Dati di diffrazione sono stati raccolti a sud-est squadra regionale a accesso collaborativo (SER-CAT) ID-22 e 22-BM beamlines presso Advanced Photon fonte (APS), Argonne National Laboratory. I dati SAXS è stato raccolto sulle Sibille beamline presso Advance Light Source (ALS), Lawrence Berkeley National Laboratory. Vorremmo ringraziare il personale presso la beamline Sibille per il loro aiuto con elaborazione e raccolta dei dati remota. Siamo grati alla ricerca di spettrometria di massa National Institute di Environmental Health Sciences (NIEHS) e gruppo di sostegno per aiuto per determinare i limiti del dominio della proteina. Questo lavoro è stato supportato da noi programma nazionale di Istituto di salute intramurale ricerca; US National Institute of Environmental Health Sciences (NIEHS) (ZIA ES103247 a S. R. E.) e gli istituti canadesi di ricerca sanitaria (CIHR, 146626 a M.C.). Uso di APS è stata sostenuta dal dipartimento dell'energia statunitense, Office of Science, Office di base energia scienze sotto contratto n. W-31-109-ITA-38. Utilizzo di Advanced Light Source (ALS) è stata sostenuta dal direttore, Office of Science, ufficio di energia scienze di base, del US Department of Energy sotto contratto no. DE-AC02-05CH11231. Supporto aggiuntivo per la beamline Sibille SAXS deriva dal National Institute of Health project MINOS (R01GM105404) e un high-end strumentazione Grant S10OD018483. Vorremmo anche ringraziare Andrea Moon e Dr. Sara Andres per loro lettura critica di questo manoscritto.

Gli autori non hanno nulla a rivelare.

Usando questo protocollo, ricombinante Nsa1 da S. cerevisiae è stato generato per studi strutturali di cristallografia a raggi x sia SAXS. Nsa1 era ben educati in soluzione e cristallizzato in diverse forme cristalline. Durante l'ottimizzazione di questi cristalli, è stato scoperto che il C-terminale di Nsa1 era sensibile alla degradazione della proteasi. L'alta risoluzione, forma cristallina ortorombica solo potrebbe essere duplicato con varianti di troncamento di C-terminale di Nsa1, probabilmente perché il...

I ribosomi sono macchine di grande ribonucleoproteina che svolgono il ruolo essenziale di tradurre mRNA in proteine in tutte le cellule viventi. I ribosomi sono composti da due subunità che sono prodotte in un processo complesso chiamato ribosoma biogenesi1,2,3,4. Assemblaggio del ribosoma eucariotico si basa sull'aiuto di centinaia di assemblaggio ribosomal essenziali fattori2,3,5. Nsa1 (Nop7 associato 1) è un fattore di assemblaggio ribosoma eucariotico che sia specificatamente richiesto per la produzione delle subunità ribosomali6, ed è noto come WD-ripetizione contenente 74 (WDR74) in più alti organismi7. WDR74 è stato indicato per essere richiesto per la formazione di blastocisti in topi8e il promotore di WDR74 è frequentemente mutato in cancro cellule9. Tuttavia, la funzione e i meccanismi precisi di Nsa1/WDR74 nell'assembly del ribosoma sono ancora in gran parte sconosciuti. Per iniziare a scoprire il ruolo di Nsa1/WDR74 durante la maturazione del ribosoma eucariotico, sono state effettuate analisi strutturali multiple, compreso cristallografia a raggi x e piccolo angolo x-ray scattering (SAXS)10.
Cristallografia a raggi x, spettroscopia di risonanza magnetica nucleare (NMR), microscopia elettronica e SAXS sono tutti importanti tecniche per studiare la struttura macromolecolare. Dimensioni, forma, disponibilità e stabilità delle influenze di macromolecole il metodo di biologia strutturale per cui una particolare macromolecola sarà meglio adatto, tuttavia combinando tecniche multiple attraverso un approccio di cosiddetti "ibridi" sta diventando un strumento sempre più utile di11. In particolare la cristallografia a raggi x e SAXS sono complementari e potenti metodi per la determinazione strutturale di macromolecole12.
Cristallografia fornisce strutture atomiche ad alta risoluzione che vanno da piccole molecole a grande macchinario cellulare come il ribosoma e ha portato a numerose scoperte nella comprensione delle funzioni biologiche delle proteine e altro macromolecole13. Inoltre, progettazione di farmaci basati su struttura sfrutta la potenza delle strutture cristalline per docking molecolare di metodi computazionali, aggiungendo una dimensione critica per droga scoperta e sviluppo14. Nonostante la sua ampia applicabilità, sistemi flessibili e disordinati sono difficili da valutare di cristallografia poiché impaccamento cristallino può essere ostacolato o mappe di densità elettronica potrebbero essere incomplete o di scarsa qualità. Al contrario, SAXS è un approccio strutturale a bassa risoluzione e basati su soluzioni in grado di descrivere sistemi flessibili che vanno dal loop disordinati e stazione termini a proteine intrinsecamente disordinati12,15,16. Considerando che è compatibile con una vasta gamma di particelle di dimensioni12, SAXS può lavorare sinergico con cristallografia per ampliare la gamma di domande biologiche che possono essere affrontate dagli studi strutturali.
Nsa1 è adatto per un approccio strutturale ibrida perché contiene un dominio ben strutturato di WD40 seguito da una C-terminale funzionale, ma flessibile che non è assoggettabile a metodi di cristallografia a raggi x. Di seguito è un protocollo per la clonazione, espressione e purificazione di S. cerevisiae Nsa1 per determinazione strutturale ibrida di cristallografia a raggi x e SAXS. Questo protocollo può essere adattato per studiare le strutture di altre proteine che sono costituiti da una combinazione di regioni ordinate e disordinate.

