עבודה זו נתמכה על ידי גרנט זרע מוח קרן המחקר (BRFSG-2014-02) להלן Bateup. דירק Hockemeyer הוא חדש Scholar בהזדקנות של הקרן הרפואית אליסון ונתמך על ידי קרן גלן כמו גם Shurl וקיי קורצ&#39;י הקרן. DH נתמך גם על ידי NIH 1R01CA196884-01.

המחברים מצהירים שום אינטרסים כלכליים מתחרים.

השיטה המוצגת כאן לבידוד אוכלוסיות הומוגניות של תאי pluripotent אדם בעריכת גן הגזע היא גישה רבת עוצמה ליצירת קווי hPSC isogenic השונה רק במוקד הממוקד. תאים אלה הם מערכת אידיאלית לחיטוט מנגנוני התמיינות תאים אנושי ופיתוח, כמו גם להבנת הפתופיזיולוגיה של מחלות monogenic בהגדרה גנטית בשליטה. כפי שהודגם כאן, אפשר להשתמש בשלוש אסטרטגיות עיצוב SSN עצמאיות (ZFNs, TALENs, וCRISPR / Cas9) כדי להשיג אינטגרציה ממוקדת במוקד AAVS1. לכל אחד משיטות אלו יתרונות משלה וחסרונות. יתרון פוטנציאלי של ZFNs ו, במידה מסוימת, TALENs הוא הגמישות בעיצוב שלהם, המאפשר הנדסת איטרטיבי כדי לשפר את ה- DNA מחייב תחומים של nucleases פרט 42. אופטימיזציה nuclease זה יכול להגדיל את הספציפיות של ZFNs וTALENs מעבר למה שהוא בר השגה עם CRIמערכת SPR / Cas9. סלקטיביות כזו עשויה להיות חשובה עבור יישומים קליניים הדורשים רמה גבוהה של היעד ספציפי. היתרון העיקרי של המערכת / Cas9 CRISPR הוא קלות שימוש. למרות ערכות בניית Talen וZFN נעשו זמינות לציבור (כלומר, דרך Addgene 21), CRISPR SSNs / מבוסס Cas9 קל יותר באופן משמעותי לבנייה, כהתאמה ההכרחית היחידה הוא oligonucleotide זוג 20 בסיס (בעת השימוש בפלסמיד px330 עיצוב 14). פשטות זה מוכיחה להיות יתרון עבור מעבדות מחקר מחפשים כולל עריכת הגנום בלימודיהם. קיימות טכניקות transfection חלופיות, כוללים nucleofection 43, כדי ליצור קווי hPSC-גן בעריכה; עם זאת electroporation הוכח להיות יעילים 4,5,25 עקביים ועלות. Nucleofection יכול לשמש כדי transfect ישירות מתחמי ribonucleoprotein RNA Cas9-מדריך לגרעין, הגדלת יעילות SSNנאמנות ד 44. גידול hPSCs על MEFs הוא שיטה חזקה ולא יקרה כדי לשמור על hPSCs במדינת pluripotent ללא הבחנה מוגזמת. בנוסף, היא מאפשרת לבידוד קל של מושבות זהות מבחינה גנטית. לחלופין, ניתן hPSCs התרבות ללא MEFs, אולם תנאי התרבות אלה יכולים להיות יקרים יותר מתרבויות מבוססות מזין. יתר על כן, כל התהליך הוא מדרגי, המאפשר לבידוד של אירועי עריכה מאוד נדירים או הדור של שורות תאים שונות רבות בניסויי עריכה מקבילים. הפרוטוקול המתואר כאן הוא חזק; עם זאת יש כמה שלבים עיקריים המשפיעים על היעילות שבה ניתן להשיג שיבוטים נערכו כראוי. המרכיב הקריטי ביותר לשיטה זו הוא שיש MEFs באיכות גבוהה וMEFs DR4 עמיד סמים. ההישרדות של hPSCs היחיד היא קלושה, וMEFs באיכות נמוכה יהיה לעכב את הבידוד של קווי hPSC מובחנים. שנית, השימוש של Y-27632 הוא גםמפתח להישרדות לאפשר תא בודד מבלי ליצור לחץ סלקטיבי לתאים עם קריוטיפ לא נורמלי 45. שלישית, לקטוף מושבות היטב במרווחים מבטיח הומוגניות גנטית של שורות תאים נגזרו. לבסוף, חשוב להכין טפטפות זכוכית, כך שהפתיחה היא קטנה מספיק כדי לשבור את המושבה לרבות חתיכות קטנות יותר, להבטיח כי מושבות מרובות תגדל בבאר החדשה. זה מאפשר הקטיף של subclones היטב במרווחים לצלחת העתק שיש בתרבות, שעזבה את הצלחת המקורית של מושבות מבודדות לgenotyping. חלק מאתגר בפרוטוקול זה הוא המדריך למשייכת טפטפות הזכוכית; זה צריך להיות מתורגל מראש. יש לציין שישנן טכניקות רבות של קטיף שיבוט שאינו דורשות פיפטה זכוכית. הנסיינים מוזמנים למצוא אחד שעובד הכי טוב בשבילם. יש מגבלות לפרוטוקול זה, שניתן להתגבר על ידי שינויים פשוטים. ניסוי נועד only לשבש את המוקד של עניין ללא תיקון או אחד תיקון שתבנית אינו מכיל קלטת בחירה, חייב להשתמש בשיטה אחרת של העשרה לתאים שנערכו. שים לב שמספר מושבות שחייבות להיות נטלו למצוא שיבוט חיובי מגביר באופן משמעותי בהיעדר הבחירה. אסטרטגיה אחת כדי לשפר את היעילות היא לשתף transfect פלסמיד שאינו שילוב שמבטא חלבון פלואורסצנטי. לאחר מאפשר לתאים להתאושש במשך יומיים, ניתן למיין תאים ממוקדים על הקרינה חיובית באמצעות מיון תא הקרינה המופעל וreplated 29. תהליך זה מעשיר את תאים שכבר transfected עם פלסמידים ידי electroporation ובכך מגדיל את ההסתברות לאירוע עריכה במקביל בתא. הטכניקות המתוארות כאן ניתן להרחיב להשתמש RNAs מדריך מרובה למקד כמה 14,46,47 לוקוסים בו זמנית. פרוטוקולים רבים הוקמו כדי לבדל hPSCsלסוגים שונים של תאים, ומאפשר מניפולציות גנטיות שונות בסוגי תאים של עניין 30. בסך הכל, יש לנו הפגנו הפוטנציאל לעריכת הגנום יעיל בhPSCs ללא קשר לבחירת SSN. אנו מציעים כי טכניקה זו יכולה להיות מותאמת ליצירת קווי hPSC isogenic שנערכו-גן בכל מוקד הגנומי.

