עבודה זו נתמכה על ידי קרן המדע הלאומית מעניקה A.S. (דב #1427772, 1745411, 1750037).

1. סמן אוסף ועיקור משטח
<ol><li>לאסוף קרציות על-ידי גרירת מטלית2 לבן 1 מ' על גידול הקשורים שנתות, הסרת קרציות אלו המארח מינים, או לגידול מתקתק ב ה15,מעבדה16. להשתמש מלקחיים בסדר כדי לתפעל קרציות ואחסן אותם ב- 80 ° c</li>
	<li>הכנס קרציות בודדות המבחנות ולהסיר לכלוך משטח מאת vortexing 15 s במרוכז עם 500 μL של מי חמצן (H2O2), 70% אתנול ddH2O.</li>
	<li>למקם את הקרציות צינור PCR, לאפשר להם מילה נהדרת...</li>
	<li>. בצינור הזה, לשבש באופן מכני שנתות רקמות ע י השמדת את צבת ומכתש (השתמשו במחקר זה), באמצעות חרוזים קטנים במכה חרוז, או לחתוך את תקתוק בנפרד עם אזמל.</li>
</ol>2. טיהור DNA
<ol><li>לטהר את הדנ א של קרציות בודדות, ביצוע ההוראות בערכה החילוץ של ה-DNA זמינים מסחרית. Elute עבור אמצעי אחסון הסופי של 100 μL. הערה: עיין באיור 1 לקבלת סקירה כללית של צעדים 2.2 – 2.8. שיטות הוצאה אלטרנטיבית כוללות פנול-כלורופורם החילוץ17,18, אתנול משקעים19או חילוץ עם גשמי20,chelating21.</li>
	<li>לאשר מוצלחת טיהור DNA באמצעות fluorometer או ספקטרופוטומטרים. עבור fluorometry, להשתמש μL 10 של תבנית ה-DNA 190 assay DNA גדילי כפול μL. התשואה הצפויה היא 0.1-1.0 ng/μL22. ספקטרופוטומטר, להשתמש μL 1 של תבנית ה-DNA של כימות חומצות גרעין. היחס A260/280 הצפוי הוא כ 1.823.</li>
	<li>אם לא מיד שימשיך הגברה, לאחסן את הדגימות ב-20 ° C.</li>
</ol>3. 16 rRNA ג'ין הגברה
<ol><li>להגדיר את אמפליקון PCR ב תגובה 27.5 μL המכיל: 5 μL של כל תחל ב- 1 μM; ΜL 12.5 של מיקס PCR זמינים מסחרית; μL 5 של DNA מופק קרציות בודדות-ריכוז 5 ng/μL. הערה: השתמש תחל את הבאים עבור הגברה של האזור V3-V4 hypervariable של מטוסי אף-16 rRNA ג'ין13: 5' - TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG - 3 אינץ ', 5 - GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC - 3' '</li>
	<li>להעביר צינורות thermocycler מתוכנת: דנטורציה הראשונית ב 95 מעלות צלזיוס למשך 3 דקות; 25 מחזורי 1) 95 ° C ל 30 s, 2) 57 ° C ל 30 s, 3) 72 ° C ל 30 s; סיומת הסופי ב-72 מעלות למשך 5 דקות; והחזק הסופי ב- 10 מעלות צלזיוס.</li>
	<li>ברגע נעשה את ה-PCR, דמיינו את המוצר PCR על-ידי טעינת 4-6 μL/לדוגמה ב- 1.5% agarose ג'ל. מחפש להקה. 460 bp כדי לאשר הגברה. הערה: אמפליקון PCR מוצר עשוי לא להיות גלוי על הג'ל אם ריכוז מדגם נמוכה מדי (< 10 ng). פריימר דיימר נוכחות נפוץ בדגימות ריכוז נמוך. אם קיימות להקות אחרות שאינן-יעד, להתאים את טמפרטורת מחזק או להקטין את מספר מחזורי.</li>
	<li>אם לא ממשיכים מיד לתחנת טיהור, לאחסן את הדגימות-4 מעלות צלזיוס.</li>
</ol>4. 16 אמפליקון טיהור
<ol><li>באמצעות צינור PCR עבור כל דגימה, לשלב את המוצר PCR עם ddH2O להשיג הכולל 60 μL. לקבלת דוגמאות עם ריכוזים נמוכים של ה-DNA, לבצע אמפליקון PCR שהפקידים כדי להפחית הגברה הטיה מאגר דגימות להתרכז.</li>
	<li>להביא חרוזים פאראמגנטיים בטמפרטורת החדר ו מערבולת שאותם היטב לפני השימוש.</li>
	<li>להוסיף μL 48 של חרוזים פאראמגנטיים 60 μL של המדגם, תקופת דגירה של 5 דק. לנקות את הצינורות על מתלה מגנטי במשך 5 דקות עד פתרון הופך את המקום. הסר את תגובת שיקוע. הערה: במכלול זה חרוז מטרות ההסרה של הדימרים פריימר (< 60 bp). במידת הצורך, התאם את הריכוז חרוז כדי להסיר סימון שאינם ספציפיים אחרים.</li>
	<li>עם צינורות על מתלה מגנטי, להוסיף 500 μL של טריות 80% EtOH. מיד לאחר הוספת EtOH לכל הצינורות, פיפטה החוצה הנוזל. אל תסיר את החרוזים. חזור על תוספת EtOH והסרה עוד פעם אחת.</li>
	<li>מילה נהדרת את הדוגמאות כדי להסיר עודפי EtOH על ידי השארת הצינורות פתוחים על מתלה מגנטי במשך 5 דקות, או עד סדקים קטנים הגלויות בהחרוזים...</li>
	<li>הוסף 20 μL טה המאגר, דגירה בדגימות את המגנט, בטמפרטורת החדר, למשך 5-10 דקות.</li>
	<li>במקום הצינורות בחזרה על המגנט. ברגע חרוזים ונוזלים מופרדים, להעביר את תגובת שיקוע צינור טריים כדי לקבל את המוצר PCR נקי.</li>