<table><tbody><tr><td>&lt;strong&gt;Molecular Cloning of Nsa1&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>pMBP2 parallel vector</td><td>Sheffield et al, Protein Expression and Purification 15, 34-39 (1999)</td><td></td><td>We used a modified version of pMBP2 which included an N-terminal His-tag (pHMBP)</td></tr><tr><td>S. cerevisiae genomic DNA</td><td>ATCC</td><td>204508D-5</td><td></td></tr><tr><td>&lt;strong&gt;Primers for cloning Nsa1&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>SC_Nsa1_FLFw</td><td>IDT</td><td></td><td>CGC CAA AGG CCT&lt;br/&gt; ATGAGGTTACTAGTCAGCTGTGT&lt;br/&gt; GGATAG</td></tr><tr><td>SC_Nsa1_FLRv</td><td>IDT</td><td></td><td>AATGCAGCGGCCGCTCAAATTTT&lt;br/&gt; GCTTTTCTTACTGGCTTTAGAAGC&lt;br/&gt; AGC</td></tr><tr><td>SC_Nsa1_DeltaCFw</td><td>IDT</td><td></td><td>GGGCGCCATGGGATCCATGAGG&lt;br/&gt; TTACTAGTCAGCTGTGTGG</td></tr><tr><td>SC_Nsa1_DeltaCRv</td><td>IDT</td><td></td><td>GATTCGAAAGCGGCCGCTTAAAC&lt;br/&gt; CTTCCTTTTTTGCTTCCC</td></tr><tr><td>&lt;strong&gt;Recombinant Protein Production and Purification of Nsa1&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Escherichia coli BL21 (DE3) Star Cells</td><td>Invitrogen</td><td>C601003</td><td></td></tr><tr><td>pMBP- NSA1 and various truncations</td><td>Lo et al., 2017</td><td></td><td></td></tr><tr><td>Selenomethionine</td><td>Molecular Dimensions</td><td>MD12-503B</td><td></td></tr><tr><td>IPTG, Dioxane-Free</td><td>Promega</td><td>V3953</td><td></td></tr><tr><td>EDTA Free Protease Inhibitor Cocktail</td><td>Sigma-Aldrich</td><td>4693159001</td><td></td></tr><tr><td>Sodium Chloride</td><td>Caledon Laboratory Chemicals</td><td>7560-1-80</td><td></td></tr><tr><td>Magnesium Chloride hexahydrate</td><td>Sigma-Aldrich</td><td>M2670</td><td></td></tr><tr><td>Tris Buffer, 1 M pH7.5</td><td>KD Medical</td><td>RGF-3340</td><td></td></tr><tr><td>Glycerol</td><td>Invitrogen</td><td>15514-029</td><td></td></tr><tr><td>beta-mercaptoethanol</td><td>Sigma</td><td>M6250</td><td></td></tr><tr><td>1M Imidazole, pH 8.0</td><td>Teknova</td><td>I6980-06</td><td></td></tr><tr><td>Talon Affinity Resin</td><td>Clonetech</td><td>635503</td><td></td></tr><tr><td>Amicon Ultra 15 mL Centrifugal Filter (MWCO 10K)</td><td>Millipore</td><td>UFC901024</td><td></td></tr><tr><td>HiLoad 16/600 Superdex 200 Prep Grade Gel Filtration Column</td><td>GE-Healthcare</td><td>28989335</td><td></td></tr><tr><td>TEV Protease</td><td>Prepared by NIEHS Protein Expression Core</td><td>Expression plasmid provided by NCI (Tropea et al. Methods Mol Biology, 2009)</td><td></td></tr><tr><td>4-15% Mini-PROTEAN TGX Precast Protein Gels</td><td>BioRad</td><td>456-8056</td><td></td></tr><tr><td>&lt;strong&gt;Crystallization, Proteolytic Screening&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Crystal Screen</td><td>Hampton Research</td><td>HR2-110</td><td></td></tr><tr><td>Crystal Screen 2</td><td>Hampton Research</td><td>HR2-112</td><td></td></tr><tr><td>Salt Rx</td><td>Hampton Research</td><td>HR2-136</td><td></td></tr><tr><td>Index Screen</td><td>Hampton