טכנולוגיות עריכת הגנום במהירות מתפתחות לכלים סטנדרטיים לביולוגיה מולקולרית של תא 1. הנדסה גנטית של תאים האנושיים pluripotent גזע (hPSCs) היא עניין מיוחד כhPSCs מהווה מקור עצמי חידוש של תאים אנושיים עיקריים הגנטית בשלמותה. יכול להיות מובחן hPSCs לסוגי תאים שונים למידול מחלה או כמקור לטיפולי השתלה 2,3. הפגין כאן הוא פרוטוקול שמנצל שלושה סוגים שונים של nucleases אתר ספציפי (SSNs) בשיתוף עם מנגנוני תיקון DNA אנדוגני לשילוב ממוקד של מבנה כתב במוקד AAVS1. לאחר transfection של SSNs לhPSCs, אנו מדגימים כיצד לבודד אוכלוסיות תאי isogenic מחסה הכתב. היכולת לתפעל את הגנום, במיוחד pluripotent גזע הגנום של תאים, SSNs באמצעות אינה תופעה חדשה ככלי של nucleases אצבע אבץ (ZFNs) וactivat השעתוקnucleases כמו-או מפעיל (TALENs) לעריכת גן הודגם לפני כמה שנות 4-10. עם זאת, עם כניסתו של CRISPR pyogenes ס / טכנולוגית Cas9 11-13, עריכת הגן הפכה לנגישה 14 נרחב. כל SSNs להציג הפסקת DNA גדילים כפולה (DSB) באתר היעד שצוין 1,4,5,11 שתוקן על ידי מנגנונים תאיים אנדוגני או באמצעות תיקון שאינו הומולוגי (NHEJ) מכוון שהצטרף סוף או הומולוגיה (HDR) 15. NHEJ הוא מועדת לטעויות ויכול להציג את מוטציות שינוי מסגרת ותוצאה הוא אובדן של תפקוד גן, בעוד HDR מאפשר להיות הציגו אלמנטי רומן דרך שיתוף transfection של תבנית תיקון עם SSN. בעוד עקרונות היסוד של תיקון DNA המאפשרים עריכת גן נחשבים במידה רבה את אותו הדבר עבור כל SSN, כמה הבדלים בין הפלטפורמות ניתן לציין. דה נובו עיצוב של ZFNs מאפשר גמישות וnuclease אופטימיזציה 16, עם זאת שימוש בבפומביספריות זמינות הרכבה וכלים הקרנה לעצב ZFNs פרט יכולים להיות זמן רב. ברגע שהמוקד הרצוי למיקוד בתיווך ZFN נקבע, יכולים להיות מתוכננים זוגות ZFN עם הכלי המקוון ZiFit 17. לאחר עיצוב, ZFNs ניתן להרכיב באופן מודולארי דרך כמה סיבובים של שיבוט פלסמיד 18. לחלופין, יש ZFNs רב זמין מסחרי,-תוקף לפני 19. nucleases האגדה גם יכול להיות מתוכנן תוך שימוש בכלים מקוונים ורכיבים זמינים בפומבי 17,20. לדוגמא, TALENs ניתן להרכיב במהירות מלוקים של חמש חזרות סיפור, דרך ההרכבה FLASH 21 או באמצעות PCR הרכבה שער זהב היררכי מבוסס 22. קלות עיצוב SSN ומהירות של הבנייה באמצעות CRISPR / Cas9 עשו הגנום עריכת כלי נגיש לציבור רחב. המיקוד בתיווך RNA מדריך הקצר של CRISPR / Cas9 גם מאפשר ריבוב של RNAs המדריך למקד כמה לוקוסים עם מבנה יחיד 14. העיצובשל Cas9 לעריכת גן דורש רק זיהוי של מוטיב protospacer סמוך (PAM; trinucleotide NGG לס pyrogenes Cas9) הפרוקסימלי למוקד היעד. על ידי הוספת oligonucleotide המתאים עד 20 הזוגות הבסיסים 5 &#39;של PAM לפלסמיד px330 14, המבנה ניתן להרכיב בצעד שיבוט אחד. בנוסף לס pyogenes Cas9, Cas9 מנ meningitidis (NmCas9) שמכיר 5&#39;-NNNNGATT-3 &quot;(PAM) הוכח כדי לאפשר לגן-עריכה יעילה בhPSCs 23. בנוסף להבדלים בקלות עיצוב SSN, לכל פלטפורמה מאפיינים ספציפיים. לדוגמא, ZFNs וTALENs לנצל תחום nuclease FokI, אשר מייצר 5 הסככה ארבעה נוקליאוטידים &#39;24 בזמן שהוא חשב Cas9 לייצר בעיקר להקהות DSBs הסתיימה. ZFNs, TALENs, וCas9 שונה בstabilities החלבון שלהם, שיעור ב- off על DNA היעד, ומצב של סריקת ה- DNA, שכולן גולד באופן תיאורטי לגרום להבדלים קטנים בתוצאת 1 העריכה. בעוד שמחקרים נוספים יידרשו כדי להבין את ההשלכות של הבדלים אלה, אנו מתארים כאן פרוטוקול כי הוא חזק מאוד בכל שלוש פלטפורמות וניתן להשתמש בו כדי ליצור בקלות hPSCs המהונדסת גנטי. ללא קשר לבחירת SSN, electroporation הוא הליך חזק כדי transfect SSNs ותבניות תיקון ההומולוגיה לhPSCs 25. מספר שרד מושבות לאחר בחירה לעמידות לאנטיביוטיקה תלויה בפרמטרי מוקד ספציפי ואסטרטגית העריכה (למשל, גודל של הכנס ומצב של בחירה מהונדס). הפרוטוקול המתואר כאן בדרך כלל תוצאות בכ 150-400 מושבות תא בודד נגזרות. במוקד AAVS1 באמצעות פרוטוקול זה עריכה-הגן כבר בעבר בשימוש כדי להדגים את היעילות של SSNs 4,5. תבנית תיקון AAV-CAGGS-EGFP משתמשת str מלכודת גןategy להקנות עמידות לpuromycin באופן ספציפי מוקד. בקצרה, תבנית התיקון מכילה אתר acceptor אחוי במעלה הזרם של קלטת התנגדות puromycin promoterless. עם שילוב נכון לאינטרון הראשון של גן PPP1R12C במוקד AAVS1, קלטת ההתנגדות באה לידי ביטוי מאמרגנו של הגן בעריכה. החוסן של assay AAVS1 הספציפי הזה מאפשר לנו להשוות את היעילות של כל פלטפורמת SSN. עריכת גן באמצעות SSNs היא חזקה נתנה את היכולת לשבש ו / או לשנות באופן תיאורטי כל גן. יישום אסטרטגיה זו לhPSCs מספק צדדיות כhPSCs יכול להיות מובחן בהמשך למספר רב של סוגי תאים אנושיים כגון נוירונים 26, hepatocytes 27, ושריר לב 28. בנוסף, השימוש בתאי גזע pluripotent מושרה נגזר מטופל מאפשר תיקון או הקדמה של מוטציות הגורמות למחלות ידועות ברקע גנטי מטופל ספציפי 29 </sup&gt;, מספק פלטפורמה שממנו ניתן לחקור מנגנוני מחלה ותרופות מבחן שימוש בתאים של חולה 30. לסיכום, עריכת הגן בhPSCs היא גישה יעילה ותכליתית לחקירת הביולוגיה הבסיסית של פיתוח ומחלה 31 בני אדם.