	<li>(אופציונלי) דמיינו את המוצר כדי לאשר טיהור אמפליקון מוצלחת על-ידי טעינת 4-6 μL/לדוגמה ב- 1.5% ג'ל. הלהקה bp 460 צריך להיות גלוי, צריך להיות אין פריימר דיימר.</li>
	<li>אם לא ממשיכים מיד לאינדקס PCR לאחסן את הדגימות 4 ° C.</li>
</ol>5. לטעום Barcoding וטיהור
<ol><li>להקצות שילובים ייחודיים פריימר כל דגימה על-ידי בחירת תחל קדימה או אחורה, או את שתיהן, ערכה אינדקס ספריית זמינים מסחרית. הערה: באופן ייחודי תיוג דגימות מאפשר בידול לאחר רצף. ערכות מספקים בדרך כלל מספיק תחל את רצף דגימות 96-384.</li>
	<li>לצרף את צבעי בסיס כפול, או מדדי, דוגמאות על-ידי ביצוע PCR בתגובה 25 μL המכילה 2.5 μL של כל פריימר (N7xx ו- S5xx), 12.5 μL של זמינים מסחרית PCR מאסטר מיקס, 5 μL של ddH2O, ו- 2.5 μL של המוצר אמפליקון נקי.</li>
	<li>לעבור הצינורות thermocycler מתוכנת: דנטורציה הראשונית ב 95 מעלות צלזיוס למשך 3 דקות; 8-14 מחזורים של 1) 95 ° C ל 30 s, 2) 55 ° C ל 30 s, 3) 72 ° C ל 30 s; סיומת הסופי ב-72 מעלות למשך 5 דקות; והחזק הסופי ב- 10 מעלות צלזיוס.</li>
	<li>ברגע נעשה את ה-PCR, דמיינו את המוצר PCR על-ידי טעינת 4-6 μL/לדוגמה ב- 1.5% agarose ג'ל. מחפש להקה. 550 bp כדי לאשר הגברה. הערה: השתמש בתוצאות ויזואליזציה להודיע תנאי הרכיבה של ה-PCR מדד. . תוריד את ספירת סבובי כדי להמתיק מחייב שאינם ספציפיים או הגדל את ספירת סבובי להשיג להקות גלויים עבור כל דגימה.</li>
	<li>חזור על הפעולות לנקות ברשימה בשלב 4. כדי למנוע דילול במהלך ניקיון, לבצע אינדקס PCR כפילויות, בריכה המוצר כאן.</li>
	<li>אם לא מיד שימשיך ספריית כמת, נורמליזציה, לאחסן את הדגימות-4 מעלות צלזיוס.</li>
</ol>6. ספריית כימות ונורמליזציה
<ol><li>מעריכים את הריכוז של כל מוצר לבר-קוד מטוהרים, משלב 5.5 שימוש fluorometer או ספקטרופוטומטרים (ראה שלב 2.2). לדלל את הדגימות במאגר טה לקבל ריכוזים של 1 pM. הערה: ספריית כמת יש צורך להשיג את הדוגמית מעמיסים ריכוז מומלץ עבור פלטפורמת רצף. ספריית כימות מושגת באמצעות qPCR, אך הערכת הריכוז מדגם לפני qPCR חוסך ריאגנטים וזמן. ריכוז 1 pM מומלץ להגדיל את הדיוק של ספריית כמת, כמו זה הריכוז אכזרי של הסטנדרטים qPCR הניתנים את ערכת כימות24.</li>
	<li>ביצוע qPCR לתגובה 10 μL המכיל μL 6.0 של מיקס מאסטר qPCR (מתוך ספריית כימות קיט), μL 2.0 של ddH2O μL 2.0 של הדגימה או רגיל. הפעל כל דוגמה סטנדרטי דולר עבור ודיוק רב יותר. לרוץ כל מדגם ברמות דילול שלושה או יותר (למשל-, 0-1 pm, מאי 1 ו 22:00 עבור ריכוזים התחלה משוער) כדי להבטיח כימות מדויק. הערה: מידע מפורט על תחל שסופקו ועל סטנדרטים ישתנו בהתבסס על ערכת כימות בשימוש והם זמינים בגליון נתונים טכניים של מוצרים. עיין בטבלה של חומרים עבור ערכת כימות השתמשו במחקר זה.</li>
	<li>להעביר את qPCR בצלחת או צינורות מכשיר PCR בזמן אמת מתוכנת: דנטורציה הראשונית של 95 מעלות צלזיוס למשך 5 דקות; 35 מחזורי 1) 95 ° C עבור s 30 ו 2) 60 מעלות צלזיוס במשך 45-סופרן; צעד דיסוציאציה של 1) 95 ° C 15 s, 2) 60 ° C ל 30 s, ו- 3) 95 ° C 15 s.</li>
	<li>לחשב את הממוצע החל ריכוז עבור כל דגימה, באמצעות הערכים כימות המתקבל התוצאות qPCR ואת רמות הדילול מדגם בשימוש. הערה: לדוגמה, ריכוז ממוצע של 14:00 עבור כוללות מדגם מדולל התשואות של הריכוז ההתחלתי המקורי של 200 ננומטר. אם אף אחת מרמות לדילול דגימה נתון נופל בתוך הטווח של עקומות סטנדרטי, כמת תוצאות וייתכן שלא תהיה מדויקת; בכל מקרה, לכוונן את רמות הדילול ולבצע מחדש qPCR.</li>
	<li>לדלל כל מדגם לבר-קוד מטוהרים, 4 nM במאגר טה, מבוסס על ריכוז ממוצע שחושבו בצעד 7.5. הערה: לדוגמה, ריכוז ממוצע מדגם של 200 ננומטר, שתדללו דוגמה 1:50 ב- TE מאגר להשגת ריכוז 4 nM. ריכוז דגימה מדויקת משתנים בהתאם מערכת רצף וערכת ריאגנט בשימוש. עיין במדריך למשתמש של מערכת רצף עבור הריכוז המומלץ ביותר.</li>
	<li>צור ספריית משולב על-ידי הוספת נפחים שווים (בדרך כלל 5-10 μL) כל הספריות בודדים לתוך צינור יחיד. הערה: כמו כל דוגמאות צריך להיות ב 4 nM ריכוז, הוספת נפחים שווים משיג על ריכוז שווה של כל הדגימות בספריה במאגר.</li>