Research</td><td>HR2-144</td><td></td></tr><tr><td>PEG/Ion Screen</td><td>Hampton Research</td><td>HR2-139</td><td></td></tr><tr><td>JCSG+</td><td>Molecular Dimensions</td><td>MD1-37</td><td></td></tr><tr><td>Wizard Precipitant Synergy</td><td>Molecular Dimensions</td><td>MD15-PS-T</td><td></td></tr><tr><td>Swissci 96-well 3-drop UVP sitting drop plates</td><td>TTP Labtech</td><td>4150-05823</td><td></td></tr><tr><td>3inch Wide Crystal Clear Sealing Tape</td><td>Hampton Research</td><td>HR4-506</td><td></td></tr><tr><td>Proti-Ace Kit</td><td>Hampton Research</td><td>HR2-429</td><td></td></tr><tr><td>PEG 1500</td><td>Molecular Dimensions</td><td>MD2-100-6</td><td></td></tr><tr><td>PEG 400</td><td>Molecular Dimensions</td><td>MD2-100-3</td><td></td></tr><tr><td>HEPES/sodium hydroxide pH 7.5</td><td>Molecular Dimensions</td><td>MD2-011-</td><td></td></tr><tr><td>Sodium Citrate tribasic</td><td>Molecular Dimensions</td><td>MD2-100-127</td><td></td></tr><tr><td>22 mm x 0.22 mm Siliconized Coverslides</td><td>Hampton Research</td><td>HR3-231</td><td></td></tr><tr><td>24 Well Plates with sealant (VDX Plate with Sealant)</td><td>Hampton Research</td><td>HR3-172</td><td></td></tr><tr><td>18 mM Mounted Nylon Loops (0.05 mm to 0.5 mM)</td><td>Hampton Research</td><td>HR4-945, HR4-947, HR4-970, HR4-971</td><td></td></tr><tr><td>Seed Bead Kit</td><td>Hampton Research</td><td>HR2-320</td><td></td></tr><tr><td>Magnetic Crystal Caps</td><td>Hampton Research</td><td>HR4-779</td><td></td></tr><tr><td>Magnetic Cryo Wand</td><td>Hampton Research</td><td>HR4-729</td><td></td></tr><tr><td>Cryogenic Foam Dewar</td><td>Hampton Research</td><td>HR4-673</td><td></td></tr><tr><td>Crystal Puck System</td><td>MiTeGen</td><td>M-CP-111-021</td><td></td></tr><tr><td>Full Skirt 96 well Clear Plate</td><td>VWR</td><td>10011-228</td><td></td></tr><tr><td>AxyMat Sealing Mat</td><td>VWR</td><td>10011-130</td><td></td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>UVEX-m</td><td>JAN Scientific, Inc.</td><td></td><td></td></tr><tr><td>Nanodrop Lite Spectrophotometer</td><td>Thermo-Fisher</td><td></td><td></td></tr><tr><td>Mosquito Robot</td><td>TTP Labtech</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Software/Websites&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>HKL2000</td><td>Otwinoski and Minor, 1997</td><td></td><td></td></tr><tr><td>Phenix</td><td>Adams et al., 2010</td><td></td><td></td></tr><tr><td>Coot</td><td>Emsley et al., 2010</td><td></td><td></td></tr><tr><td>ATSAS</td><td>Petoukhov et al., 2012</td><td></td><td>https://www.embl-hamburg.de/biosaxs/atsas-online/</td></tr><tr><td>Scatter</td><td>Rambo and Tainer, 2013</td><td></td><td></td></tr><tr><td>Pymol</td><td>The PyMOL Molecular Graphics System, Version 1.8 Schr&amp;ouml;dinger, LLC.</td><td></td><td></td></tr><tr><td>BUNCH</td><td>Petoukhov and Svergun, 2005</td><td></td><td></td></tr><tr><td>CRYSOL</td><td>Svergun et al, 1995</td><td></td><td></td></tr><tr><td>PRIMUS</td><td>Konarev et al, 2003</td><td></td><td></td></tr><tr><td>EOM</td><td>Tria et al, 2015</td><td></td><td></td></tr></tbody></table>

