines. Overall, we present a comprehensive ChIP-seq workflow that can be applied to dozens of human tumor samples and cancer cell lines to determine epigenomic aberrations in various malignancies.

Here, we describe an optimized high-throughput ChIP-sequencing protocol and computational analyses pipeline for the determination of genome-wide chromatin state patterns from frozen tumor tissues and cell lines.

종양 조직에 높은 처리량 칩 시퀀스를 사용 하 여 Chromatin의 게놈 넓은 매핑 위한 통합된 플랫폼

Histone modifications constitute a major component of the epigenome and play important regulatory roles in determining the transcriptional status of ...

연구

암 연구학

ATAC-seq Assay with Low Mitochondrial DNA Contamination from Primary Human CD4+ T Lymphocytes

ATAC-seq has become a widely used methodology in the study of epigenetics due to its rapid and simple approach to mapping genome-wide accessible chromatin. In this paper we present an improved ATAC-seq protocol that reduces contaminating mitochondrial DNA reads. While previous ATAC-seq protocols have struggled with an average of 50% contaminating mitochondrial DNA reads, the optimized&#160;lysis buffer introduced in this protocol reduces mitochondrial DNA contamination to an average of 3%. This improved ATAC-seq protocol allows for a near 50% reduction in the sequencing cost. We demonstrate how these high-quality ATAC-seq libraries can be prepared from activated CD4+ lymphocytes, providing step-by-step instructions from CD4+ lymphocyte isolation from whole blood through data analysis. This improved ATAC-seq protocol has been validated in a wide range of cell types and will be of immediate use to researchers studying chromatin accessibility.

Here, we present a protocol to perform an assay for transposase-accessible chromatin sequencing (ATAC-seq) on activated CD4+ human lymphocytes. The protocol has been modified to minimize contaminating mitochondrial DNA reads from 50% to 3% through the introduction of a new lysis buffer.

ATAC seq 분석 결과 주 인간의 CD4 + T 세포에서 낮은 미토 콘 드리 아 DNA 오염

ATAC-seq has become a widely used methodology in the study of epigenetics due to its rapid and simple approach to mapping genome-wide accessible ...

유전학

Adipocyte-Specific ATAC-Seq with Adipose Tissues Using Fluorescence-Activated Nucleus Sorting

Assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) is a robust technique that enables genome-wide chromatin accessibility profiling. This technique has been useful for understanding the regulatory mechanisms of gene expression in a range of biological processes. Although ATAC-seq has been modified for different types of samples, there have not been effective modifications of ATAC-seq methods for adipose tissues. Challenges with adipose tissues include the complex cellular heterogeneity, large lipid content, and high mitochondrial contamination. To overcome these problems, we have developed a protocol that allows adipocyte-specific ATAC-seq by employing fluorescence-activated nucleus sorting with adipose tissues from the transgenic reporter Nuclear tagging and Translating Ribosome Affinity Purification (NuTRAP) mouse. This protocol produces high-quality data with minimal wasted sequencing reads while reducing the amount of nucleus input and reagents. This paper provides detailed step-by-step instructions for the ATAC-seq method validated for the use of adipocyte nuclei isolated from mouse adipose tissues. This protocol will aid in the investigation of chromatin dynamics in adipocytes upon diverse biological stimulations, which will allow for novel biological insights.

We present a protocol for assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) specifically on adipocytes using nucleus sorting with adipose tissues isolated from transgenic reporter mice with nuclear fluorescence labeling.

Fluorescence-Activated Nucleus Sorting을 사용한 지방 조직을 사용한 지방 세포 특이적 ATAC-Seq

Assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) is a robust technique that enables genome-wide chromatin ...

CATCH-UP: A High-Throughput Upstream-Pipeline for Bulk ATAC-Seq and ChIP-Seq Data

Assay for transposase-accessible chromatin (ATAC) and chromatin immunoprecipitation (ChIP), coupled with next-generation sequencing (NGS), have revolutionized the study of gene regulation. A lack of standardization in the analysis of the highly dimensional datasets generated by these techniques has made reproducibility difficult to achieve, leading to discrepancies in the published, processed data. Part of this problem is due to the diverse range of bioinformatic tools available for the analysis of these types of data. Secondly, a number of different bioinformatic tools are required sequentially to convert raw data into a fully processed and interpretable output, and these tools require varying levels of computational skills. Furthermore, there are many options for quality control that are not uniformly employed during data processing. We address these issues with a complete assay for transposase-accessible chromatin sequencing (ATAC-seq) and chromatin immunoprecipitation sequencing (ChIP-seq) upstream pipeline (CATCH-UP), an easy-to-use, Python-based pipeline for the analysis of bulk ChIP-seq and ATAC-seq datasets from raw fastq files to visualizable bigwig tracks and peaks calls. This pipeline is simple to install and run, requiring minimal computational knowledge. The pipeline is modular, scalable, and parallelizable on various computing infrastructures, allowing for easy reporting of methodology to enable reproducible analysis of novel or published datasets.