<table><tbody><tr><td>DMEM/F12</td><td>Life Technologies</td><td>11320082</td><td></td></tr><tr><td>Fetal Bovine Serum (HI)</td><td>Life Technologies</td><td>10082-147</td><td></td></tr><tr><td>Knockout Serum</td><td>Life Technologies</td><td>10828-028</td><td></td></tr><tr><td>Fibroblast Growth Factor - basic</td><td>Life Technologies</td><td>PHG0261</td><td></td></tr><tr><td>Pen/Strep</td><td>Life Technologies</td><td>15140-122</td><td></td></tr><tr><td>Glutamine</td><td>Life Technologies</td><td>25030-081</td><td></td></tr><tr><td>MEM NEAA</td><td>Life Technologies</td><td>11140-050</td><td></td></tr><tr><td>2-mercaptoethanol</td><td>Life Technologies</td><td>21985-023</td><td></td></tr><tr><td>Y-27632</td><td>Calbiochem</td><td>688000</td><td></td></tr><tr><td>6-well plates</td><td>Corning</td><td>3506</td><td></td></tr><tr><td>12-well plates</td><td>Corning</td><td>3512</td><td></td></tr><tr><td>4 mm Electroporation cuvettes</td><td>Bio-rad</td><td>165-2081</td><td></td></tr><tr><td>X-cel gene pulser II</td><td>Bio-rad</td><td>165-2661</td><td></td></tr><tr><td>0.25% Trypsin-EDTA</td><td>Life Technologies</td><td>25200-056</td><td></td></tr><tr><td>10&amp;times; Phosphate buffered saline (PBS) pH7.4&amp;nbsp;</td><td>Life Technologies</td><td>70011-044</td><td></td></tr><tr><td>Puromycin</td><td>Life Technologies</td><td>A11138-02</td><td></td></tr><tr><td>Pasteur pipettes, plugged</td><td>VWR</td><td>14672-412</td><td></td></tr><tr><td>Tris-HCl</td><td>Sigma-Aldrich</td><td>S5941</td><td></td></tr><tr><td>NaCl</td><td>Sigma-Aldrich</td><td>S9888</td><td></td></tr><tr><td>SDS</td><td>Sigma-Aldrich</td><td>L3771</td><td></td></tr><tr><td>EDTA</td><td>Sigma-Aldrich</td><td>E5134</td><td></td></tr><tr><td>Proteinase-K</td><td>Life Technologies</td><td>AM2544</td><td></td></tr><tr><td>Ethanol</td><td>VWR</td><td>TX89125-172SFU</td><td></td></tr><tr><td>Isopropyl Alcohol</td><td>VWR</td><td>MK303216</td><td></td></tr><tr><td>TE Buffer</td><td>Life Technologies</td><td>12090-015</td><td></td></tr><tr><td>Dimethyl Sulfoxide (DMSO)</td><td>Sigma-Aldrich</td><td>D8418</td><td></td></tr><tr><td>1.8 ml Cryotubes</td><td>ThermoScientific</td><td>377267</td><td></td></tr></tbody></table>

establishment of genome-edited human pluripotent stem cell lines: from targeting to isolation

הגנום עריכה של תאי גזע אנושיים pluripotent (hPSCs) מספקת פלטפורמה גנטית מבוקרת ורלוונטית מבחינה קלינית שממנו ניתן להבין את התפתחות אדם ולחקור את הפתופיזיולוגיה של מחלה. על ידי שימוש בnucleases אתר ספציפי (SSNs) לעריכת הגנום, הגזירה המהירה של קווים החדשים hPSC מחסה שינויים גנטיים ספציפיים בהגדרה אחרת isogenic הופכת אפשרית. אצבע האבץ nucleases (ZFNs), nucleases שעתוק כמו activator-מפעיל (TALENs) וחוזר palindromic הקצר interspaced באופן קבוע התקבצו (CRISPR) / Cas9 הם SSNs הנפוץ ביותר. כל nucleases אלה לתפקד על ידי החדרת DNA הפסקת פעמיים תקועה באתר שצוין, ובכך לקדם עריכת גן מדויקת במוקד הגנומי. עריכת הגנום מדיטציה-SSN מנצלת שני מנגנונים של התא אנדוגני תיקון DNA, הסוף שאינו הומולוגי שהצטרף (NHEJ) ותיקון מכוון הומולוגיה (HDR), או להציג הכנסה / מוטציות מחיקה או altאה הגנום באמצעות תבנית תיקון הומולוגית באתר של הפסקת גדילים הכפולה. Electroporation של hPSCs הוא אמצעי יעיל של transfecting SSNs ותבניות תיקון המשלבים transgenes כגון כתבי ניאון וקלטות עמידות לאנטיביוטיקה. לאחר electroporation, אפשר לבודד רק את אלה ששולב hPSCs מבנה התיקון על ידי בחירה לעמידות לאנטיביוטיקה. מכאני הפרדת מושבות hPSC ומאשר שילוב ראוי באתר היעד דרך genotyping מאפשרת הבידוד של שורות תאים בצורה נכונה וממוקדות גנטיים הומוגני. תוקפו של פרוטוקול זה בא לידי הביטוי כאן על ידי שימוש בכל שלוש פלטפורמות SSN לשלב EGFP והתנגדות puromycin לבנות למוקד הנמל הבטוח AAVS1 בתאי גזע pluripotent אנושיים.