	<li>חזור על שלבים 6.2-6.4 על הספרייה המשולבת כדי לאשר את הריכוז nM 4.</li>
	<li>לחשב את הריכוז ספריה משולבת ו לדלל או מחדש מהווים גמר, במאגר הספריה באמצעות מאגר טריס לפי הצורך כדי להשיג 4 nM.</li>
	<li>אם לא ממשיכים מיד לתחנת טעינה הדגימה, לאחסן את הדגימות ב-20 ° C. לבצע רצף זמן קצר לאחר כימות כדי למזער את אובדן או שינויים DNA ריכוז במהלך האחסון.</li>
</ol>7. ספריית דנטורציה, דילול, ולבצע רצף לרוץ (באותו יום)
<ol><li>Denature הספרייה 4 nM המשולב משלב 6.9 עם NaOH. הערה: השלבים הכנה ספריית הסופי להשתנות עבור כל מערכת רצף. עיין במדריך למשתמש של מערכת רצף עבור פרוטוקולים יותר מפורט, מעודכן. משתמשים חדשים כדי להתאמן על השימוש של פלטפורמת רצף או לשלוח שלהם ספריות למתקן רצף של הליבה.</li>
	<li>לדלל את הספריה denatured לריכוז הרצוי טעינה באמצעות המאגר המסופק בערכה ריאגנט רצף (טבלה של חומרים). הערה: טעינה אופטימלית ריכוזים משתנים בהתאם מערכת רצף בדרך כלל בטווח שבין 1-250 pM25.</li>
	<li>Denature, לדלל את הפקד רצף. הערה: הוספת פקד רצף מתקנת עבור רצף בעיות הנובעות ספריות המגוון נמוך. Denature הפקד רצף באמצעות NaOH, לדלל את ריכוז זהה כמו הספרייה.</li>
	<li>לשלב את הספריה רצפי הבקרה. הערה: היחס של רצפי בקרה לספריית משולב יהיה תלוי ספריית המגוון ואת מערכת רצף, אבל זה בדרך כלל 1:126.</li>
	<li>לטעון את הספריה משולב ואת רצף התערובת שליטה על רצף זרימה התא.</li>
</ol>8. אמפליקון רצף ניתוח
<ol><li>להעריך את ההצלחה הכוללת של ההפעלה על ידי בחינת המדדים לרוץ על הסביבה מחשוב ענן המתאים למערכת רצף בשימוש. הערה: המדדים לרוץ, כגון מספר הקריאות רצף, ישתנו בהתבסס על רצף פלטפורמה וערכת ריאגנט בשימוש. ערכי יעד עבור מערכות רצף נפוצות מפורטים בטבלה 1.</li>
	<li>הורד את הנתונים הגולמיים רצף של תוכנת קוד-פתוח ביואינפורמטיקה להזמנה כמותית תובנות אקולוגיה מיקרוביאלית (QIIME)27 או Mothur28. הערה: שניהם QIIME Mothur הם פתוח להורדה בחינם. הוראות מפורטות על שימוש בתוכניות אלה ניתן למצוא באינטרנט, מפורטים מספיק עבור משתמשים מתחילים. השלבים שלהלן מספקים סקירה רחבה של צינור ביואינפורמטיקה שנערך QIIME. היכרות עם פיתון לא הכרחי אבל יקל על היישום של קבצי ה-script הבא</li>
	<li>ליצור ולאמת את קובץ מיפוי באמצעות קובץ ה-script "validate_mapping_file.py" ב- QIIME. הערה: הקובץ מיפוי מכיל כל המטה-נתונים הדרושים לביצוע ניתוח נתונים, כולל זיהוי הדגימה, רצפים פריימר אמפליקון ותיאור מדגם. שלב האימות בודק את כל הנתונים הדרושים הוזן בתבנית מתאימה.</li>
	<li>Demultiplex ולסנן רצפים באמצעות script "split_libraries.py" (איור 1). הערה: קובץ script זה מקצה לבר-קוד קריאות דגימות בהתבסס על הצירופים פריימר אינדקס, מזהי מדגם קלט בקובץ המיפוי. היא גם מבצעת מספר איכות סינון צעדים כדי לשלוט על רצף שגיאה מבוסס על-ידי המשתמש גזור-offs ציון איכות מינימלי, רצף אורכי של סוף-זמירה.</li>
	<li>להקצות יחידות מבצעיות בטקסונומיה (אוטוס) רצפים באמצעות קובץ ה-script "pick_open_references_otus.py". הערה: בשלב זה, רצפים מקובצים נגד אוסף רצף הפניה בהתבסס על סף של זהות (בדרך כלל 97%). קורא אשר אינן תואמות את האוסף רצף ההתייחסות מקובצים אחד נגד השני. De novo והפניה סגור OTU איסוף אפשרויות זמינות גם, אבל פתוח-הפניה האיסוף מומלץ על-ידי מפתחים QIIME.</li>
	<li>לנרמל את הטבלה OTU באמצעות לכתיב "alpha_rarefaction.py" או "normalize_table.py". הערה: שלב זה מתקן עבור וריאציה סכומי עמודה, או רצף הכולל הקראה עבור דגימה, הנובעים טכנולוגיות רצף מודרני. נורמליזציה יכול להתבצע באמצעות rarefaction מסורתיים, או באמצעות שיטות אלטרנטיביות כגון שינוי גודל הסכום המצטבר.</li>
	<li>לבצע מספר אלפא-המגוון בטא-המגוון, ניתוחים גיוון בהרכב בטקסונומיה בעת ובעונה אחת באמצעות קובץ ה-script "core_diversity_analysis.py". הערה: לחלופין, ניתוחים אלה ניתן להפעיל בנפרד באמצעות קבצי ה-script בודדים (למשל, "alpha_diversity.py").</li>
</ol>