ATAC-seq and ChIP-seq allow detailed investigation of gene regulation; however, processing these data types is challenging and often inconsistent between research groups. We present CATCH-UP: an easy-to-use computational pipeline that allows standardized and reproducible data processing and analysis of new and published ATAC/ChIP-seq datasets.

Assay for transposase-accessible chromatin (ATAC) and chromatin immunoprecipitation (ChIP), coupled with next-generation sequencing (NGS), have ...

ATAC-Seq Optimization for Cancer Epigenetics Research

The assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) probes deoxyribonucleic acid (DNA) accessibility using the hyperactive Tn5 transposase. Tn5 cuts and ligates adapters for high-throughput sequencing within accessible chromatin regions. In eukaryotic cells, genomic DNA is packaged into chromatin, a complex of DNA, histones, and other proteins, which acts as a physical barrier to the transcriptional machinery. In response to extrinsic signals, transcription factors recruit chromatin remodeling complexes to enable access to the transcriptional machinery for gene activation. Therefore, identifying open chromatin regions is useful when monitoring enhancer and gene promoter activities during biological events such as cancer progression. Since this protocol is easy to use and has a low cell input requirement, ATAC-seq has been widely adopted to define open chromatin regions in various cell types, including cancer cells. For successful data acquisition, several parameters need to be considered when preparing ATAC-seq libraries. Among them, the choice of cell lysis buffer, the titration of the Tn5 enzyme, and the starting volume of cells are crucial for ATAC-seq library preparation in cancer cells. Optimization is essential for generating high-quality data. Here, we provide a detailed description of the ATAC-seq optimization methods for epithelial cell types.

ATAC-seq is a DNA sequencing method that uses the hyperactive mutant transposase, Tn5, to map changes in chromatin accessibility mediated by transcription factors. ATAC-seq enables the discovery of the molecular mechanisms underlying phenotypic alterations in cancer cells. This protocol outlines optimization procedures for ATAC-seq in epithelial cell types, including cancer cells.

암 후성유전학 연구를 위한 ATAC-Seq 최적화

The assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) probes deoxyribonucleic acid (DNA) accessibility using the ...

Single-Cell Resolution에서 Mouse Cardiac Progenitor Cells의 핵 분리(Nuclei Isolation from Mouse Cardiac Progenitor Cells at Single-Cell Resolution)

Nuclei Isolation from Mouse Cardiac Progenitor Cells for Epigenome and Gene Expression Profiling at Single-Cell Resolution

The developing heart is a complex structure containing various progenitor cells controlled by complex regulatory mechanisms. The examination of the gene expression and chromatin state of individual cells allows the identification of the cell type and state. Single-cell sequencing approaches have revealed a number of important characteristics of cardiac progenitor cell heterogeneity. However, these methods are generally restricted to fresh tissue, which limits studies with diverse experimental conditions, as the fresh tissue must be processed at once in the same run to reduce the technical variability. Therefore, easy and flexible procedures to produce data from methods such as single-nucleus RNA sequencing (snRNA-seq) and the single-nucleus assay for transposase-accessible chromatin with high-throughput sequencing (snATAC-seq) are needed in this area. Here, we present a protocol to rapidly isolate nuclei for subsequent single-nuclei dual-omics (combined snRNA-seq and snATAC-seq). This method allows the isolation of nuclei from frozen samples of cardiac progenitor cells and can be combined with platforms that use microfluidic chambers.

저자 스포트라이트: Nuclei Isolation from Mouse Cardiac Progenitor Cells for Epigenome and Gene Expression Profiling at Single-Cell Resolution  

Here, we present a protocol describing cell nuclei preparation. After microdissection and enzymatic dissociation of cardiac tissue into single cells, the progenitor cells were frozen, followed by isolation of pure viable cells, which were used for single-nucleus RNA sequencing and the single-nucleus assay for transposase-accessible chromatin with high-throughput sequencing analyses.