כאן אנו מדגימים פרוטוקול תואם עם שלוש פלטפורמות SSN שונות כדי ליצור קווי hPSC מהונדסים גנטי. אנו ממוקדים # WIBR 3 תאי גזע עובריים אנושיים במוקד AAVS1 באמצעות ZFNs שפורסם בעבר 4, 5 וTALENs CRISPR / Cas9s 37 באמצעות תבנית תיקון שמציגה כתב EGFP וקלטת התנגדות puromycin 4. אנו תרבית hPSCs על MEFs לעבודת תרבית תאים המאפשרת תחזוקה והרחבת hPSCs מובחן (איור 2), שהוא גם חסכוני וניתן להרחבה. אם תאים גדלים יותר מהנחוץ קיים סיכון המוגבר של בידול, צמצום מספר תאי pluripotent כי הם transfected וכתוצאה מכך מספר מושבות hPSC ממוקדות בצורה נכונה שהושגו. אנו electropצטט 5.0 x 10 6 תאים לכל פלטפורמת SSN ומצופה בתאים מכל מיקוד על אחד צלחת גם 6 של MEFs DR4. לאחר בחירה, כל פלטפורמה הביאה מושבות EGFP-חיובי (איור 3) ושילוב של שיבוטים לא ממוקדים, ממוקדים homozygously וממוקד heterozygously (איור 4 א &#39;, ב&#39;; טבלה 3). בתנאים שהוצגו כאן, אנו מוצאים כי TALENs AAVS1 הביא השיבוטים EGFP החיוביים ביותר. התבנית המשמשת לתיקון ניסוי זה מורכב מאתר acceptor אחוי במעלה הזרם של קלטת הכתב והתנגדות puromycin EGFP. באמצעות אסטרטגיה זו &quot;גן-מלכודת&quot; (איור 1), המבנה צריך להכניס לתוך אינטרון הראשון של מוקד AAVS1, באמצעות אמרגן אנדוגני לנהוג ביטוי של קלטת puromycin ההתנגדות. חוסר אמרגן נהיגה הביטוי של גן התנגדות puromycin בתוך תבנית התיקון צריך למנוע ביטוי ב<html> מקרה של שילוב אקראי. לכן, אנו מצפים שכל השיבוטים puromycin עמיד יהיו ממוקדים באתר AAVS1. יש לציין כי קבוצת משנה של שיבוטים לבצע אינטגרציות חריגות במוקד AAVS1 שלזיהוי על ידי כתם דרום באמצעות בדיקה פנימית, אך לא על ידי רוב אסטרטגיות PCR (איור 1; איור 4C) 4. אירועי אינטגרציה אלה הם ככל הנראה התוצאה של אירועים שהובילו למיקוד Heterologous אינטגרציות מרובות של פלסמיד התורם 4. אספנו 24 מושבות מכל ניסוי SSN ומצאתי כי כל פלטפורמות יעילות מיקוד גבוהה מאוד והראו הבדלים מזעריים בלבד. כנחקר על ידי ה- PCR, CRISPR / Cas9 הניב שיבוטים הממוקדים ביותר בצורה הנכונה ואילו פלטפורמת Talen השיבוטים הממוקדים ביותר homozygously (לוח 3). &quot;Width =&quot; 700 /files/ftp_upload/53583/53583fig1highres.jpg &quot;/&gt; סכמטי באיור 1. של הגן ערך מוקד AAVS1 באמצעות תבנית תיקון AAV-CAGGS-EGFP. השתנה מHockemeyer et al., 2009. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/53583/53583fig1highres.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" src="/files/ftp_upload/53583/53583fig2highres.jpg" width="700" /> 2. מושבות איור של # 3 תאי WIBR. נציג תמונות בהירות שדה של מושבות של # WIBR 3 תאי גזע עובריים אנושיים לפני המיקוד. שים לב לחוסר הבחנה וההפרדה ברורה משיכבת המזין במושבה אידיאלית (משמאל), בניגוד לאחד שאינו אידיאלי (מימין). <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/53583/53583fig2highres.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a><img alt="איור 3" src="/files/ftp_upload/53583/53583fig3highres.jpg" width="700" /> איור 3. # WIBR EGFP חיובי 3 תאים. נציג תמונות של # WIBR 3 תאים ממוקדים עם תבנית תיקון להביע EGFP במוקד AAVS1. תמונות של מושבות נציג נערכו עם ZFNs, TALENs וCRISPR / Cas9 מוצגים. <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/53583/53583fig3highres.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 4" src="/files/ftp_upload/53583/53583fig4highres.jpg" width="700" /> אסטרטגיות Genotyping איור 4. כדי לאשר מיקוד נכון. () תוצאות genotyping הנציג PCR מראים שיבוטים ממוקדים ממוקדים, הטרוזיגוטיים והומוזיגוטים על פני שלוש פלטפורמות SSN. WT CTL = שליטת wild-type. Repre (ב)תוצאות sentative דרום הכתם מראים שיבוט הטרוזיגוטיים ממוקדת ושיבוט הומוזיגוטים ממוקד מזוהה עם בדיקה החיצונית &#39;3. גדלים שבר: WT-6.5 KB, בעריכת-6.9 kb. (ג) תוצאות כתם דרום נציג מראים שיבוט נערך כראוי ושיבוט הטרוזיגוטיים עם דאבל-אינטגרציה אינה אקראית. גדלים שבר:. עריכה-6.9 כראוי kb, kb אינטגרציה-5 נוסף הסוטה <a href="https://jove.unicartagenaproxy.elogim.com/files/ftp_upload/53583/53583fig4highres.