combining x-ray crystallography with small angle x-ray scattering to model unstructured regions of nsa1 from s. cerevisiae

Determinazione della struttura Full-Length del fattore di assemblaggio del ribosoma Nsa1 da Saccharomyces cerevisiae (S. cerevisiae) è impegnativo a causa della disordinata e proteasi labile C-terminale della proteina. Questo manoscritto descrive i metodi per purificare ricombinante Nsa1 da S. cerevisiae per l'analisi strutturale di cristallografia a raggi x sia SAXS. Cristallografia a raggi x è stato utilizzato per risolvere la struttura del dominio N-terminale WD40 ben ordinato di Nsa1, e poi SAXS è stato utilizzato per risolvere la struttura del C-terminale di Nsa1 in soluzione. Dati di scattering di soluzione è stato raccolto da Full-Length Nsa1 in soluzione. Le ampiezze di scattering teorici sono state calcolate dalla struttura di cristallo ad alta risoluzione del dominio WD40, e poi una combinazione di corpo rigido e ab-initio modellazione ha rivelato il C-terminale di Nsa1. Attraverso questo approccio ibrido è stata ricostruita la struttura quaternaria della proteina intera. I metodi presentati qui dovrebbero essere generalmente applicabili per la determinazione strutturale di ibrido di altre proteine composta da un mix di domini strutturati e non strutturati.

Nsa1 era PCR amplificati da DNA genomic di S. cerevisiae e subclonato in un vettore contenente un tag di affinità di 6 x-istidina N-terminale seguito da MBP e un sito di proteasi TEV. Nsa1 fu trasformato in cellule di e. coli BL21 (DE3) e alti rendimenti dell'espressione della proteina sono stati ottenuti dopo induzione con IPTG e crescita a 25 ° C durante la notte (Figura 1A). Nsa1 è stato purificato per affinità su resina di affinità ...

Watch this Scientific Journal Video about Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae at JoVE.com

Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

Questo metodo descrive la clonazione, espressione e purificazione di Nsa1 ricombinante per determinazione strutturale di cristallografia a raggi x e small-angle x-ray scattering (SAXS) ed è applicabile per l'analisi strutturale di ibrido di altre proteine che contiene sia ordinato e disordinati domini.

Combinando la cristallografia a raggi x con piccolo angolo x-ray Scattering per modellare le regioni non strutturate di Nsa1 da S. Cerevisiae

Determination of the full-length structure of ribosome assembly factor Nsa1 from Saccharomyces cerevisiae (S. cerevisiae) is challenging because of the ...

combining-x-ray-crystallography-with-small-angle-x-ray-scattering-to

Universidad de Cartagena UDEC

Research

JoVE Journal

Biochemistry

Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

9.8K Views.  National Institutes of Health. Questo metodo descrive la clonazione, espressione e purificazione di Nsa1 ricombinante per determinazione strutturale di cristallografia a raggi x e small-angle x-ray scattering (SAXS) ed è applicabile per l'analisi strutturale di ibrido di altre proteine che contiene sia ordinato e disordinati domini.

Video: Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

Online Size-exclusion and Ion-exchange Chromatography on a SAXS Beamline

Biological small angle X-ray scattering (BioSAXS) is a powerful technique in molecular and structural biology used to determine solution structure, particle size and shape, and surface-to-volume ratio of macromolecules. The technique is applicable to a very wide variety of solution conditions spanning a broad range of concentrations, pH values, ionic strengths, temperatures, additives, etc., but the sample is required to be monodisperse. This caveat led to the implementation of liquid chromatography systems on SAXS beamlines. Here, we describe the upstream integration of size-exclusion (SEC) and ion-exchange chromatography (IEC) on a beamline, different methods for optimal background subtraction, and data reduction. As an example, we describe how we use SEC- and IEC-SAXS on a fragment of the essential vaccinia virus protein D5, consisting of a D5N helicase domain. We determine its overall shape and molecular weight, showing the hexameric structure of the protein.

The determination of the solution structure of a protein by small angle X-ray scattering (SAXS) requires monodisperse samples. Here, we present two possibilities to ensure minimal delays between sample preparation and data acquisition: online size-exclusion chromatography (SEC) and online ion-exchange chromatography (IEC).

In linea Size-esclusione e cromatografia a scambio ionico su una SAXS Beamline

Biological small angle X-ray scattering (BioSAXS) is a powerful technique in molecular and structural biology used to determine solution structure, ...

Ricerca

Biochimica

Atomic Scale Structural Studies of Macromolecular Assemblies by Solid-state Nuclear Magnetic Resonance Spectroscopy

Supramolecular protein assemblies play fundamental roles in biological processes ranging from host-pathogen interaction, viral infection to the propagation of neurodegenerative disorders. Such assemblies consist in multiple protein subunits organized in a non-covalent way to form large macromolecular objects that can execute a variety of cellular functions or cause detrimental consequences. Atomic insights into the assembly mechanisms and the functioning of those macromolecular assemblies remain often scarce since their inherent insolubility and non-crystallinity often drastically reduces the quality of the data obtained from most techniques used in structural biology, such as X-ray crystallography and solution Nuclear Magnetic Resonance (NMR). We here present magic-angle spinning solid-state NMR spectroscopy (SSNMR) as a powerful method to investigate structures of macromolecular assemblies at atomic resolution. SSNMR can reveal atomic details on the assembled complex without size and solubility limitations. The protocol presented here describes the essential steps from the production of 13C/15N isotope-labeled macromolecular protein assemblies to the acquisition of standard SSNMR spectra and their analysis and interpretation. As an example, we show the pipeline of a SSNMR structural analysis of a filamentous protein assembly.

Structures of supramolecular protein assemblies at atomic resolution are of high relevance because of their crucial roles in a variety of biological phenomena. Herein, we present a protocol to perform high-resolution structural studies on insoluble and non-crystalline macromolecular protein assemblies by magic-angle spinning solid-state nuclear magnetic resonance spectroscopy (MAS SSNMR).

Studi strutturali su scala atomica degli assembly macromolecolari di spettroscopia a risonanza magnetica di nucleare allo stato solido

Supramolecular protein assemblies play fundamental roles in biological processes ranging from host-pathogen interaction, viral infection to the ...

Microcrystallography of Protein Crystals and In Cellulo Diffraction

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in their largest dimension, which used to represent a challenge. We present two alternative workflows for the structure determination of protein microcrystals by X-ray crystallography with a particular focus on crystals grown in vivo. The microcrystals are either extracted from cells by sonication and purified by differential centrifugation, or analyzed in cellulo after cell sorting by flow cytometry of crystal-containing cells. Optionally, purified crystals or crystal-containing cells are soaked in heavy atom solutions for experimental phasing. These samples are then prepared for diffraction experiments in a similar way by application onto a micromesh support and flash cooling in liquid nitrogen. We briefly describe and compare serial diffraction experiments of isolated microcrystals and crystal-containing cells using a microfocus synchrotron beamline to produce datasets suitable for phasing, model building and refinement.
These workflows are exemplified with crystals of the Bombyx mori cypovirus 1 (BmCPV1) polyhedrin produced by infection of insect cells with a recombinant baculovirus. In this case study, in cellulo analysis is more efficient than analysis of purified crystals and yields a structure in ~8 days from expression to refinement.

Microcrystallography of Protein Crystals and In Cellulo Diffraction

A protocol is presented for X-ray crystallography using protein microcrystals. Two examples analyzing in vivo-grown microcrystals after purification or in cellulo are compared.

Microcristallografia dei cristalli proteici e<em&gt; In Cellulo</em&gt; Diffrazione

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in ...

Biochemical and Structural Characterization of the Carbohydrate Transport Substrate-binding-protein SP0092

Development of new antimicrobials and vaccines for Streptococcus pneumoniae (pneumococcus) are necessary to halt the rapid rise in multiple resistant strains. Carbohydrate substrate binding proteins (SBPs) represent viable targets for the development of protein-based vaccines and new antimicrobials because of their extracellular localization and the centrality of carbohydrate import for pneumococcal metabolism, respectively. Described here is a rationalized integrated protocol to carry out a comprehensive characterization of SP0092, which can be extended to other carbohydrate SBPs from the pneumococcus and other bacteria. This procedure can aid the structure-based design of inhibitors for this class of proteins. Presented in the first part of this manuscript are protocols for biochemical analysis by thermal shift assay, multi angle light scattering (MALS), and size exclusion chromatography (SEC), which optimize the stability and homogeneity of the sample directed to crystallization trials and so enhance the probability of success. The second part of this procedure describes the characterization of the SBP crystals using a tunable wavelength anomalous diffraction synchrotron beamline, and data collection protocols for measuring data that can be used to resolve the crystallized protein structure.

A streamlined protocol for performing an extensive biochemical and structural characterization of a carbohydrate substrate binding protein from Streptococcus pneumoniae is presented.

Caratterizzazione biochimica e strutturale del carboidrato trasporto substrato-proteina-SP0092

Development of new antimicrobials and vaccines for Streptococcus pneumoniae (pneumococcus) are necessary to halt the rapid rise in multiple resistant ...

Small and Wide Angle X-Ray Scattering Studies of Biological Macromolecules in Solution

In this paper, Small and Wide Angle X-ray Scattering (SWAXS) analysis of macromolecules is demonstrated through experimentation. SWAXS is a technique where X-rays are elastically scattered by an inhomogeneous sample in the nm-range at small angles (typically 0.1 - 5&deg;) and wide angles (typically &gt; 5&deg;). This technique provides information about the shape, size, and distribution of macromolecules, characteristic distances of partially ordered materials, pore sizes, and surface-to-volume ratio. Small Angle X-ray Scattering (SAXS) is capable of delivering structural information of macromolecules between 1 and 200 nm, whereas Wide Angle X-ray Scattering (WAXS) can resolve even smaller Bragg spacing of samples between 0.33 nm and 0.49 nm based on the specific system setup and detector. The spacing is determined from Bragg's law and is dependent on the wavelength and incident angle.
In a SWAXS experiment, the materials can be solid or liquid and may contain solid, liquid or gaseous domains (so-called particles) of the same or another material in any combination. SWAXS applications are very broad and include colloids of all types: metals, composites, cement, oil, polymers, plastics, proteins, foods, and pharmaceuticals. For solid samples, the thickness is limited to approximately 5 mm.
Usage of a lab-based SWAXS instrument is detailed in this paper. With the available software (e.g., GNOM-ATSAS 2.3 package by D. Svergun EMBL-Hamburg and EasySWAXS software) for the SWAXS system, an experiment can be conducted to determine certain parameters of interest for the given sample. One example of a biological macromolecule experiment is the analysis of 2 wt% lysozyme in a water-based aqueous buffer which can be chosen and prepared through numerous methods. The preparation of the sample follows the guidelines below in the Preparation of the Sample section. Through SWAXS experimentation, important structural parameters of lysozyme, e.g. the radius of gyration, can be analyzed.

The demonstration of the small and wide angle X-ray scattering (SWAXS) procedure has become instrumental in the study of biological macromolecules. Through the use of the instrumentation and procedures of specific angle methods and preparation, the experimental data from the SWAXS displays the atomic and nano-scale characterization of macromolecules.

Piccole e Wide Angle X-Ray Scattering Studi di macromolecole biologiche in soluzione

In this paper, Small and Wide Angle X-ray Scattering (SWAXS) analysis of macromolecules is demonstrated through experimentation. SWAXS is a technique ...

Bioingegneria

Contrast-Matching Detergent in Small-Angle Neutron Scattering Experiments for Membrane Protein Structural Analysis and Ab Initio Modeling

The biological small-angle neutron scattering instrument at the High-Flux Isotope Reactor of Oak Ridge National Laboratory is dedicated to the investigation of biological materials, biofuel processing, and bio-inspired materials covering nanometer to micrometer length scales. The methods presented here for investigating physical properties (i.e., size and shape) of membrane proteins (here, MmIAP, an intramembrane aspartyl protease from Methanoculleus marisnigri) in solutions of micelle-forming detergents are well-suited for this small-angle neutron scattering instrument, among others. Other biophysical characterization techniques are hindered by their inability to address the detergent contributions in a protein-detergent complex structure. Additionally, access to the Bio-Deuteration Lab provides unique capabilities for preparing large-scale cultivations and expressing deuterium-labeled proteins for enhanced scattering signal from the protein. While this technique does not provide structural details at high-resolution, the structural knowledge gap for membrane proteins contains many addressable areas of research without requiring near-atomic resolution. For example, these areas include determination of oligomeric states, complex formation, conformational changes during perturbation, and folding/unfolding events. These investigations can be readily accomplished through applications of this method.

Contrast-Matching Detergent in Small-Angle Neutron Scattering Experiments for Membrane Protein Structural Analysis and Ab Initio Modeling

This protocol demonstrates how to obtain a low-resolution ab initio model and structural details of a detergent-solubilized membrane protein in solution using small-angle neutron scattering with contrast-matching of the detergent.

Contrasto-Matching detergente in esperimenti di Scattering di neutroni Small-Angle per Ab Initio modellazione e analisi strutturale di proteine di membrana

The biological small-angle neutron scattering instrument at the High-Flux Isotope Reactor of Oak Ridge National Laboratory is dedicated to the ...

Structural Studies of Macromolecules in Solution using Small Angle X-Ray Scattering

Protein-protein interactions involving proteins with multiple globular domains present technical challenges for determining how such complexes form and how the domains are oriented/positioned. Here, a protocol with the potential for elucidating which specific domains mediate interactions in multicomponent system through ab initio modeling is described. A method for calculating solution structures of macromolecules and their assemblies is provided that involves integrating data from small angle X-ray scattering (SAXS), chromatography, and atomic resolution structures together in a hybrid approach. A specific example is that of the complex of full-length nidogen-1, which assembles extracellular matrix proteins and forms an extended, curved nanostructure. One of its globular domains attaches to laminin &#947;-1, which structures the basement membrane. This provides a basis for determining accurate structures of flexible multidomain protein complexes and is enabled by synchrotron sources coupled with automation robotics and size exclusion chromatography systems. This combination allows rapid analysis in which multiple oligomeric states are separated just prior to SAXS data collection. The analysis yields information on the radius of gyration, particle dimension, molecular shape and interdomain pairing. The protocol for generating 3D models of complexes by fitting high-resolution structures of the component proteins is also given.

Here, we present how Small Angle X-Ray Scattering (SAXS) can be utilized to obtain information on low-resolution envelopes representing the macromolecular structures. When used in conjunction with high-resolution structural techniques such as X-Ray Crystallography and Nuclear Magnetic Resonance, SAXS can provide detailed insights into multidomain proteins and macromolecular complexes in-solution.

Studi strutturali di macromolecole in soluzione con piccolo angolo x-ray Scattering

Protein-protein interactions involving proteins with multiple globular domains present technical challenges for determining how such complexes form and ...