단일 세포 분해능에서 후성유전체 및 유전자 발현 프로파일링을 위한 마우스 심장 전구 세포에서 핵 분리

The developing heart is a complex structure containing various progenitor cells controlled by complex regulatory mechanisms. The examination of the gene ...

발생학

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly offer whole-genome coverage, where combining chromatin immunoprecipitation (ChIP) and massively parallel sequencing can be utilized to identify the repertoire of mammalian DNA sequences bound by transcription factors in vivo. "Next-generation" genome sequencing technologies provide 1-2 orders of magnitude increase in the amount of sequence that can be cost-effectively generated over older technologies thus allowing for ChIP-seq methods to directly provide whole-genome coverage for effective profiling of mammalian protein-DNA interactions.
For successful ChIP-seq approaches, one must generate high quality ChIP DNA template to obtain the best sequencing outcomes. The description is based around experience with the protein product of the gene most strongly implicated in the pathogenesis of type 2 diabetes, namely the transcription factor transcription factor 7-like 2 (TCF7L2). This factor has also been implicated in various cancers.
Outlined is how to generate high quality ChIP DNA template derived from the colorectal carcinoma cell line, HCT116, in order to build a high-resolution map through sequencing to determine the genes bound by TCF7L2, giving further insight in to its key role in the pathogenesis of complex traits.

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

The combination of chromatin immunoprecipitation and ultra-high-throughput sequencing (ChIP-seq) can identify and map protein-DNA interactions in a given tissue or cell line. Outlined is how to generate a high quality ChIP template for subsequent sequencing, using experience with the transcription factor TCF7L2 as an example.

높은 처리량 시퀀싱을위한 고품질 염색질 면역 침전의 DNA 템플릿의 생성 (칩 SEQ)

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

생물학

Multiplexed Analysis of Retinal Gene Expression and Chromatin Accessibility Using scRNA-Seq and scATAC-Seq

Powerful next generation sequencing techniques offer robust and comprehensive analysis to investigate how retinal gene regulatory networks function during development and in disease states. Single-cell RNA sequencing allows us to comprehensively profile gene expression changes observed in retinal development and disease at a cellular level, while single-cell ATAC-Seq allows analysis of chromatin accessibility and transcription factor binding to be profiled at similar resolution. Here the use of these techniques in the developing retina is described, and MULTI-Seq is demonstrated, where individual samples are labeled with a modified oligonucleotide-lipid complex, enabling researchers to both increase the scope of individual experiments and substantially reduce costs.

Here, the authors showcase the utility of MULTI-seq for phenotyping and subsequent paired scRNA-seq and scATAC-seq in characterizing the transcriptomic and chromatin accessibility profiles in retina.

scRNA-Seq 및 scATAC-Seq 를 이용한 망막 유전자 발현 및 크로마틴 접근성의 다중화 분석

Powerful next generation sequencing techniques offer robust and comprehensive analysis to investigate how retinal gene regulatory networks function during ...

ATAC Seq에 의해 기본 인간 T 림프 톨에 게놈 넓은 접근 Chromatin 매핑

요약

더 많은 비디오 탐색

이 비디오의 챕터

종양 조직에 높은 처리량 칩 시퀀스를 사용 하 여 Chromatin의 게놈 넓은 매핑 위한 통합된 플랫폼

ATAC seq 분석 결과 주 인간의 CD4 + T 세포에서 낮은 미토 콘 드리 아 DNA 오염

Fluorescence-Activated Nucleus Sorting을 사용한 지방 조직을 사용한 지방 세포 특이적 ATAC-Seq

CATCH-UP: A High-Throughput Upstream-Pipeline for Bulk ATAC-Seq and ChIP-Seq Data

암 후성유전학 연구를 위한 ATAC-Seq 최적화

단일 세포 분해능에서 후성유전체 및 유전자 발현 프로파일링을 위한 마우스 심장 전구 세포에서 핵 분리

단일 세포 분해능에서 후성유전체 및 유전자 발현 프로파일링을 위한 마우스 심장 전구 세포에서 핵 분리

단일 세포 분해능에서 후성유전체 및 유전자 발현 프로파일링을 위한 마우스 심장 전구 세포에서 핵 분리

높은 처리량 시퀀싱을위한 고품질 염색질 면역 침전의 DNA 템플릿의 생성 (칩 SEQ)

scRNA-Seq 및 scATAC-Seq 를 이용한 망막 유전자 발현 및 크로마틴 접근성의 다중화 분석