המחברים אין לחשוף.

רצף הדור הבא של מטוסי אף-16 rRNA להפוך בגישה סטנדרטית לזיהוי חיידקים, התומך חקר כיצד וקטור microbiomes להשפיע על השידור הפתוגן. פרוטוקול שמפורטות כאן פרטים על השימוש בשיטה זו כדי לחקור את מכלול קהילה מיקרוביאלי אני pacificus, זן וקטור עבור מחלת ליים; עם זאת, ניתן בקלות להחיל אותה ללמוד שנתות מינים א...

התחייה של התפשטות מחלות נישאות וקטור בעשורים האחרונים מהווים איום רציני לבריאות האדם וחיות גלובלית. חיסונים יעילים חסרים עבור רוב המחלות האלה, מאמצי הבקרה הם מוגבל בשל האופי ביולוגי המורכב של וקטורים ואינטראקציות וקטור-פונדקאי. להבין את התפקיד של אינטראקציות חיידקים בתוך וקטור הפתוגן בשידור שיכולים לאפשר הפיתוח של אסטרטגיות מקוריות אשר לעקוף האתגרים הללו. בפרט, אינטראקציות בין וקטור-הקשורים commensals מיקרוביאלי, אנחנו חיים איתם בסמביוזה פתוגנים, המכונה של microbiome, עשויות להיות השלכות חשובות לשידור הפתוגן. ראיות רבות עכשיו תומך קביעה זו, עם דוגמאות הדגמת קישור בין וקטור microbiome הקוד עבור מחלות כמו מלריה, Zika וירוס ומחלת ליים1,2,3. עם זאת, לתרגם את הממצאים הללו לאסטרטגיות לבקרת מחלות דורש הבנה הרבה יותר מפורטת של מבנה, תפקוד, מקורם של וקטור microbiomes. זיהוי ואפיון של הקהילה מיקרוביאלי וקטור תחת משתנה תנאים אקולוגיים וניסויים מהווים נתיב חשוב קדימה בתחום זה.
הליך של זיהוי תושבי מיקרוביאלי וקטור הפתוגן מסופק כאן על ידי ניצול המערבי שחור-רגלי השניה, Ixodes pacificus, זן וקטור של המחלה מחלת ליים Borrelia burgdorferi. בעוד קרציות הנמל סוגים נוספים של פתוגנים האנושית מאשר כל פרוקי-רגליים, יחסית מעט מאוד ידוע על האקולוגיה ביולוגיה והקהילה של שנתות microbiomes4. זה מתבטא קרציות הנמל מערך מגוון של וירוסים, חיידקים, פטריות, protozoans, הכוללים commensals, endosymbionts ו-5,תושבים מיקרוביאלי ארעי4. עבודה מוקדמת הוכיחה וריאציות חזקה ב- microbiomes Ixodes המשויך גאוגרפיה, מינים, מין, שלב חיים וארוחת דם מקור6,7,8. עם זאת, המנגנונים וריאציה זו עדיין לא ידועים ומתחייב שמפורט יותר חקירות של המקור והרכבה של קהילות אלה חיידקים. קרציות יכול לרכוש חיידקים באמצעות שידור אנכי, קשר עם מארחים, ספיגת מן הסביבה דרך spiracles, הפה, נקבובית אנאלי9. הבנת הגורמים בעיצוב את היווצרות ראשונית והפיתוח של microbiome שנתות, במיוחד את התרומה היחסית של השידור האנכי וסביבתיים, חשוב להבנת דפוסי הטבעי של וריאציות של שנתות microbiome המגוון ואת האינטראקציה של קהילות אלה במהלך השידור הפתוגן, עם היישומים האפשריים כדי לשלוט במחלה או וקטור.
טכניקות מולקולריות רבי עוצמה, כגון הדור הבא רצפי, כעת קיים לזיהוי קהילות מיקרוביאלי, יכול להיות מועסק כדי לאפיין וקטור microbiomes תחת מגוון תנאים סביבתיים או ניסיוני. לפני כניסתו של גישות אלה רצף תפוקה גבוהה, זיהוי חיידקים הסתמך בעיקר על מיקרוסקופ ותרבות. בעוד מיקרוסקופ היא טכניקה מהירה וקלה, מורפולוגיים שיטות לזיהוי חיידקים הם מטבעם סובייקטיבי, גס, מוגבל על-ידי רגישות נמוכה, זיהוי10. שיטות מבוססות-תרבות נמצאים בשימוש נרחב עבור זיהוי חיידקים והוא יכול לשמש כדי לקבוע את הרגישות של חיידקים סמים טיפולים11. עם זאת, שיטה זו סובל גם רגישות נמוכה, כאשר ההערכה היא כי פחות מ 2% של הסביבה חיידקים יכולים להיות תרבותי במעבדה הגדרת12. גישות מכתימים היסטולוגית יש גם כבר מועסקים לזהות לשפה חיידקים ספציפיים בתוך וקטורים, לאפשר חקירות של הפצות שונות taxa בתוך השניה ושל לימוד היפותזות על אינטראקציות מיקרוביאלי. עם זאת, ידיעה מוקדמת זהות מיקרוביאלי נדרש לבחירת שהכתמים המתאים, ביצוע גישה זו נועד עבור זיהוי ואפיון מיקרוביאלי. יתר על כן, צביעת היסטולוגית הוא תהליך מאוד אינטנסיבית, מייגעת, אינה סקיילבילית טוב עבור מדגמים גדולים. הגישות המסורתיות מולקולרי כגון סנגר רצף מוגבלות באופן דומה שלהם רגישות וזיהוי של קהילות מיקרוביאלי מגוונות.
הדור הבא רצפי מאפשר זיהוי מהיר של חיידקים מן מספר רב של דוגמאות. הנוכחות של גנים הסמן הרגיל ומאפשר התייחסות מסדי נתונים נוספים משופרת ברזולוציה בטקסונומיה, לעיתים קרובות לשלב סוג או מין. יחידת משנה קטנים ribosomal RNAs משמשים לעתים קרובות כדי להשיג מטרה זו, עם 16 rRNA להיות הנפוצה ביותר בשל נוכחותם של אזורים שנשמרת ומשתנה בתוך הגן, המאפשר היצירה של צבעי בסיס אוניברסלי עם amplicons ייחודי עבור כל בקטריאלי מינים13,14. דו ח זה מפרט הליך של זיהוי taxa, microbiome שנתות באמצעות מטוסי אף-16 rRNA הדור הבא רצפי. בפרט, פרוטוקול זה מדגיש את השלבים הכרוכים בהכנת הדגימות רצף. כללית יותר פרטים על הרצף ומסופקים שלבים ביואינפורמטיקה, שכן ישנם מגוון רחב של פלטפורמות רצף ניתוח תוכניות זמין כעת, כל אחד עם קיים תיעוד נרחב. הכדאיות הכוללת של גישה זו הדור הבא רצפי מומחש החלתו על חקירה של הקהילה מיקרוביאלי הרכבה בתוך וקטור מחלת מפתח.