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <table fo:keep-together.within-page="1" style=";text-align:right;direction:rtl"><tbody><tr><td> לימוד </td><td> גן ממוקד </td><td> פּלַטפוֹרמָה </td><td> סוג תבנית תיקון </td><td> # של שיבוטים הרים </td><td> יעילות מיקוד </td></tr><tr><td> סקסטון et al., 2014 </td><td> TPP1 </td><td> ZFN </td><td> GFP-Puro </tד&gt; <td> לא דווח </td><td> לא דווח </td></tr><tr><td> סקסטון et al., 2014 </td><td> טרט </td><td> ZFN </td><td> Hygromycin </td><td> לא דווח </td><td> לא דווח </td></tr><tr><td> Hockemeyer et al., 2009 </td><td> POU5F1 </td><td> ZFN </td><td> GFP-Puro </td><td> 31 </td><td> 39.0% </td></tr><tr><td> Hockemeyer et al., 2009 </td><td> PITX3 </td><td> ZFN </td><td> GFP-Puro </td><td> 74 </td><td> 14.9% </td></tr><tr><td> Hockemeyer et al., 2011 </td><td> POU5F1 </td><td> Talen </td><td> GFP-Puro </td><td> 68 </td><td> 91.0% </td></tr><tr><td> Hockemeyer et al., 2011 </td><td> PITX3 </td><td> Talen </td><td> GFP-Puro </td><td> 96 </td><td> 13.0% </td></tr><tr><td> מרקל et al., 2015 </td><td> VASA </td><td> Cas9 </td><td> כתב-Geneticin </td><td> 139 </td><td> 94.0% </td></tr><tr><td> מרקל et al. &lt;/ Em&gt; 2015 </td><td> CRH </td><td> Cas9 </td><td> כתב-Geneticin </td><td> 30 </td><td> 93.0% </td></tr><tr><td> מרקל et al., 2015 </td><td> HCRT </td><td> Cas9 </td><td> כתב-Geneticin </td><td> 154 </td><td> 92.0% </td></tr><tr><td> מרקל et al., 2015 </td><td> HMX2 </td><td> Cas9 </td><td> כתב-Geneticin </td><td> 11 </td><td> 45.0% </td></tr><tr><td> פורסטר et al., 2014 </td><td> LRG5-Nterm </td><td> ZFN </td><td> GFP-Puro </td><td> לא דווח </td><td> 30.0% </td></tr><tr><td> פורסטר et al., 2014 </td><td> LRG5-Cterm </td><td> ZFN </td><td> GFP-Puro </td><td> לא דווח </td><td> 14.0% </td></tr><tr><td> Soldner et al., 2011 </td><td> סנכ&quot;א </td><td> ZFN </td><td> Puro </td><td> 96 </td><td> 1.0% </td></tr></tbody></table> טבלת 1. תיאור של גנים אחרים ממוקד בשיטה זו, עם קורsponding מיקוד יעילות נלקחה ממחקרים שפורסמו בעבר. 4,5,38-41 <table fo:keep-together.within-page="1" style=";text-align:right;direction:rtl"><tbody><tr><td> לוקוס </td><td> סדר פעולות </td><td> הערות </td></tr><tr><td> פריימר AAVS1-F </td><td> CTCTAACGCTGCCGTCTCTC </td><td> תנאי PCR: T מ &#39;= 57 מעלות צלזיוס, 35 מחזורים </td></tr><tr><td> פריימר AAVS1-WT-R </td><td> GCTTCTCCTCTTGGGAAGTG </td><td> להקת WT: 1,273 נקודות בסיס </td></tr><tr><td> AAVS1 ממוקד-R פריימר </td><td> CGTCACCGCATGTTAGAAGA </td><td> להקה ממוקדת: 992 נ&quot;ב </td></tr><tr><td> T2-Cas9-מדריך </td><td> GGGCCACTAGGGACAGGAT </td><td> ממאלי et al., 2013 </td></tr><tr><td> AAVS1-ZFN ימני </td><td> TAGGGACAGGAT </td><td> מHockemeyer et al., 2009 </td></tr><tr><td> AAVS1-ZFN-שמאל </td><td> TGGGGTGTCACC </td><td> מHockemeyer et al., 2009 </td></tr><tr><td> AAVS1-Talen ימני </td><td> TCCTAACCACTGTCTTT </td><td> מHockemeyer et al., 2011 </td></tr><tr><td> AAVS1-Talen-שמאל </td><td> CCCCTCCACCCCACAGT </td><td> מHockemeyer et al., 2011 </td></tr></tbody></table> רשימת 2. טבלה של פריימרים ורצפי מיקוד SSN. <table fo:keep-together.within-page="1" style=";text-align:right;direction:rtl"><tbody><tr><td> מיקוד לבנות </td><td> מספר EGFP + המושבות </td><td> ממוקד שיבוטים הרימו (PCR מאומת) </td><td> יעיל קודם מדווח תיקון מיקוד (על ידי כתם דרום) </td></tr><tr><td> ZFN </td><td> 150 </td><td> 86.9% (73.9% Het / 13.0% הומו) </td><td> 56% (50% Het / 6% הומו) </td></tr><tr><td> Talen </td><td> 412 </td><td> 91.3% (47.8% Het / 39.1% הומו) </td><td> 47% (Het 37.5% / 9.3% הומו) </td></tr><tr><td> CRISPR-Cas9 </td><td> 235 </td><td> 95.7% (69.5% Het / 26.3% הומו) </td><td> לא דווח </td></tr></tbody></table> 3. מספרים השוואתיים השולחן של EGFP חיובי וממוקד Talen, ZFN וCRISPR / מושבות תאי גזע אנושיות Cas9. PCR אומת אינטגרציות במוקד AAVS1 לניסוי זה הם בהשוואה לכתם דרום מאומת אינטגרציות יחידים נכונים בניסויים קודמים 4,5.