Structure Solution of the Fluorescent Protein Cerulean Using MeshAndCollect

X-ray crystallography is the major technique used to obtain high resolution information concerning the 3-dimensional structures of biological macromolecules. Until recently, a major requirement has been the availability of relatively large, well diffracting crystals, which are often challenging to obtain. However, the advent of serial crystallography and a renaissance in multi-crystal data collection methods has meant that the availability of large crystals need no longer be a limiting factor. Here, we illustrate the use of the automated MeshAndCollect protocol, which first identifies the positions of many small crystals mounted on the same sample holder and then directs the collection from the crystals of a series of partial diffraction data sets for subsequent merging and use in structure determination. MeshAndCollect can be applied to any type of micro-crystals, even if weakly diffracting. As an example, we present here the use of the technique to solve the crystal structure of the Cyan Fluorescent Protein (CFP) Cerulean.

We present the use of the MeshAndCollect protocol to obtain a complete diffraction data set, for use in subsequent structure determination, composed of partial diffraction data sets collected from many small crystals of the fluorescent protein Cerulean.

Soluzione di strutture della proteina fluorescente Cerulean utilizzando MeshAndCollect

X-ray crystallography is the major technique used to obtain high resolution information concerning the 3-dimensional structures of biological ...

Analysis of SEC-SAXS data via EFA deconvolution and Scatter

BioSAXS is a popular technique used in molecular and structural biology to determine the solution structure, particle size and shape, surface-to-volume ratio and conformational changes of macromolecules and macromolecular complexes. A high quality SAXS dataset for structural modeling must be from monodisperse, homogeneous samples and this is often only reached by a combination of inline chromatography and immediate SAXS measurement. Most commonly, size-exclusion chromatography is used to separate samples and exclude contaminants and aggregations from the particle of interest allowing SAXS measurements to be made from a well-resolved chromatographic peak of a single protein species. Still, in some cases, even inline purification is not a guarantee of monodisperse samples, either because multiple components are too close to each other in size or changes in shape induced through binding alter perceived elution time. In these cases, it may be possible to deconvolute the SAXS data of a mixture to obtain the idealized SAXS curves of individual components. Here, we show how this is achieved and the practical analysis of SEC-SAXS data is performed on ideal and difficult samples. Specifically, we show the SEC-SAXS analysis of the vaccinia E9 DNA polymerase exonuclease minus mutant.

SEC-BioSAXS measurements of biological macromolecules are a standard approach for determining solution structure of macromolecules and their complexes. Here, we analyze SEC-BioSAXS data from two types of commonly encountered SEC traces&#8212;chromatograms with fully resolved and partially resolved peaks. We demonstrate the analysis and deconvolution using scatter and BioXTAS RAW.

Analisi dei dati SEC-SAXS tramite deconvoluzione EFA e Scatter

BioSAXS is a popular technique used in molecular and structural biology to determine the solution structure, particle size and shape, surface-to-volume ...

Assembly and Characterization of Polyelectrolyte Complex Micelles

Polyelectrolyte complex micelles (PCMs), core-shell nanoparticles formed by self-assembly of charged polymers in aqueous solution, provide a powerful platform for exploring the physics of polyelectrolyte interactions and also offer a promising solution to the pressing problem of delivering therapeutic oligonucleotides in vivo. Developing predictive structure-property relationships for PCMs has proven difficult, in part due to the presence of strong kinetic traps during nanoparticle self-assembly. This article discusses criteria for choosing polymers for PCM construction and provides protocols based on salt annealing that enable assembly of repeatable, low-polydispersity nanoparticles. We also discuss PCM characterization using light scattering, small-angle X-ray scattering, and electron microscopy.

We provide protocols and representative data for designing, assembling, and characterizing polyelectrolyte complex micelles, core-shell nanoparticles formed by polyelectrolytes and hydrophilic charged-uncharged block copolymers.

Assemblaggio e caratterizzazione di Micelle complesse di polielettroliti

Polyelectrolyte complex micelles (PCMs), core-shell nanoparticles formed by self-assembly of charged polymers in aqueous solution, provide a powerful ...