<table><tbody><tr><td>Item</td><td>Name of Material/Equipment</td><td>Company</td><td>Catalog #</td></tr><tr><td>1</td><td>DNeasy Blood &amp;amp; Tissue Kit</td><td>Qiagen</td><td>69504</td></tr><tr><td>2</td><td>Qubit 4 Fluorometer</td><td>ThermoFisher Scientific</td><td>Q3326</td></tr><tr><td>3</td><td>NanoDrop 8000 Spectrophotometer</td><td>ThermoFisher Scientific</td><td>ND-8000-GL</td></tr><tr><td>4</td><td>2x KAPA HiFi HotStart ReadyMix</td><td>Kapa Biosystems</td><td>KK2501</td></tr><tr><td>5</td><td>AMPure XP beads</td><td>Agen Court</td><td>A63880&amp;nbsp;</td></tr><tr><td>6</td><td>Magnetic Rack</td><td>ThermoFisher Scientific</td><td>MR02</td></tr><tr><td>6</td><td>TE buffer</td><td>Teknova</td><td>T0223</td></tr><tr><td>7</td><td>Nextera Index Kit</td><td>Illumina</td><td>FC-121-1011</td></tr><tr><td>8</td><td>KAPA Library Quantification Kit</td><td>Roche</td><td>KK4824</td></tr><tr><td>9</td><td>MiSeq System</td><td>Illumina</td><td>SY-410-1003</td></tr><tr><td>10</td><td>MiSeq Reagent Kit v3&amp;nbsp;</td><td>Illumina</td><td>MS-102-3001</td></tr><tr><td>11</td><td>10 mM Tris-HCl with 0.1% Tween 20</td><td>Teknova</td><td>T7724</td></tr></tbody></table>

tick microbiome characterization by next-generation 16s rrna amplicon sequencing

במהלך העשורים האחרונים, מחלות נישאות וקטור מחדש, מורחב-מדאיגה המחירים, גורם משמעותי התחלואה והתמותה ברחבי העולם. חיסונים נרחב זמין ויעיל חסרים עבור רוב המחלות האלה, המחייב הפיתוח של אסטרטגיות להפחתת הסיכון למחלות הרומן. למטרה זו, שדרה מבטיח שליטה במחלה כולל מיקוד microbiome וקטור, הקהילה של חיידקים המאכלסים את הווקטור. Microbiome וקטור ממלא תפקיד מרכזי ב- dynamics הפתוגן, מניפולציות של microbiome הובילו שידור שפע או פתוגן וקטור מופחתת על קומץ של מחלות נישאות וקטור. עם זאת, לתרגם את הממצאים הללו לתוך המחלה בקרת יישומים דורש הבנה מעמיקה של וקטור אקולוגיה מיקרוביאלית, מבחינה היסטורית מוגבל על-ידי הטכנולוגיה לא מספיק בתחום זה. כניסתו של הדור הבא רצפי גישות אפשרה רצף מהיר, מקבילים ביותר של קהילות שונות מיקרוביאלי. פילוח הגן rRNA והתפאורה מאוד מטוסי אף-16 הנחתה את אפיוני של חיידקים מתנה בתוך וקטורים תחת משתנה תנאים אקולוגיים וניסויים. טכניקה זו כוללת הגברה של הגן rRNA מטוסי אף-16, דוגמת barcoding באמצעות PCR, טעינה בדגימות אל תא זרימה עבור רצף, ואת ביואינפורמטיקה הגישות כדי להתאים את רצף נתונים עם מידע פילוגנטי. מין או סוג ברמת זיהוי עבור מספר גבוה של משכפל יכולה בדרך כלל להיות מושגת באמצעות גישה זו, ובכך לעקוף את האתגרים של זיהוי נמוך, רזולוציית הפלט culturing מסורתיים, מיקרוסקופ או צביעת היסטולוגית טכניקות. לכן, בשיטה זו הוא מתאים היטב אפיון וקטור מיקרובים בתנאים מגוונים אך כעת לא יכול לספק לכם מידע אודות הפונקציה מיקרוביאלי, מיקום בתוך וקטור, או התגובה לטיפול אנטיביוטי. בסך הכל, מטוסי אף-16 הדור הבא רצפי היא טכניקה עוצמה להבנת טוב יותר את הזהות ואת התפקיד של חיידקים וקטור ב dynamics המחלה.

סך של קרציות 42 מביצה נפרדים שלושה מצמדים, שתי תקופות החשיפה הסביבתית, 0 ו- 2 שבועות, באדמת עובדו על רצף microbiome. . קבוצת כל טיפול, נחשבת אחת מצמד וחשיפה זמן, הכיל 6-8 לשכפל דוגמיות שנתות. תמציות שנתות מעובדים אלה העלו ברצף הדור הבא, הניב 12,885,713 קריאות לזווג-end עובר סינון. כלל בהפעלה ...

Watch this Scientific Journal Video about Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing at JoVE.com

Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing

כאן אנו מציגים פרוטוקול הדור הבא רצפי עבור מטוסי אף-16 rRNA רצף המאפשרת זיהוי ואפיון של קהילות חיידקים בתוך וקטורים. שיטה זו כרוכה DNA החילוץ, הגברה, barcoding דגימות באמצעות PCR, רצף תאים זרימה, ביואינפורמטיקה כדי להתאים את רצף נתונים למידע פילוגנטי.

אפיון Microbiome שנתות על-ידי מטוסי אף-16 הדור הבא rRNA אמפליקון רצף

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective ...

tick-microbiome-characterization-next-generation-16s-rrna-amplicon

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

12.7K Views.  San Francisco State University. כאן אנו מציגים פרוטוקול הדור הבא רצפי עבור מטוסי אף-16 rRNA רצף המאפשרת זיהוי ואפיון של קהילות חיידקים בתוך וקטורים. שיטה זו כרוכה DNA החילוץ, הגברה, barcoding דגימות באמצעות PCR, רצף תאים זרימה, ביואינפורמטיקה כדי להתאים את רצף נתונים למידע פילוגנטי.

Video: Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to abiotic stresses and diseases. As the plant microbiome can be highly complex, low-cost, high-throughput methods such as amplicon-based sequencing of the 16S rRNA gene are often preferred for characterizing its microbial composition and diversity. However, the selection of appropriate methodology when conducting such experiments is critical for reducing biases that can make analysis and comparisons between samples and studies difficult. This protocol describes in detail a standardized methodology for the collection and extraction of DNA from soil, rhizosphere, and root samples. Additionally, we highlight a well-established 16S rRNA amplicon sequencing pipeline that allows for the exploration of the composition of bacterial communities in these samples, and can easily be adapted for other marker genes. This pipeline has been validated for a variety of plant species, including sorghum, maize, wheat, strawberry, and agave, and can help overcome issues associated with the contamination from plant organelles.

Here, we describe a protocol to obtain amplicon sequence data of soil, rhizosphere, and root endosphere microbiomes. This information can be used to investigate the composition and diversity of plant-associated microbial communities, and is suitable for the use with a wide range of plant species.

לחקור את השורש Microbiome: שליפת נתונים הקהילה חיידקי מן האדמה, Rhizosphere, Endosphere שורש

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...

Genetics

A Method for Targeted 16S Sequencing of Human Milk Samples

Studies of microbial communities have become widespread with the development of relatively inexpensive, rapid, and high throughput sequencing. However, as with all these technologies, reproducible results depend on a laboratory workflow that incorporates appropriate precautions and controls. This is particularly important with low-biomass samples where contaminating bacterial DNA can generate misleading results. This article details a semi-automated workflow to identify microbes from human breast milk samples using targeted sequencing of the 16S ribosomal RNA (rRNA) V4 region on a low- to mid-throughput scale. The protocol describes sample preparation from whole milk including: sample lysis, nucleic acid extraction, amplification of the V4 region of the 16S rRNA gene, and library preparation with quality control measures. Importantly, the protocol and discussion consider issues that are salient to the preparation and analysis of low-biomass samples including appropriate positive and negative controls, PCR inhibitor removal, sample contamination by environmental, reagent, or experimental sources, and experimental best practices designed to ensure reproducibility. While the protocol as described is specific to human milk samples, it is adaptable to numerous low- and high-biomass sample types, including samples collected on swabs, frozen neat, or stabilized in a preservation buffer.

A semi-automated workflow is presented for targeted sequencing of 16S rRNA from human milk and other low-biomass sample types.

שיטה של מטוסי אף-16 יישוב רצף של דגימות חלב

Studies of microbial communities have become widespread with the development of relatively inexpensive, rapid, and high throughput sequencing. However, as ...

Immunology and Infection

Fluorescence-microscopy Screening and Next-generation Sequencing: Useful Tools for the Identification of Genes Involved in Organelle Integrity

This protocol describes a fluorescence microscope-based screening of Arabidopsis seedlings and describes how to map recessive mutations that alter the subcellular distribution of a specific tagged fluorescent marker in the secretory pathway. Arabidopsis is a powerful biological model for genetic studies because of its genome size, generation time, and conservation of molecular mechanisms among kingdoms. The array genotyping as an approach to map the mutation in alternative to the traditional method based on molecular markers is advantageous because it is relatively faster and may allow the mapping of several mutants in a really short time frame. This method allows the identification of proteins that can influence the integrity of any organelle in plants. Here, as an example, we propose a screen to map genes important for the integrity of the endoplasmic reticulum (ER). Our approach, however, can be easily extended to other plant cell organelles (for example see1,2), and thus represents an important step toward understanding the molecular basis governing other subcellular structures.

A fundamental quest in cell biology is to define the mechanisms that underlie the identity of the organelles that make eukaryotic cells. Here we propose a method to identify the genes responsible for the morphological and functional integrity of plant organelles using fluorescence microscopy and next-generation sequencing tools.

פלואורסצנטי, מיקרוסקופ הקרנת ואת הדור הבא הרצף: כלים שימושיים לזיהוי גנים המעורבים אברון Integrity

This protocol describes a fluorescence microscope-based screening of Arabidopsis seedlings and describes how to map recessive mutations that alter the ...

Next-generation Sequencing of 16S Ribosomal RNA Gene Amplicons

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the long-lasting gold standards is to sequence 16S ribosomal RNA (rRNA) gene amplicons generated by domain-level PCR reactions amplifying from genomic DNA. Traditionally, this was performed by cloning and Sanger (capillary electrophoresis) sequencing of PCR amplicons. The advent of next-generation sequencing has tremendously simplified and increased the sequencing depth for 16S rRNA gene sequencing. The introduction of benchtop sequencers now allows small labs to perform their 16S rRNA sequencing in-house in a matter of days. Here, an approach for 16S rRNA gene amplicon sequencing using a benchtop next-generation sequencer is detailed. The environmental DNA is first amplified by PCR using primers that contain sequencing adapters and barcodes. They are then coupled to spherical particles via emulsion PCR. The particles are loaded on a disposable chip and the chip is inserted in the sequencing machine after which the sequencing is performed. The sequences are retrieved in fastq format, filtered and the barcodes are used to establish the sample membership of the reads. The filtered and binned reads are then further analyzed using publically available tools. An example analysis where the reads were classified with a taxonomy-finding algorithm within the software package Mothur is given. The method outlined here is simple, inexpensive and straightforward and should help smaller labs to take advantage from the ongoing genomic revolution.

Characterizing microbial community has been a longstanding goal in environmental microbiology. Next-generation sequencing methods now allow for the characterization of microbial communities at an unprecedented depth with minimal cost and labor. We detail here our approach to sequence bacterial 16S ribosomal RNA genes using a benchtop sequencer.

רצף של הדור הבא של 16S ריבוזומלי amplicons ג&#39;ין RNA

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the ...

Targeted DNA Methylation Analysis by Next-generation Sequencing

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of particular interest for epigenetic studies as it has been demonstrated to be both a long lasting and a dynamic regulator of gene expression. Efforts to examine epigenetic changes in health and disease have been hindered by the lack of high-throughput, quantitatively accurate methods. With the advent and popularization of next-generation sequencing (NGS) technologies, these tools are now being applied to epigenomics in addition to existing genomic and transcriptomic methodologies. For epigenetic investigations of cytosine methylation where regions of interest, such as specific gene promoters or CpG islands, have been identified and there is a need to examine significant numbers of samples with high quantitative accuracy, we have developed a method called Bisulfite Amplicon Sequencing (BSAS). This method combines bisulfite conversion with targeted amplification of regions of interest, transposome-mediated library construction and benchtop NGS. BSAS offers a rapid and efficient method for analysis of up to 10 kb of targeted regions in up to 96 samples at a time that can be performed by most research groups with basic molecular biology skills. The results provide absolute quantitation of cytosine methylation with base specificity. BSAS can be applied to any genomic region from any DNA source. This method is useful for hypothesis testing studies of target regions of interest as well as confirmation of regions identified in genome-wide methylation analyses such as whole genome bisulfite sequencing, reduced representation bisulfite sequencing, and methylated DNA immunoprecipitation sequencing.

Bisulfite amplicon sequencing (BSAS) is a method for quantifying cytosine methylation in targeted genomic regions of interest. This method uses bisulfite conversion paired with PCR amplification of target regions prior to next-generation sequencing to produce absolute quantitation of DNA methylation at a base-specific level.

ממוקד DNA מתילציה ניתוח על ידי רצף של הדור הבא

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of diverse libraries of retroviral integration sites using ligation-mediated PCR (LM-PCR) amplification and next-generation sequencing (NGS), (2) mapping the genomic location of each virus-host junction using BEDTools, and (3) analyzing the data for statistical relevance. Genomic DNA extracted from infected cells is fragmented by digestion with restriction enzymes or by sonication. After suitable DNA end-repair, double-stranded linkers are ligated onto the DNA ends, and semi-nested PCR is conducted using primers complementary to both the long terminal repeat (LTR) end of the virus and the ligated linker DNA. The PCR primers carry sequences required for DNA clustering during NGS, negating the requirement for separate adapter ligation. Quality control (QC) is conducted to assess DNA fragment size distribution and adapter DNA incorporation prior to NGS. Sequence output files are filtered for LTR-containing reads, and the sequences defining the LTR and the linker are cropped away. Trimmed host cell sequences are mapped to a reference genome using BLAT and are filtered for minimally 97% identity to a unique point in the reference genome. Unique integration sites are scrutinized for adjacent nucleotide (nt) sequence and distribution relative to various genomic features. Using this protocol, integration site libraries of high complexity can be constructed from genomic DNA in three days. The entire protocol that encompasses exogenous viral infection of susceptible tissue culture cells to integration site analysis can therefore be conducted in approximately one to two weeks. Recent applications of this technology pertain to longitudinal analysis of integration sites from HIV-infected patients.

We describe a protocol for amplifying retroviral integration sites from the genomic DNA of infected cells, sequencing the amplified virus-host junctions, and then mapping these sequences to a reference genome. We also describe techniques to quantify the distribution of integration sites relative to various genomic annotations using BEDTools.

הגברה, רצף הדור הבא, ואת הגנום מיפוי ה- DNA של אתרי אינטגרצית retroviral

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...

Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information.

We describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs for characterization of bacterial communities using 16S rRNA gene amplicon sequencing. The method allows for a common processing approach for multiple sample types and accommodates a number of downstream analytic processes.

הפקת חומצות גרעין יעיל 16S rRNA ג&#39;ין רצף עבור בקטריאלי קהילת אפיון

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing ...

Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing

The human intestinal microbiome plays a central role in protecting cells from injury, in processing energy and nutrients, and in promoting immunity. Deviations from what is considered a healthy microbiota composition (dysbiosis) may impair vital functions leading to pathologic conditions. Recent and ongoing research efforts have been directed toward the characterization of associations between microbial composition and human health and disease.
Advances in high-throughput sequencing technologies enable characterization of the gut microbial composition. These methods include 16S rRNA-amplicon sequencing and shotgun sequencing. 16S rRNA-amplicon sequencing is used to profile taxonomical composition, while shotgun sequencing provides additional information about gene predictions and functional annotation. An advantage in using a targeted sequencing method of the 16S rRNA gene variable region is its substantially lower cost compared to shotgun sequencing. Sequence differences in the 16S rRNA gene are used as a microbial fingerprint to identify and quantify different taxa within an individual sample.
Major international efforts have enlisted standards for 16S rRNA-amplicon sequencing. However, several studies report a common source of variation caused by batch effect. To minimize this effect, uniformed protocols for sample collection, processing, and sequencing must be implemented. This protocol proposes the integration of broadly used protocols starting from fecal sample collection to data analyses. This protocol includes a column-free, direct-PCR approach that enables simultaneous handling and DNA extraction of large numbers of fecal samples, along with PCR amplification of the V4 region. In addition, the protocol describes the analysis pipeline and provides a script using the latest version of QIIME (QIIME 2 version 2017.7.0 and DADA2). This step-by-step protocol is aimed to guide those interested in initiating the use of 16S rRNA-amplicon sequencing in a robust, reproductive, easy to use, detailed way.

This manuscript describes a detailed standardized protocol of high-throughput 16S rRNA-amplicon sequencing. The protocol introduces an integrated, uniformed, feasible, and inexpensive protocol starting from fecal sample collection through data analyses. This protocol enables analysis of large numbers of samples with rigorous standards and several controls.

פרוטוקול מודרך לקבלת צואה אפיון חיידקים על ידי מטוסי אף-16 rRNA-אמפליקון רצף

The human intestinal microbiome plays a central role in protecting cells from injury, in processing energy and nutrients, and in promoting immunity. ...

Microbiota Analysis Using Two-step PCR and Next-generation 16S rRNA Gene Sequencing

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the immune system. Perturbation of the healthy gut microbiome has been suggested to play a role in the development of inflammatory diseases, including multiple sclerosis (MS). Environmental and genetic factors can influence the composition of the microbiome; therefore, identification of microbial communities linked with a disease phenotype has become the first step towards defining the microbiome&#8217;s role in health and disease. Use of 16S rRNA metagenomic sequencing for profiling bacterial community has helped in advancing microbiome research. Despite its wide use, there is no uniform protocol for 16S rRNA-based taxonomic profiling analysis. Another limitation is the low resolution of taxonomic assignment due to technical difficulties such as smaller sequencing reads, as well as use of only forward (R1) reads in the final analysis due to low quality of reverse (R2) reads. There is need for a simplified method with high resolution to characterize bacterial diversity in a given biospecimen. Advancements in sequencing technology with the ability to sequence longer reads at high resolution have helped to overcome some of these challenges. Present sequencing technology combined with a publicly available metagenomic analysis pipeline such as R-based Divisive Amplicon Denoising Algorithm-2 (DADA2) has helped advance microbial profiling at high resolution, as DADA2 can assign sequence at the genus and species levels. Described here is a guide for performing bacterial profiling using two-step amplification of the V3-V4 region of the 16S rRNA gene, followed by analysis using freely available analysis tools (i.e., DADA2, Phyloseq, and METAGENassist). It is believed that this simple and complete workflow will serve as an excellent tool for researchers interested in performing microbiome profiling studies.

Described here is a simplified standard operating procedure for microbiome profiling using 16S rRNA metagenomic sequencing and analysis using freely available tools. This protocol will help researchers who are new to the microbiome field as well as those requiring updates on methods to achieve bacterial profiling at a higher resolution.

אנליזה microbiota באמצעות שני שלבים PCR ו-הדור הבא של 16 rRNA גן רצף

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the ...

16S rRNA Sequencing: A PCR-based Technique to Identify Bacterial Species

Source: Ewa Bukowska-Faniband1, Tilde Andersson1, Rolf Lood1 
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, Lund University, 221 00 Lund, Sweden
Planet Earth is a habitat for millions of bacterial species, each of which has specific characteristics. Identification of bacterial species is widely used in microbial ecology to determine biodiversity of environmental samples and medical microbiology to diagnose infected patients. Bacteria can be classified using conventional microbiology methods, such as microscopy, growth on specific media, biochemical and serological tests, and antibiotic sensitivity assays. In recent decades, molecular microbiology methods have revolutionized bacterial identification. A popular method is 16S ribosomal RNA (rRNA) gene sequencing. This method is not only faster and more accurate than conventional methods, but also allows identification of strains that are difficult to grow in laboratory conditions. Furthermore, differentiation of strains at the molecular level enables discrimination between phenotypically identical bacteria (1-4).
16S rRNA joins with a complex of 19 proteins to form a 30S subunit of the bacterial ribosome (5). It is encoded by the 16S rRNA gene, which is present and highly conserved in all bacteria due to its essential function in ribosome assembly; however, it also contains variable regions which may serve as fingerprints for particular species. These features have made the 16S rRNA gene an ideal genetic fragment to be used in identification, comparison, and phylogenetic classification of bacteria (6).
16S rRNA gene sequencing is based on the polymerase chain reaction (PCR) (7-8) followed by DNA sequencing (9). PCR is a molecular biology method used to amplify specific fragments of DNA through a series of cycles that include:
i) Denaturation of a double stranded DNA template 
ii) Annealing of primers (short oligonucleotides) that are complementary to the template 
iii) Extension of primers by the DNA polymerase enzyme, which synthesizes a new DNA strand
A schematic overview of the method is shown in Figure 1.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10510/10510fig1.jpg" /> 
Figure 1: Schematic overview of the PCR reaction. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/10510/10510fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
There are several factors that are important for a successful PCR reaction, one of which is quality of the DNA template. Isolation of chromosomal DNA from bacteria can be performed using standard protocols or commercial kits. Special care should be taken to obtain DNA that is free of contaminants that can inhibit the PCR reaction.
Conserved regions of the 16S rRNA gene permit the design of universal primer pairs (one forward and one reverse) that can bind to and amplify the target region in any bacterial species. The target region can vary in size. While some primer pairs can amplify most of the 16S rRNA gene, others amplify only parts of it. Examples of commonly used primers are shown in Table 1 and their binding sites are depicted in Figure 2.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer name</td>
			<td>Sequence (5&#39;&#8594;3&#39;)</td>
			<td>Forward/ reverse</td>
			<td>Reference</td>
		</tr>
		<tr>
			<td>8F b)</td>
			<td>AGAGTTTGATCCTGGCTCAG</td>
			<td>forward</td>
			<td>-1</td>
		</tr>
		<tr>
			<td>27F</td>
			<td>AGAGTTTGATCMTGGCTCAG</td>
			<td>forward</td>
			<td>-10</td>
		</tr>
		<tr>
			<td>515F</td>
			<td>GTGCCAGCMGCCGCGGTAA</td>
			<td>forward</td>
			<td>-11</td>
		</tr>
		<tr>
			<td>911R</td>
			<td>GCCCCCGTCAATTCMTTTGA</td>
			<td>reverse</td>
			<td>-12</td>
		</tr>
		<tr>
			<td>1391R</td>
			<td>GACGGGCGGTGTGTRCA</td>
			<td>reverse</td>
			<td>-11</td>
		</tr>
		<tr>
			<td>1492R</td>
			<td>GGTTACCTTGTTACGACTT</td>
			<td>reverse</td>
			<td>-11</td>
		</tr>
	</tbody>
</table>
Table 1: Examples of standard oligonucleotides used in amplification of 16S rRNA genes a). 
a) The expected lengths of the PCR product generated using the different primer combinations can be estimated by calculating the distance between the binding sites for the forward and the reverse primer (see Figure 2), e.g. the size of the PCR product using primer pair 8F-1492R is ~1500 bp, and for primer pair 27F-911R ~900 bp. 
b) also known as fD1
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10510/10510fig2.jpg" /> 
Figure 2: Representative figure of the 16S rRNA sequence and the primer-binding sites. Conserved regions are colored in grey and variable regions are filled with diagonal lines. To allow for the highest resolution, primer 8F and 1492R (name based on location on rRNA sequence) are used to amplify the whole sequence, allowing for the sequencing of several variable regions of the gene. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/10510/10510fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Cycling conditions for PCR (i.e. the temperature and time required for the DNA to be denatured, annealed with primers, and synthesized) are dependent on the type of polymerase that is used and the properties of the primers. It is recommended to follow the manufacturer&#39;s guidelines for a particular polymerase.
After the PCR program is completed, the products are analyzed by agarose gel electrophoresis. A successful PCR yields a single band of expected size. The product must be purified prior to sequencing to remove residual primers, deoxyribonucleotides, polymerase, and buffer which were present in the PCR reaction. The purified DNA fragments are usually sent for sequencing to commercial sequencing services; however, some institutions perform DNA sequencing at their own core facilities.
The DNA sequence is automatically generated from a DNA chromatogram by a computer and must be carefully checked for quality, as manual editing is sometimes needed. Following this step, the gene sequence is compared with sequences deposited in the 16S rRNA database. The regions of similarity are identified, and the most similar sequences are delivered.

16S rRNA Sequencing: Identifying Bacterial Species by PCR

ריצוף rRNA 16S: טכניקה מבוססת PCR לזיהוי מינים חיידקיים

Source: Ewa Bukowska-Faniband1, Tilde Andersson1, Rolf Lood1
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, ...

אפיון Microbiome שנתות על-ידי מטוסי אף-16 הדור הבא rRNA אמפליקון רצף

Summary

Explore More Videos

Chapters in this video