Watch this Scientific Journal Video about Establishment of Genome-edited Human Pluripotent Stem Cell Lines: From Targeting to Isolation at JoVE.com

Establishment of Genome-edited Human Pluripotent Stem Cell Lines: From Targeting to Isolation

הקמת שורות תאי גזע pluripotent האדם בעריכה-הגנום: ממיקוד לבידוד

Genome editing of human pluripotent stem cells (hPSCs) can be done quickly and efficiently. Presented here is a robust experimental procedure to genetically engineer hPSCs as exemplified by editing the AAVS1 safe harbor locus to express EGFP and introduce antibiotic resistance.

Genome-editing of human pluripotent stem cells (hPSCs) provides a genetically controlled and clinically relevant platform from which to understand human ...

establishment-genome-edited-human-pluripotent-stem-cell-lines-from

Universidad de Cartagena UDEC

Research

JoVE Journal

Developmental Biology

13.5K Views.  University of California, Berkeley. Genome editing of human pluripotent stem cells (hPSCs) can be done quickly and efficiently. Presented here is a robust experimental procedure to genetically engineer hPSCs as exemplified by editing the AAVS1 safe harbor locus to express EGFP and introduce antibiotic resistance. 

Video: Establishment of Genome-edited Human Pluripotent Stem Cell Lines: From Targeting to Isolation

Transfection, Selection, and Colony-picking of Human Induced Pluripotent Stem Cells TALEN-targeted with a GFP Gene into the AAVS1 Safe Harbor

Targeted transgene addition can provide persistent gene expression while circumventing the gene silencing and insertional mutagenesis caused by viral vector mediated random integration. This protocol describes a universal and efficient transgene targeted addition platform in human iPSCs based on utilization of validated open-source TALENs and a gene-trap-like donor to deliver transgenes into a safe harbor locus. Importantly, effective gene editing is rate-limited by the delivery efficiency of gene editing vectors. Therefore, this protocol first focuses on preparation of iPSCs for transfection to achieve high nuclear delivery efficiency. When iPSCs are dissociated into single cells using a gentle-cell dissociation reagent and transfected using an optimized program, >50% cells can be induced to take up the large gene editing vectors. Because the AAVS1 locus is located in the intron of an active gene (PPP1R12C), a splicing acceptor (SA)-linked puromycin resistant gene (PAC) was used to select targeted iPSCs while excluding random integration-only and untransfected cells. This strategy greatly increases the chance of obtaining targeted clones, and can be used in other active gene targeting experiments as well. Two weeks after puromycin selection at the dose adjusted for the specific iPSC line, clones are ready to be picked by manual dissection of large, isolated colonies into smaller pieces that are transferred to fresh medium in a smaller well for further expansion and genetic and functional screening. One can follow this protocol to readily obtain multiple GFP reporter iPSC lines that are useful for in vivo and in vitro imaging and cell isolation.

TALEN-mediated gene editing at the safe harbor AAVS1 locus enables high-efficiency transgene addition in human iPSCs. This protocol describes the procedures for preparing iPSCs for TALEN and donor vector delivery, transfecting iPSCs, and selecting and isolating iPSC clones to achieve targeted integration of a GFP gene to generate reporter lines.

Transfection, בחירה, ומושבת קטיף של תאי גזע האנושי המושרה pluripotent Talen-ממוקד עם גן GFP לSafe Harbor AAVS1

Targeted transgene addition can provide persistent gene expression while circumventing the gene silencing and insertional mutagenesis caused by viral ...

Genome Editing and Directed Differentiation of hPSCs for Interrogating Lineage Determinants in Human Pancreatic Development

Interrogating gene function in self-renewing or differentiating human pluripotent stem cells (hPSCs) offers a valuable platform towards understanding human development and dissecting disease mechanisms in a dish. To capitalize on this potential application requires efficient genome-editing tools to generate hPSC mutants in disease-associated genes, as well as in vitro hPSC differentiation protocols to produce disease-relevant cell types that closely recapitulate their in vivo counterparts. An efficient genome-editing platform for hPSCs named iCRISPR has been developed through the TALEN-mediated targeting of a Cas9 expression cassette in the AAVS1 locus. Here, the protocols for the generation of inducible Cas9 hPSC lines using cells cultured in a chemically defined medium and a feeder-free condition are described. Detailed procedures for using the iCRISPR system for gene knockout or precise genetic alterations in hPSCs, either through non-homologous end joining (NHEJ) or via precise nucleotide alterations using a homology-directed repair (HDR) template, respectively, are included. These technical procedures include descriptions of the design, production, and transfection of CRISPR guide RNAs (gRNAs); the measurement of the CRISPR mutation rate by T7E1 or RFLP assays; and the establishment and validation of clonal mutant lines. Finally, we chronicle procedures for hPSC differentiation into glucose-responsive pancreatic &#946;-like cells by mimicking in vivo pancreatic embryonic development. Combining iCRISPR technology with directed hPSC differentiation enables the systematic examination of gene function to further our understanding of pancreatic development and diabetes disease mechanisms.

Protocols to generate hPSC mutant lines using the iCRISPR platform and to differentiate hPSCs into glucose-responsive &#946;-like cells are described. Combining genome editing technology with hPSC-directed differentiation provides a powerful platform for the systematic analysis of the role of lineage determinants in human development and disease progression.

הגנום עריכה בימוי בידול של hPSCs עבור חקירת גורמים המשפיעים Lineage בהתפתחות האנושית הלבלב

Interrogating gene function in self-renewing or differentiating human pluripotent stem cells (hPSCs) offers a valuable platform towards understanding ...

Genetics

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise heterozygous genetic modifications is challenging due to CRISPR-CAS9 mediated indel formation in the second allele. Here, we demonstrate a protocol to help overcome this difficulty by using two repair templates in which only one expresses the desired sequence change, while both templates contain silent mutations to prevent re-cutting and indel formation. This methodology is most advantageous for gene editing coding regions of DNA to generate isogenic control and mutant human stem cell lines for studying human disease and biology. In addition, optimization of transfection and screening methodologies have been performed to reduce labor and cost of a gene editing experiment. Overall, this protocol is widely applicable to many genome editing projects utilizing the human pluripotent stem cell model.

This protocol provides a method to facilitate the generation of defined heterozygous or homozygous nucleotide changes using CRISPR-CAS9 in human pluripotent stem cells.

הדור של שינויים גנומית מוגדרים באמצעות CRISPR-CAS9 בתאי גזע האדם Pluripotent

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise ...

Introducing Point Mutations into Human Pluripotent Stem Cells Using Seamless Genome Editing

Custom designed endonucleases, such as RNA-guided Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9, enable efficient genome editing in mammalian cells. Here we describe detailed procedures to seamlessly genome edit the hepatocyte nuclear factor 4 alpha (HNF4&#945;) locus as an example in human pluripotent stem cells. Combining a piggyBac-based donor plasmid and the CRISPR-Cas9 nickase mutant in a two-step genetic selection, we demonstrate correct and efficient targeting of the HNF4&#945; locus.

Here, we describe a detailed method for seamless gene editing in human pluripotent stem cells using a piggyBac-based donor plasmid and the Cas9 nickase mutant. Two point mutations were introduced into exon 8 of the hepatocyte nuclear factor 4 alpha (HNF4&#945;) locus in human embryonic stem cells (hESCs).

החדרת מוטציות נקודתיות לתאי גזע פלוריפוטנטיים אנושיים באמצעות עריכת גנום חלקה

Custom designed endonucleases, such as RNA-guided Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9, enable efficient genome editing ...

Transfecting and Nucleofecting Human Induced Pluripotent Stem Cells

Genetic modification is continuing to be an essential tool in studying stem cell biology and in setting forth potential clinical applications of human embryonic stem cells (HESCs)1. While improvements in several gene delivery methods have been described2-9, transfection remains a capricious process for HESCs, and has not yet been reported in human induced pluripotent stem cells (iPSCs). In this video, we demonstrate how our lab routinely transfects and nucleofects human iPSCs using plasmid with an enhanced green fluorescence protein (eGFP) reporter. Human iPSCs are adapted and maintained as feeder-free cultures to eliminate the possibility of feeder cell transfection and to allow efficient selection of stable transgenic iPSC clones following transfection. For nucleofection, human iPSCs are pre-treated with ROCK inhibitor11, trypsinized into small clumps of cells, nucleofected and replated on feeders in feeder cell-conditioned medium to enhance cell recovery. Transgene-expressing human iPSCs can be obtained after 6 hours. Antibiotic selection is applied after 24 hours and stable transgenic lines appear within 1 week. Our protocol is robust and reproducible for human iPSC lines without altering pluripotency of these cells.

Despite recent advancements in genetic modification, transfection of human embryonic stem cells (HESCs) remains a capricious process. To our knowledge, systematic and efficient methods to transfect human induced pluripotent stem cells (iPSCs) have not been reported. Here, we describe robust protocols to efficiently transfect and nucleofect human iPSCs.

Transfecting וNucleofecting תאי גזע אנושיים pluripotent מושרים

Genetic modification is continuing to be an essential tool in studying stem cell biology and in setting forth potential clinical applications of human ...

Biology

Rapid and Efficient Generation of Recombinant Human Pluripotent Stem Cells by Recombinase-mediated Cassette Exchange in the AAVS1 Locus

Even with the revolution of gene-targeting technologies led by CRISPR-Cas9, genetic modification of human pluripotent stem cells&#160;(hPSCs)&#160;is still time consuming. Comparative studies that use recombinant lines with transgenes integrated into safe harbor loci could benefit from approaches that use site-specific targeted recombinases, like Cre or FLPe, which are more rapid and less prone to off-target effects. Such methods have been described, although they do not significantly outperform gene targeting in most aspects. Using Zinc-finger nucleases, we previously created a master cell line in the AAVS1 locus of hPSCs&#160;that contains a GFP-Hygromycin-tk expressing cassette, flanked by heterotypic FRT sequences. Here, we describe the procedures to perform FLPe recombinase-mediated cassette exchange (RMCE) using this line. The master cell line is transfected with a RMCE donor vector, which contains a promoterless Puromycin resistance, and with FLPe recombinase. Application of both a positive (Puromycin) and negative (FIAU) selection program leads to the selection of RMCE without random integrations. RMCE generates fully characterized pluripotent polyclonal transgenic lines in 15 d&#160;with 100% efficiency. Despite the recently described limitations of the AAVS1 locus, the ease of the system paves the way for hPSC transgenesis in isogenic settings, is necessary for comparative studies, and enables semi-high-throughput genetic screens for gain/loss of function analysis that would otherwise be highly time consuming.

Rapid and Efficient Generation of Recombinant Human Pluripotent Stem Cells by Recombinase-mediated Cassette Exchange in the AAVS1 Locus

Here we report a rapid and efficient gene editing method based on RMCE in the AAVS1 locus of human Pluripotent Stem Cells (hPSCs) that improves upon previously described systems. Using this technique, isogenic lines can be rapidly and reliably generated for proper comparative studies, facilitating transgenesis-mediated research with hPSCs.

הדור מהיר ויעיל של תאי גזע פלוריפוטנטיים רקומביננטי אנושי ידי recombinase בתיווך המרת קלטת ב<em&gt; AAVS1</em&gt; לוקוס

Even with the revolution of gene-targeting technologies led by CRISPR-Cas9, genetic modification of human pluripotent stem cells&#160;(hPSCs)&#160;is ...

Medicine

Selecting and Isolating Colonies of Human Induced Pluripotent Stem Cells Reprogrammed from Adult Fibroblasts

Herein we present a protocol of reprogramming human adult fibroblasts into human induced pluripotent stem cells (hiPSC) using retroviral vectors encoding Oct3/4, Sox2, Klf4 and c-myc (OSKM) in the presence of sodium butyrate 1-3. We used this method to reprogram late passage (&gt;p10) human adult fibroblasts derived from Friedreich's ataxia patient (GM03665, Coriell Repository). The reprogramming approach includes highly efficient transduction protocol using repetitive centrifugation of fibroblasts in the presence of virus-containing media. The reprogrammed hiPSC colonies were identified using live immunostaining for Tra-1-81, a surface marker of pluripotent cells, separated from non-reprogrammed fibroblasts and manually passaged 4,5. These hiPSC were then transferred to Matrigel plates and grown in feeder-free conditions, directly from the reprogramming plate. Starting from the first passage, hiPSC colonies demonstrate characteristic hES-like morphology. Using this protocol more than 70% of selected colonies can be successfully expanded and established into cell lines. The established hiPSC lines displayed characteristic pluripotency markers including surface markers TRA-1-60 and SSEA-4, as well as nuclear markers Oct3/4, Sox2 and Nanog. 
The protocol presented here has been established and tested using adult fibroblasts obtained from Friedreich's ataxia patients and control individuals 6, human newborn fibroblasts, as well as human keratinocytes.

We present a protocol for efficient reprogramming of human somatic cells into human induced pluripotent stem cells (hiPSC) using retroviral vectors encoding Oct3/4, Sox2, Klf4 and c-myc (OSKM) and identification of correctly reprogrammed hiPSC by live staining with Tra-1-81 antibody.

בחירה בידוד מושבות של בתאי גזע pluripotent מושרה לתכנות מחדש של Fibroblasts למבוגרים

Herein we present a protocol of reprogramming human adult fibroblasts into human induced pluripotent stem cells (hiPSC) using retroviral vectors encoding ...

Efficient iPS Cell Generation from Blood Using Episomes and HDAC Inhibitors

This manuscript illustrates a protocol for efficiently creating integration-free human induced pluripotent stem cells (iPSCs) from peripheral blood using episomal plasmids and histone deacetylase (HDAC) inhibitors. The advantages of this approach include: (1) the use of a minimal amount of peripheral blood as a source material; (2) nonintegrating reprogramming vectors; (3) a cost effective method for generating vector free iPSCs; (4) a single transfection; and (5) the use of small molecules to facilitate epigenetic reprogramming. Briefly, peripheral blood mononuclear cells (PBMCs) are isolated from routine phlebotomy samples and then cultured in defined growth factors to yield a highly proliferative erythrocyte progenitor cell population that is remarkably amenable to reprogramming. Nonintegrating, nontransmissible episomal plasmids expressing OCT4, SOX2, KLF4, MYCL, LIN28A, and a p53 short hairpin (sh)RNA are introduced into the derived erythroblasts via a single nucleofection. Cotransfection of an episome that expresses enhanced green fluorescent protein (eGFP) allows for easy identification of transfected cells. A separate replication-deficient plasmid expressing Epstein-Barr nuclear antigen 1 (EBNA1) is also added to the reaction mixture for increased expression of episomal proteins. Transfected cells are then plated onto a layer of irradiated mouse embryonic fibroblasts (iMEFs) for continued reprogramming. As soon as iPSC-like colonies appear at about twelve days after nucleofection, HDAC inhibitors are added to the medium to facilitate epigenetic remodeling. We have found that the inclusion of HDAC inhibitors routinely increases the generation of fully reprogrammed iPSC colonies by 2 fold. Once iPSC colonies exhibit typical human embryonic stem cell (hESC) morphology, they are gently transferred to individual iMEF-coated tissue culture plates for continued growth and expansion.

Here we describe a protocol for generating human induced pluripotent stem cells from peripheral blood using an episome based reprogramming strategy and histone deacetylase inhibitors.

דור יעיל iPS תא מהדם באמצעות Episomes וHDAC המעכבים

This manuscript illustrates a protocol for efficiently creating integration-free human induced pluripotent stem cells (iPSCs) from peripheral blood using ...

Derivation and Characterization of a Transgene-free Human Induced Pluripotent Stem Cell Line and Conversion into Defined Clinical-grade Conditions

Human induced pluripotent stem cells (hiPSCs) can be generated with lentiviral-based reprogramming methodologies. However, traces of potentially oncogenic genes remaining in actively transcribed regions of the genome, limit their potential for use in human therapeutic applications1. Additionally, non-human antigens derived from stem cell reprogramming or differentiation into therapeutically relevant derivatives preclude these hiPSCs from being used in a human clinical context2. In this video, we present a procedure for reprogramming and analyzing factor-free hiPSCs free of exogenous transgenes. These hiPSCs then can be analyzed for gene expression abnormalities in the specific intron containing the lentivirus. This analysis may be conducted using sensitive quantitative polymerase chain reaction (PCR), which has an advantage over less sensitive techniques previously used to detect gene expression differences3. Full conversion into clinical-grade good manufacturing practice (GMP) conditions, allows human clinical relevance. Our protocol offers another methodology&#8212;provided that current safe-harbor criteria will expand and include factor-free characterized hiPSC-based derivatives for human therapeutic applications&#8212;for deriving GMP-grade hiPSCs, which should eliminate any immunogenicity risk due to non-human antigens. This protocol is broadly applicable to lentiviral reprogrammed cells of any type and provides a reproducible method for converting reprogrammed cells into GMP-grade conditions.

We describe a protocol for deriving lentiviral-based reprogrammed and characterized factor-free human induced pluripotent stem cells and conversion into putative clinical-grade conditions.

גזירה ואפיון ללא transgene האדם המושרה pluripotent גזע קו סלולארי והמרה לתנאי כיתה קלינית מוגדרים

Human induced pluripotent stem cells (hiPSCs) can be generated with lentiviral-based reprogramming methodologies. However, traces of potentially oncogenic ...

CRISPR-Cas9 Mediated Gene Deletion in Human Pluripotent Stem Cells Cultured Under Feeder-Free Conditions

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical application of this technique, particularly in pluripotent stem cells, presents certain challenges, such as being time- and labor-intensive and having low editing efficiency. Here, we describe the generation of a CRISPR-mediated gene knockout in a human embryonic stem cell (hESC) line stably expressing sgRNAs for the L2HGDH gene, using a highly efficient and stable lentiviral-mediated gene delivery system. The sgRNAs targeting exon 1 of the L2HGDH gene were chemically synthesized and cloned into the lentiCRISPR v2-puro vector, which combines the constitutive expression of sgRNAs with Cas9 in a highly efficient single-vector system to achieve higher lentiviral titers for hESC infection and stable selection using puromycin. Puromycin-selected cells were further expanded, and single-cell clones were obtained using the limited dilution method. The single clones were expanded, and several homozygous knockout clones for the L2HGDH gene were obtained, as confirmed by a 100% reduction in L2HGDH expression using Western blot analysis. Furthermore, using MSBSP-PCR, the CRISPR mutation site was mapped upstream of the PAM recognition sequence of Cas9 in the selected homozygous clones. Sanger sequencing was performed to analyze the exact insertions/deletions, and functional characterization of the clones was conducted. This method produced a significantly higher percentage of homozygous deletions compared to previously reported non-viral gene delivery methods. Although this report focuses on the L2HGDH gene, this robust and cost-effective approach can be used to create homozygous knockouts for other genes in pluripotent stem cells for gene function studies.

<meta charset="utf8"></head><body>CRISPR-Cas9 תיווך מחיקת גנים בתאי גזע פלוריפוטנטיים אנושיים שגודלו בתרבית בתנאים נטולי הזנה

The presented method describes the generation of a CRISPR-mediated gene knockout in the human embryonic stem cell (hESC) line H9, which stably expresses sgRNAs targeting the L2HGDH gene using a highly efficient lentiviral-mediated gene delivery system.

CRISPR-Cas9 תיווך מחיקת גנים בתאי גזע פלוריפוטנטיים אנושיים שגודלו בתרבית בתנאים נטולי הזנה

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical ...