Este trabajo fue apoyado por subvenciones del Instituto Nacional de Salud Mental (R00MH103531 y R01MH116901 a J.A.), una beca de capacitación predoctoral del Instituto Nacional de Medicina General (T32GM007635 a S.R.), y una Beca Lyda Hill Gilliam de Estudio Avanzado (GT11021 a S.R.). Agradecemos al Dr. Kevin Woolfrey la ayuda con el microscopio, el Dr. K Ulrich Bayer por el uso de su microscopio epifluorescente, y Thomas Südhof (Universidad de Stanford) por el plásmido LRRTM2.

1. Cultivo celular y transfección
<ol><li>Hacer medios celulares HEK con DMEM, 1x (Dulbecco's Modification of Eagle's Medium) complementado con glucosa de 4,5 g/L, piruvato de L-glutamina y sodio y 10% FBS. Filtro estéril.</li>
	<li>Predeterminar ligandos y receptores adecuados para el ensayo de agregación. NOTA: Neurexin3α SS4+/- y uno de sus ligandos conocidos, LRRTM2, fueron utilizados en este estudio. Ligandos y receptores de interés se expresaron a partir de CDNAs en pcDNA3.1. Se utilizó un conjunto Gibson para insertar Neurexin3α en pcDNA3.112. Neurexin3α F/R: TTTAAACTTAAGCTTGGTACCGAGCTCGGATCCGCCACCATGAGCTTTACCCTCCACTCTC/ GAGCGGCCGCCACTGTGCTGGATATCTGCAGAATTCTTACACATAATACTCCTTGTCCTT.</li>
	<li>Prepare las células HEK293T.<ol>
<li>Cultivar células HEK293T a la confluencia en un matraz T-75.</li>
		<li>Una vez confluente, utilice 2 ml de trypsin y colóquelo en una incubadora de 37 °C durante 2 min. Agregue 6 ml de soporte HEK al matraz para volver a usar las células y transferir los 8 ml a un tubo cónico de 15 ml.</li>
		<li>Pellet a 500 x g durante 5 min y resuspend en medios celulares HEK para un total de 8 mL.</li>
		<li>Contar células y añadir 735.000 células en cada pozo de una placa de 6 pozos. Ajuste el volumen final a 2 ml para cada pozo utilizando medios de celda HEK.</li>
		<li>Colocar en incubadora de 37 °C y permitir que las células crezcan durante la noche o hasta que alcancen el 50-60% de confluencia.</li>
	</ol></li>
	<li>Transfectar células HEK293T utilizando el método de fosfato de calcio13.<ol>
<li>Transfectar bien-1 con 3 μg de la proteína de interés y co-transfecto con 1 μg de proteína fluorescente (3 μg de pcDNA3.1-Neurexin3αWT SS4- y 1 μg de mCherry).</li>
		<li>Transfecto bien-2 como en el paso 1.4.1. pero con la proteína mutada de interés (pcDNA3.1-Neurexin3αA687T SS4-).</li>
		<li>Transfectar bien-3 con 3 μg del ligando de interés y co-transfecto con 1 μg de otra proteína fluorescente (3 μg de pcDNA3.1 LRRTM2 y 1 μg de GFP).</li>
		<li>Transfecto bien-4 y bien-5 para servir como controles negativos: bueno-4 con 1 μg de GFP y bien-5 con 1 μg de mCherry.</li>
		<li>Preparar otra placa (como en el paso 1.4.1-1.4.4) si requiere condiciones o controles adicionales (Neurexin3αWT/A687T SS4+). NOTA: La eficiencia de transfección se analiza 24 h después de la transfección bajo un microscopio de epifluorescencia y cuantificada como el número de células que expresan la proteína fluorescente con la que fueron transfectadas. Un enfoque más simplificado incluiría la transfección de células HEK con una codificación vectorial bicistrónica para una proteína fluorescente y el ligando de interés y es muy recomendable por encima de la co-transfección. En el caso de este estudio, las neurexinas alfa son ~4.3 kb y se observó baja intensidad de fluorescencia utilizando un sistema bicistrónico que requiere co-transfección.</li>
	</ol></li>
	<li>48 horas después de la transfección, cosechar células para la agregación.<ol>
<li>Lave cada pozo dos veces con PBS.</li>
		<li>Agregue 1 ml de EDTA de 10 mM en PBS en cada pozo para disociar suavemente las interacciones de célula a célula e incubar la placa a 37 °C durante 5 minutos. NOTA: Trypsin no se recomienda para el paso 1.5.2 debido a un posible escote proteolítico de moléculas de adhesión en estudio. Además, después de la adición de EDTA, es posible que el protocolo no se detenga hasta su finalización, ya que las celdas ahora estarán expuestas a condiciones ambientales.</li>
		<li>Toque suavemente la placa para separar las células y cosechar cada pozo en tubos cónicos separados de 15 ml.</li>
		<li>Centrífuga tubos cónicos a 500 x g y temperatura ambiente durante 5 min.</li>
	</ol></li>
	<li>Mientras las células están peletizando, prepare 6 tubos de incubación etiquetando la parte superior de cada tubo de microcentrífuga con cada condición. NOTA: Cada permutación de las condiciones GFP y mCherry debe utilizarse para abarcar todas las condiciones experimentales y controles adecuados. Por ejemplo: 1. GFP/mCherry, 2. mCherry/LRRTM2-GFP 3. GFP/Neurexin3αWT SS4-—mCherry, 4. GFP/Neurexin3αA687T SS4- –mCherry, 5. Neurexin3αWT SS4-—mCherry/LRRTM2—GFP, 6. Neurexin3αA687T SS4- –mCherry/LRRTM2—GFP. Haga tubos adicionales para adaptarse a otras condiciones y controles.</li>
	<li>Retire las células sobrenadantes y resuspend en 500 μL de medios HEK con 10 mM CaCl2 y 10 mM MgCl2 calentado a 37 °C. NOTA: La adición de CaCl2 y MgCl2 permite que las moléculas de adhesión restablezcan la unión y sólo es necesaria si los socios de interacción transcelular en cuestión requieren cationes divalentes para la adhesión.</li>
	<li>Cuente las células de cada tubo cónico de 15 ml utilizando un hemociclo y aliquot 200.000 células de cada condición en el tubo apropiado desde el paso 1.6.1 para una mezcla de 1:1 en un volumen total de 500 μL. NOTA: Solo se debe tomar 5 minutos por condición para contar y alicuar cantidades.</li>
	<li>Incubar tubos a temperatura ambiente en un rotador de tubo lento.</li>
</ol>2. Adquisición de imágenes
<ol><li>Optimice los parámetros de adquisición de microscopios para muestras específicas. En este ejemplo, las imágenes se tomaron en un microscopio de campo ancho. Utilice un objetivo de aire 5x (NA: 0.15; WD: 20000 μm) para obtener un campo lo suficientemente grande para su análisis.</li>
	<li>Evalúe la agregación basal inmediatamente después de mezclar las dos condiciones de las células HEK en el paso 1.8. Estas son ahora las imágenes de "tiempo cero".<ol>
<li>Pipeta 40 μL de cada mezcla de muestra en una diapositiva de microscopio cargada e imagen bajo fluorescencia en los canales 488 y 561.</li>
		<li>Adquiera tres campos de visión diferentes en un plano de enfoque por caída de muestra.</li>
	</ol>
</li>
	<li>Adquiere imágenes finales a 60 min como la imagen de 'time 60'.<ol>
<li>Para obtener la imagen de "tiempo 60" de la mezcla después de una incubación de 60 minutos, tome otra muestra de 40 μL de cada condición de tubos giratorios y pipeta cada muestra en una diapositiva cargada. Imagen como en el paso 2.2.2. NOTA: La agregación celular debe comprobarse cada 15 minutos hasta que se produzca la saturación. El momento de la agregación dependerá de las proteínas que se prueben.</li>
	</ol>
</li>
</ol>3. Análisis de ImageJ/Fiji
<ol><li>Para cuantificar el alcance de la agregación mediante Fiji/ImageJ, guarde los archivos de análisis.<ol>
<li>Guarde los archivos de codificación suplementarios proporcionados en la carpeta de macros imageJ del equipo.</li>
		<li>Instale la macro de agregación proporcionada (plugins, macros, install y seleccione el archivo "AggregationAssay.txt").</li>
	</ol>
</li>
	<li>Determinar umbrales.<ol>
<li>Cargue un archivo de .tif 'time zero' en imageJ y divida los canales(Image | Color | Canales divididos). NOTA: La imagen 'time zero' se utiliza para determinar el umbral y el tamaño de puncta más pequeño para todo el experimento.</li>
		<li>Enmascarar cada canal(Plugins | Macros | AggregationAssay_MakeMask). Aparecerá la ventana Crear máscara desde imagen. Marque las casillas situadas junto a Determinar umbral para la imagen y determinar parámetros de clúster a partir de histograma y haga clic en Aceptar.</li>
		<li>Determine el umbral de la imagen mediante la barra de diapositivas, registre el número a la derecha de la barra de diapositivas y haga clic en Aceptar.</li>
		<li>Aparecerá un histograma de tamaño de clúster. Seleccione un tamaño de clúster en el histograma que se adapte al experimento, escriba este número en el cuadro Tamaño mínimo del clúster: y haga clic en Aceptar. Los clústeres por debajo de este tamaño no se analizarán.</li>
	</ol>
</li>
	<li>Ejecute el análisis.<ol>
<li>Abra la imagen 'time 60' de la condición 1 en imageJ y divida los canales como en el paso 3.2.1.</li>
		<li>Enmascara cada canal (Plugins, Macros, AggregationAssay_MakeMask). Utilice el mismo umbral y tamaño determinados en los pasos 3.2.3 y 3.2.4. Anule la selección de los cuadros situados junto a Determinar umbral para imagen y Determinar parámetros de clúster a partir de Histograma y escriba manualmente el tamaño y los umbrales en los campos adecuados y, a continuación, haga clic en Aceptar.</li>
		<li>Calcular el índice de agregación (Plugins | Macros | AggregationAssay_CalculateOverlap). Seleccione los canales enmascarados que desea comparar y el directorio en el que se guardarán los archivos resultantes.</li>
		<li>Repita los pasos 3.3.1–3.3.3 por cada imagen de "tiempo 60" en cada condición. NOTA: El índice de agregación se define como el área de superposición total dividida por la suma de las dos áreas de canal menos el área de superposición multiplicada por 100 (Índice de agregación = área de superposición/[área del canal 1 + área del canal 2 – área de superposición] x 100). Esta normalización es una operación 'OR' entre los dos canales enmascarados que representan el total de píxeles de cualquiera de las máscaras.</li>
	</ol>
</li>
</ol>

<ol>
	<li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroligins+and+neurexins+link+synaptic+function+to+cognitive+disease.">Neuroligins and neurexins link synaptic function to cognitive disease.</a> Nature. 455 (7215), 903-911 (2008).</li><li>Lakey, J. H., Raggett, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+protein-protein+interactions.">Measuring protein-protein interactions.</a> Current Opinion in Structural Biology. 8 (1), 119-123 (1998).</li><li>Aoto, J., Martinelli, D. C., Malenka, R. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Presynaptic+neurexin-3+alternative+splicing+trans-synaptically+controls+postsynaptic+AMPA+receptor+trafficking.">Presynaptic neurexin-3 alternative splicing trans-synaptically controls postsynaptic AMPA receptor trafficking.</a> Cell. 154 (1), 75-88 (2013).</li><li>Aoto, J., F&#246;ldy, C., Ilcus, S. M. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+circuit-dependent+functions+of+presynaptic+neurexin-3+at+GABAergic+and+glutamatergic+synapses.">Distinct circuit-dependent functions of presynaptic neurexin-3 at GABAergic and glutamatergic synapses.</a> Nature Neuroscience. 18 (7), 997-1007 (2015).</li><li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+Neurexin+Complexes:+A+Molecular+Code+for+the+Logic+of+Neural+Circuits.">Synaptic Neurexin Complexes: A Molecular Code for the Logic of Neural Circuits.</a> Cell. 171 (4), 745-769 (2017).</li><li>Dai, J., Aoto, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+Splicing+of+Presynaptic+Neurexins+Differentially+Controls+Postsynaptic+NMDA+and+AMPA+Receptor+Responses.">Alternative Splicing of Presynaptic Neurexins Differentially Controls Postsynaptic NMDA and AMPA Receptor Responses.</a> Neuron. 102 (5), 993-1008 (2019).</li><li>Restrepo, S., Langer, N. J., Nelson, K. A., Aoto, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+a+Neurexin-3&#945;+Human+Mutation+in+Mouse+Neurons+Identifies+a+Novel+Role+in+the+Regulation+of+Transsynaptic+Signaling+and+Neurotransmitter+Release+at+Excitatory+Synapses.">Modeling a Neurexin-3&#945; Human Mutation in Mouse Neurons Identifies a Novel Role in the Regulation of Transsynaptic Signaling and Neurotransmitter Release at Excitatory Synapses.</a> The Journal of Neuroscience. 39 (46), 9065-9082 (2019).</li><li>Ko, J., Fuccillo, M. V., Malenka, R. C., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Functions+as+a+Neurexin+Ligand+in+Promoting+Excitatory+Synapse+Formation.">LRRTM2 Functions as a Neurexin Ligand in Promoting Excitatory Synapse Formation.</a> Neuron. 64 (6), 791-798 (2009).</li><li>de Wit, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Interacts+with+Neurexin1+and+Regulates+Excitatory+Synapse+Formation.">LRRTM2 Interacts with Neurexin1 and Regulates Excitatory Synapse Formation.</a> Neuron. 64 (6), 799-806 (2009).</li><li>Linhoff, M. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Unbiased+Expression+Screen+for+Synaptogenic+Proteins+Identifies+the+LRRTM+Protein+Family+as+Synaptic+Organizers.">An Unbiased Expression Screen for Synaptogenic Proteins Identifies the LRRTM Protein Family as Synaptic Organizers.</a> Neuron. 61 (5), 734-749 (2009).</li><li>Siddiqui, T. J., Pancaroglu, R., Kang, Y., Rooyakkers, A., Craig, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTMs+and+Neuroligins+Bind+Neurexins+with+a+Differential+Code+to+Cooperate+in+Glutamate+Synapse+Development.">LRRTMs and Neuroligins Bind Neurexins with a Differential Code to Cooperate in Glutamate Synapse Development.</a> Journal of Neuroscience. 30 (22), 7495-7506 (2010).</li><li>Gibson, D. G., Young, L., Chuang, R. -. Y., Venter, J. C., Hutchison, C. A., Smith, H. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nature Methods. 6 (5), 343-345 (2009).</li><li>Bacchetti, S., Graham, F. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfer+of+the+gene+for+thymidine+kinase+to+thymidine+kinase-deficient+human+cells+by+purified+herpes+simplex+viral+DNA.">Transfer of the gene for thymidine kinase to thymidine kinase-deficient human cells by purified herpes simplex viral DNA.</a> Proceedings of the National Academy of Sciences of the United States of America. 74 (4), 1590-1594 (1977).</li><li>Cerchiari, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+strategy+for+tissue+self-organization+that+is+robust+to+cellular+heterogeneity+and+plasticity.">A strategy for tissue self-organization that is robust to cellular heterogeneity and plasticity.</a> Proceedings of the National Academy of Sciences of the United States of America. 112 (7), 2287-2292 (2015).</li><li>Burdick, M. M., McCarty, O. J. T., Jadhav, S., Konstantopoulos, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+inflammation+and+cancer+metastasis.">Cell-cell interactions in inflammation and cancer metastasis.</a> IEEE Engineering in Medicine and Biology Magazine. 20 (3), 86-91 (2001).</li><li>Fox, D. A., Gizinski, A., Morgan, R., Lundy, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+rheumatoid+arthritis+synovium.">Cell-cell interactions in rheumatoid arthritis synovium.</a> Rheumatic Diseases Clinics of North America. 36 (2), 311-323 (2010).</li><li>Yamagata, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+insights+into+modulation+and+selectivity+of+transsynaptic+neurexin-LRRTM+interaction.">Structural insights into modulation and selectivity of transsynaptic neurexin-LRRTM interaction.</a> Nature Communications. 9 (1), 3964 (2018).</li><li>Nguyen, T., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binding+properties+of+neuroligin+1+and+neurexin+1beta+reveal+function+as+heterophilic+cell+adhesion+molecules.">Binding properties of neuroligin 1 and neurexin 1beta reveal function as heterophilic cell adhesion molecules.</a> The Journal of Biological Chemistry. 272 (41), 26032-26039 (1997).</li><li>Boucard, A. A., Ko, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Affinity+Neurexin+Binding+to+Cell+Adhesion+G-protein-coupled+Receptor+CIRL1/Latrophilin-1+Produces+an+Intercellular+Adhesion+Complex.">High Affinity Neurexin Binding to Cell Adhesion G-protein-coupled Receptor CIRL1/Latrophilin-1 Produces an Intercellular Adhesion Complex.</a> Journal of Biological Chemistry. 287 (12), 9399-9413 (2012).</li></ol>

Los autores no tienen nada que revelar.

La disección de las interacciones proteína-proteínas que se producen en trans durante la adhesión celular puede conducir a una mejor comprensión de los mecanismos moleculares subyacentes a los procesos celulares básicos, incluyendo la formación, función y mantenimiento de sinapsis durante la maduración y remodelación. Las implicaciones de las interacciones de célula a célula se expanden más allá de la neurobiología y tienen un papel más amplio en la transducción de la señal, la migración celular y el d...

Las interacciones sinápticas facilitadas por moléculas de adhesión sináptica son fundamentales para el desarrollo, la organización, la especificación, el mantenimiento y la función de las sinapsis y la generación de redes neuronales. La identificación de estas moléculas de adhesión celular transsináptica está aumentando rápidamente; por lo tanto, es fundamental identificar socios de unión y entender cómo estas nuevas moléculas de adhesión interactúan entre sí. Además, la secuenciación del genoma ha identificado mutaciones en muchas de estas moléculas de adhesión que comúnmente están relacionadas con una multitud de trastornos neurodesarrollo, neuropsiquiátrico y de adicción1. Las mutaciones en genes que codifican para moléculas sinápticas de adhesión celular pueden alterar perjudicialmente las interacciones trans y pueden contribuir a alteraciones fisiológicas en la formación y el mantenimiento de sinapsis.
Existen múltiples ensayos para evaluar cuantitativamente las interacciones proteína-proteínas como calorimetría isotérmica, dichroismo circular, resonancia de plasmón superficial2 y aunque de naturaleza cuantitativa, tienen varias limitaciones. En primer lugar, requieren proteínas recombinantes, a veces exigiendo pasos de purificación largos y tediosos. En segundo lugar, requieren sofisticados equipos especializados y conocimientos técnicos. En tercer lugar, pueden sobreestimar el grado de unión, ya que permiten interacciones cis y trans entre proteínas que están naturalmente atadas a una membrana in vivo. Aquí proponemos un ensayo simple y relativamente rápido que prueba exclusivamente las interacciones trans.
Para eludir muchas de las complicaciones asociadas con los ensayos de proteínas purificadas, hemos optimizado un ensayo de interacción proteica basado en células que recapitula las interacciones trans en un sistema celular heterologoso reducido. Este ensayo se ha utilizado previamente en varias formas para estudiar interacciones transcelulares. En este enfoque, las moléculas de adhesión celular candidatas se transfectan en células HEK293T. En condiciones fisiológicas, las células HEK293T no exhiben autoagregación, por lo que son modelos ejemplares para este ensayo. Sin embargo, cuando se combinan poblaciones individuales de células HEK que expresan receptor y ligando, la unión del receptor y el ligando obliga a que se produzca la agregación de células HEK. Esta agregación se media exclusivamente mediante interacciones trans y suele ser observable en decenas de minutos. No se requieren pasos de purificación de proteínas en este método, y la eficiencia del método se basa en el paradigma de que las poblaciones de células HEK que expresan moléculas de adherencia de cognato se están combinando y luego se tienen imágenes sólo decenas de minutos más tarde. Además, este método es relativamente barato, ya que no se requieren anticuerpos ni equipos costosos. El único equipo necesario para la adquisición de datos es un microscopio fluorescente estándar. Una ventaja adicional a este ensayo basado en células es la capacidad de examinar rápidamente el efecto de las mutaciones puntuales relevantes de la enfermedad en las interacciones trans. Esto se puede realizar mediante la transfectación de células HEK con CDNAs de las variantes mutantes de la proteína de interés.
En este protocolo, presentamos un ejemplo en el que investigamos si una mutación de missense en Neurexin3α (Neurexin3αA687T),identificada en un paciente diagnosticado con profunda discapacidad intelectual y epilepsia, altera las interacciones en trans con la proteína transmembrana repetida rica en leucina 2 (LRRTM2). Neurexin3α es miembro de la familia evolutivamente conservada de moléculas presintáticas de adhesión celular y aunque el trabajo reciente ha identificado múltiples roles en la sinapsis3,4,5,6,7,nuestra comprensión sináptica de esta molécula y todos los miembros de la familia de la neurexina sigue incompleta. LRRTM2 es una proteína de adherencia de células postsinápticas excitatorias que participa en la formación y mantenimiento de sinapsis8,9,10. Es importante destacar que LRRTM2 interactúa exclusivamente con isoformes de neurexina que carecen del sitio de empalme 4 exones alternativos (SS4-) pero no con isoformes de neurexina que contienen el sitio de empalme 4 exones alternativos (SS4+). La mutación de missense humano (A687T) identificada en Neurexin3α se encuentra en una región extracelular no auditada que se conserva evolutivamente y se conserva entre todas las neurexinas alfa7. Como la interacción entre estas dos moléculas se ha establecido8,9,11, planteamos la pregunta: ¿la capacidad de unión de Neurexin3α SS4- a LRRTM2 alterada por una mutación de punto A687T? Este ensayo reveló que la mutación del punto A687T mejoró inesperadamente la agregación de Neurexin3α a LRRTM2, lo que sugiere que la región extracelular en la que se encuentra la mutación de puntos desempeña un papel en la mediación de las interacciones transsintápticas.

<table><tbody><tr><td>1.5 mL disposable microtubes with snap caps</td><td>VWR</td><td>89000-028</td><td>Incubation of mixed population of HEK cells</td></tr><tr><td>1000 mL Rapid&amp;mdash;Flow Filter Unit, 0.2 um aPES membrane</td><td>Thermo Fisher</td><td>567-0020</td><td>Sterilization of HEK media</td></tr><tr><td>15 mL SpectraTube centrifuge tubes</td><td>Ward&amp;rsquo;s Science</td><td>470224-998</td><td>Harvesting HEK cells</td></tr><tr><td>6 well sterile tissue culture plates</td><td>VWR</td><td>100062-892</td><td>culturing HEK cells</td></tr><tr><td>Calcium Chloride</td><td>Sigma</td><td>223506-500G</td><td>Calcium phosphate transfection, HEK cell resuspension</td></tr><tr><td>Centrifuge- Sorvall Legend RT</td><td>Kendro Laboratory Products</td><td>75004377</td><td>Harvesting HEK cells</td></tr><tr><td>CO2 cell incubator</td><td>Thermo Scientific</td><td>HERACELL 150i</td><td>Incubation of HEK cells during growth</td></tr><tr><td>DMEM, 1x (Dulbecco&#039;s Modification of Eagle&#039;s Medium) with 4.5 g/L glucose, L-glutamine &amp;amp; sodium pyruvate</td><td>Corning</td><td>10-013-CV</td><td>HEK cell maintenance</td></tr><tr><td>Dulbecco&amp;rsquo;s Phosphate Buffered Saline PBS (1X)</td><td>Gibco</td><td>14190-144</td><td>Passaging/harvesting HEK cell</td></tr><tr><td>Ethylenediaminetetraacetic acid</td><td>Sigma</td><td>ED-500G</td><td>Harvesting HEK cells</td></tr><tr><td>Falcon Vented culture flasks, 75cm&lt;sup&gt;2&lt;/sup&gt; growth area</td><td>Corning</td><td>9381M26</td><td>Culturing HEK cells</td></tr><tr><td>Fetal Bovine Serum</td><td>Sigma</td><td>17L184</td><td>HEK cell maintenance</td></tr><tr><td>HEK293T cells</td><td>ATCC</td><td></td><td>Model system</td></tr><tr><td>ImageJ</td><td>NIH</td><td>V: 2.0.0-rc-69/1.52p</td><td>Image analysis</td></tr><tr><td>Magnesium Chloride hexahydrate</td><td>Sigma</td><td>M9272-500G</td><td>HEK cell resuspension</td></tr><tr><td>Sodium phosphate dibasic anhydrous</td><td>Fisher BioReagents</td><td>BP332-500</td><td>Calcium phosphate transfection</td></tr><tr><td>Trypsin 0.25% (1X) Solution</td><td>GE Healthcare Life Sciences</td><td>SH30042.01</td><td>Passaging HEK cells</td></tr><tr><td>Tube rotator</td><td></td><td></td><td>Incubation of mixed population of HEK cells</td></tr><tr><td>UltraClear Microscope slides. White Frosted, Positive Charged</td><td>Denville Scientific Inc.</td><td>M1021</td><td>Image acquisition</td></tr><tr><td>Wide-field microscope</td><td>Zeiss</td><td>Axio Vert 200M</td><td>Image acquisition</td></tr></tbody></table>

measuring transcellular interactions through protein aggregation in a heterologous cell system

Las interacciones proteicas en las interfaces celulares dictan una multitud de resultados biológicos que van desde el desarrollo de tejidos y la progresión del cáncer hasta la formación y mantenimiento de sinapsis. Muchas de estas interacciones fundamentales ocurren en trans y suelen ser inducidas por interacciones heterofílicas u homofílicas entre células que expresan pares de unión anclados por membrana. Dilucidar cómo las mutaciones relevantes para la enfermedad interrumpen estas interacciones proteicas fundamentales puede proporcionar una visión de una miríada de campos de biología celular. Muchos ensayos de interacción proteína-proteína no suelen desambiguar entre las interacciones cis y trans, lo que potencialmente conduce a una sobreestimación del grado de unión que se está produciendo in vivo e implican la purificación intensiva de proteínas y/o equipos de monitoreo especializados. Aquí, presentamos un protocolo simple optimizado que permite la observación y cuantificación de sólo interacciones trans sin necesidad de largas purificaciones de proteínas o equipos especializados. El ensayo de agregación celular HEK implica la mezcla de dos poblaciones independientes de células HEK, cada una expresando ligandos de cognato unidos a membrana. Después de un breve período de incubación, las muestras se muestran en imágenes y se cuantifican los agregados resultantes.

La mutación A687T aumenta la unión de Neurexin3α SS4 a LRRTM27 Para investigar cómo las interacciones intercelulares de dos proteínas sinápticas conocidas se ven afectadas por la introducción de una mutación puntual encontrada en un paciente con discapacidad intelectual y epilepsia, utilizamos el ensayo de agregación celular HEK anterior (Figura 1). Las células fueron transfectadas de acuerdo con la sección 1 y preparadas para la toma de imágenes de...

Watch this Scientific Journal Video about Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System at JoVE.com

Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Aquí, presentamos un protocolo optimizado para medir rápida y semicuantitativamente las interacciones ligando-receptor en trans en un sistema celular heterologoso utilizando microscopía de fluorescencia.

Medición de interacciones transcelulares a través de la agregación de proteínas en un sistema celular heterologoso

Protein interactions at cellular interfaces dictate a multitude of biological outcomes ranging from tissue development and cancer progression to synapse ...

measuring-transcellular-interactions-through-protein-aggregation

Universidad de Cartagena UDEC

Research

JoVE Journal

Neuroscience

3.4K vistas.  University of Colorado Denver School of Medicine. Aquí, presentamos un protocolo optimizado para medir rápida y semicuantitativamente las interacciones ligando-receptor en trans en un sistema celular heterologoso utilizando microscopía de fluorescencia.

Video: Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Extracellular Protein Microarray Technology for High Throughput Detection of Low Affinity Receptor-Ligand Interactions

Secreted factors, membrane-tethered receptors, and their interacting partners are main regulators of cellular communication and initiation of signaling cascades during homeostasis and disease, and as such represent prime therapeutic targets. Despite their relevance, these interaction networks remain significantly underrepresented in current databases; therefore, most extracellular proteins have no documented binding partner. This discrepancy is primarily due to the challenges associated with the study of the extracellular proteins, including expression of functional proteins, and the weak, low affinity, protein interactions often established between cell surface receptors. The purpose of this method is to describe the printing of a library of extracellular proteins in a microarray format for screening of protein-protein interactions. To enable detection of weak interactions, a method based on multimerization of the query protein under study is described. Coupled to this microbead-based multimerization approach for increased multivalency, the protein microarray allows robust detection of transient protein-protein interactions in high throughput. This method offers a rapid and low sample consuming-approach for identification of new interactions applicable to any extracellular protein. Protein microarray printing and screening protocol are described. This technology will be useful for investigators seeking a robust method for discovery of protein interactions in the extracellular space.

Here, we present a protocol to screen extracellular protein microarrays for identification of novel receptor-ligand interactions in high throughput. We also describe a method to enhance detection of transient protein-protein interactions by using protein-microbead complexes.

Tecnología de microarrays de proteínas extracelulares para detección de alto rendimiento de las interacciones ligando-Receptor de baja afinidad

Secreted factors, membrane-tethered receptors, and their interacting partners are main regulators of cellular communication and initiation of signaling ...

Investigación

Bioquímica

A Fluorescence Fluctuation Spectroscopy Assay of Protein-Protein Interactions at Cell-Cell Contacts

A variety of biological processes involves cell-cell interactions, typically mediated by proteins that interact at the interface between neighboring cells. Of interest, only few assays are capable of specifically probing such interactions directly in living cells. Here, we present an assay to measure the binding of proteins expressed at the surfaces of neighboring cells, at cell-cell contacts. This assay consists of two steps: mixing of cells expressing the proteins of interest fused to different fluorescent proteins, followed by fluorescence fluctuation spectroscopy measurements at cell-cell contacts using a confocal laser scanning microscope. We demonstrate the feasibility of this assay in a biologically relevant context by measuring the interactions of the amyloid precursor-like protein 1 (APLP1) across cell-cell junctions. We provide detailed protocols on the data acquisition using fluorescence-based techniques (scanning fluorescence cross-correlation spectroscopy, cross-correlation number and brightness analysis) and the required instrument calibrations. Further, we discuss critical steps in the data analysis and how to identify and correct external, spurious signal variations, such as those due to photobleaching or cell movement.
In general, the presented assay is applicable to any homo- or heterotypic protein-protein interaction at cell-cell contacts, between cells of the same or different types and can be implemented on a commercial confocal laser scanning microscope. An important requirement is the stability of the system, which needs to be sufficient to probe diffusive dynamics of the proteins of interest over several minutes.

This protocol describes a fluorescence fluctuation spectroscopy-based approach to investigate interactions among proteins mediating cell-cell interactions, i.e. proteins localized in cell junctions, directly in living cells. We provide detailed guidelines on instrument calibration, data acquisition and analysis, including corrections to possible artefact sources.

Un análisis de espectroscopia de fluorescencia fluctuación de interacciones de proteínas en los contactos célula-célula

A variety of biological processes involves cell-cell interactions, typically mediated by proteins that interact at the interface between neighboring ...

Bead Aggregation Assays for the Characterization of Putative Cell Adhesion Molecules

Cell-cell adhesion is fundamental to multicellular life and is mediated by a diverse array of cell surface proteins. However, the adhesive interactions for many of these proteins are poorly understood. Here we present a simple, rapid method for characterizing the adhesive properties of putative homophilic cell adhesion molecules. Cultured HEK293 cells are transfected with DNA plasmid encoding a secreted, epitope-tagged ectodomain of a cell surface protein. Using functionalized beads specific for the epitope tag, the soluble, secreted fusion protein is captured from the culture medium. The coated beads can then be used directly in bead aggregation assays or in fluorescent bead sorting assays to test for homophilic adhesion. If desired, mutagenesis can then be used to elucidate the specific amino acids or domains required for adhesion. This assay requires only small amounts of expressed protein, does not require the production of stable cell lines, and can be accomplished in 4 days.

Here we present a simple, rapid method for characterizing the intrinsic adhesive properties of putative cell adhesion molecules. The secreted, epitope-tagged ectodomain of a cell adhesion molecule is captured from the culture medium on small, uniform functionalized beads. These beads can then be used immediately in simple bead aggregation assays.

Grano de agregación Los ensayos para la caracterización de Putativos Moléculas de Adhesión Celular

Cell-cell adhesion is fundamental to multicellular life and is mediated by a diverse array of cell surface proteins. However, the adhesive interactions ...

Bioingeniería

Monitoring Protein Aggregation Kinetics In Vivo using Automated Inclusion Counting in Caenorhabditis elegans

Protein aggregation into insoluble inclusions is a hallmark of a variety of human diseases, many of which are age-related. The nematode Caenorhabditis elegans is a well-established model organism that has been widely used in the field to study protein aggregation and toxicity. Its optical transparency enables the direct visualization of protein aggregation by fluorescence microscopy. Moreover, the fast reproductive cycle and short lifespan make the nematode a suitable model to screen for genes and molecules that modulate this process.
However, the quantification of aggregate load in living animals is poorly standardized, typically performed by manual inclusion counting under a fluorescence dissection microscope at a single time point. This approach can result in high variability between observers and limits the understanding of the aggregation process. In contrast, amyloid-like protein aggregation in vitro is routinely monitored by thioflavin T fluorescence in a highly quantitative and time-resolved fashion.
Here, an analogous method is presented for the unbiased analysis of aggregation kinetics in living C. elegans, using a high-throughput confocal microscope combined with custom-made image analysis and data fitting. The applicability of this method is demonstrated by monitoring inclusion formation of a fluorescently labeled polyglutamine (polyQ) protein in the body wall muscle cells. The image analysis workflow allows the determination of the numbers of inclusions at different timepoints, which are fitted to a mathematical model based on independent nucleation events in individual muscle cells. The method described here may prove useful to assess the effects of proteostasis factors and potential therapeutics for protein aggregation diseases in a living animal in a robust and quantitative manner.

Monitoring Protein Aggregation Kinetics In Vivo using Automated Inclusion Counting in Caenorhabditis elegans

Here, a method is presented for the analysis of protein aggregation kinetics in the nematode Caenorhabditis elegans. Animals from an age-synchronized population are imaged at different time points, followed by semiautomated inclusion counting in CellProfiler and fitting to a mathematical model in AmyloFit.

Monitoreo de la cinética de agregación de proteínas in vivo mediante el conteo automatizado de inclusión en Caenorhabditis elegans

Protein aggregation into insoluble inclusions is a hallmark of a variety of human diseases, many of which are age-related. The nematode Caenorhabditis ...

Pulldown Assay Coupled with Co-Expression in Bacteria Cells as a Time-Efficient Tool for Testing Challenging Protein-Protein Interactions

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble effectively in vitro. Such complexes may require co-translational assembly and the presence of molecular chaperones; either they form stable oligomers which cannot dissociate and re-associate in vitro or are unstable without a binding partner. To overcome these problems, it is possible to use a method based on the bacterial co-expression of differentially tagged proteins using a set of compatible vectors followed by the conventional pulldown techniques. The workflow is more time-efficient compared to traditional pulldown because it lacks the time-consuming steps of separate purification of interacting proteins and their following incubation. Another advantage is a higher reproducibility due to a significantly smaller number of steps and a shorter period of time in which proteins that exist within the in vitro environment are exposed to proteolysis and oxidation. The method was successfully applied for studying a number of protein-protein interactions when other in vitro techniques were found to be unsuitable. The method can be used for batch testing protein-protein interactions. Representative results are shown for studies of interactions between BTB domain and intrinsically disordered proteins, and of heterodimers of zinc-finger-associated domains.

Here, we describe a method for the bacterial co-expression of differentially tagged proteins using a set of compatible vectors, followed by the conventional pulldown techniques to study protein complexes that cannot assemble in vitro.

Ensayo pulldown junto con coexpresión en células bacterianas como una herramienta eficiente en el tiempo para probar interacciones desafiantes proteína-proteína

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble ...

4D Imaging of Protein Aggregation in Live Cells

One of the key tasks of any living cell is maintaining the proper folding of newly synthesized proteins in the face of ever-changing environmental conditions and an intracellular environment that is tightly packed, sticky, and hazardous to protein stability1. The ability to dynamically balance protein production, folding and degradation demands highly-specialized quality control machinery, whose absolute necessity is observed best when it malfunctions. Diseases such as ALS, Alzheimer's, Parkinson's, and certain forms of Cystic Fibrosis have a direct link to protein folding quality control components2, and therefore future therapeutic development requires a basic understanding of underlying processes. Our experimental challenge is to understand how cells integrate damage signals and mount responses that are tailored to diverse circumstances.
The primary reason why protein misfolding represents an existential threat to the cell is the propensity of incorrectly folded proteins to aggregate, thus causing a global perturbation of the crowded and delicate intracellular folding environment1. The folding health, or "proteostasis," of the cellular proteome is maintained, even under the duress of aging, stress and oxidative damage, by the coordinated action of different mechanistic units in an elaborate quality control system3,4. A specialized machinery of molecular chaperones can bind non-native polypeptides and promote their folding into the native state1, target them for degradation by the ubiquitin-proteasome system5, or direct them to protective aggregation inclusions6-9.
In eukaryotes, the cytosolic aggregation quality control load is partitioned between two compartments8-10: the juxtanuclear quality control compartment (JUNQ) and the insoluble protein deposit (IPOD) (Figure 1 - model). Proteins that are ubiquitinated by the protein folding quality control machinery are delivered to the JUNQ, where they are processed for degradation by the proteasome. Misfolded proteins that are not ubiquitinated are diverted to the IPOD, where they are actively aggregated in a protective compartment.
Up until this point, the methodological paradigm of live-cell fluorescence microscopy has largely been to label proteins and track their locations in the cell at specific time-points and usually in two dimensions. As new technologies have begun to grant experimenters unprecedented access to the submicron scale in living cells, the dynamic architecture of the cytosol has come into view as a challenging new frontier for experimental characterization. We present a method for rapidly monitoring the 3D spatial distributions of multiple fluorescently labeled proteins in the yeast cytosol over time. 3D timelapse (4D imaging) is not merely a technical challenge; rather, it also facilitates a dramatic shift in the conceptual framework used to analyze cellular structure.
We utilize a cytosolic folding sensor protein in live yeast to visualize distinct fates for misfolded proteins in cellular aggregation quality control, using rapid 4D fluorescent imaging. The temperature sensitive mutant of the Ubc9 protein10-12 (Ubc9ts) is extremely effective both as a sensor of cellular proteostasis, and a physiological model for tracking aggregation quality control. As with most ts proteins, Ubc9ts is fully folded and functional at permissive temperatures due to active cellular chaperones. Above 30 &deg;C, or when the cell faces misfolding stress, Ubc9ts misfolds and follows the fate of a native globular protein that has been misfolded due to mutation, heat denaturation, or oxidative damage. By fusing it to GFP or other fluorophores, it can be tracked in 3D as it forms Stress Foci, or is directed to JUNQ or IPOD.

Cellular viability depends on timely and efficient management of protein misfolding. Here we describe a method for visualizing the different potential fates of a misfolded protein: refolding, degradation, or sequestration in inclusions. We demonstrate the use of a folding sensor, Ubc9ts, for monitoring proteostasis and aggregation quality control in live cells using 4D microscopy.

4D de imágenes de la agregación de proteínas en células vivas

One of the key tasks of any living cell is maintaining the proper folding of newly synthesized proteins in the face of ever-changing environmental ...

Biología

Genetic and Biochemical Approaches for In Vivo and In Vitro Assessment of Protein Oligomerization: The Ryanodine Receptor Case Study

Oligomerization is often a structural requirement for proteins to accomplish their specific cellular function. For instance, tetramerization of the ryanodine receptor (RyR) is necessary for the formation of a functional Ca2+ release channel pore. Here, we describe detailed protocols for the assessment of protein self-association, including yeast two-hybrid (Y2H), co-immunoprecipitation (co-IP) and chemical cross-linking assays. In the Y2H system, protein self-interaction is detected by &#946;-galactosidase assay in yeast co-expressing GAL4 bait and target fusions of the test protein. Protein self-interaction is further assessed by co-IP using HA- and cMyc-tagged fusions of the test protein co-expressed in mammalian HEK293 cells. The precise stoichiometry of the protein homo-oligomer is examined by cross-linking and SDS-PAGE analysis following expression in HEK293 cells. Using these different but complementary techniques, we have consistently observed the self-association of the RyR N-terminal domain and demonstrated its intrinsic ability to form tetramers. These methods can be applied to protein-protein interaction and homo-oligomerization studies of other mammalian integral membrane proteins.

Genetic and Biochemical Approaches for In Vivo and In Vitro Assessment of Protein Oligomerization: The Ryanodine Receptor Case Study

Oligomerization of the ryanodine receptor, a homo-tetrameric ion channel mediating Ca2+ release from intracellular stores, is critical for skeletal and cardiac muscle contraction. Here, we present complementary in vivo and in vitro methods to detect protein self-association and determine homo-oligomer stoichiometry.

Los enfoques genéticos y bioquímicos para<em&gt; En Vivo</em&gt; y<em&gt; In Vitro</em&gt; Evaluación de la oligomerización de proteínas el receptor de rianodina Estudio de caso

Oligomerization is often a structural requirement for proteins to accomplish their specific cellular function. For instance, tetramerization of the ...

In Situ Monitoring of Transiently Formed Molecular Chaperone Assemblies in Bacteria, Yeast, and Human Cells

J-domain proteins (JDPs) form the largest and the most diverse co-chaperone family in eukaryotic cells. Recent findings show that specific members of the JDP family could form transient heterocomplexes in eukaryotes to fine-tune substrate selection for the 70 kDa heat shock protein (Hsp70) chaperone-based protein disaggregases. The JDP complexes target acute/chronic stress induced aggregated proteins and presumably help assemble the disaggregases by recruiting multiple Hsp70s to the surface of protein aggregates. The extent of the protein quality control (PQC) network formed by these physically interacting JDPs remains largely uncharacterized in vivo. Here, we describe a microscopy-based in situ protein interaction assay named the proximity ligation assay (PLA), which is able to robustly capture&#160;these transiently formed chaperone complexes in distinct cellular compartments of eukaryotic cells. Our work expands the employment of PLA from human cells to yeast (Saccharomyces cerevisiae) and bacteria (Escherichia coli), thus rendering an important tool to monitor the dynamics of transiently formed protein assemblies in both prokaryotic and eukaryotic cells.

Cognate J-domain proteins cooperate with the Hsp70 chaperone to assist in a myriad of biological processes ranging from protein folding to degradation. Here, we describe an in situ proximity ligation assay, which allows the monitoring of these transiently formed chaperone machineries in bacterial, yeast and human cells.

Monitoreo in situ de conjuntos de chaperona molecular formadas transitoriamente en bacterias, levaduras y células humanas

J-domain proteins (JDPs) form the largest and the most diverse co-chaperone family in eukaryotic cells. Recent findings show that specific members of the ...

Cuantificación de interacciones de proteínas basada en imágenes de molécula única de células vivas

Single-Molecule Measurement of Protein Interaction Dynamics Within Biomolecular Condensates

Biomolecular condensates formed via liquid-liquid phase separation (LLPS) have been considered critical in cellular organization and an increasing number of cellular functions. Characterizing LLPS in live cells is also important because aberrant condensation has been linked to numerous diseases, including cancers and neurodegenerative disorders. LLPS is often driven by selective, transient, and multivalent interactions between intrinsically disordered proteins. Of great interest are the interaction dynamics of proteins participating in LLPS, which are well-summarized by measurements of their binding residence time (RT), that is, the amount of time they spend bound within condensates. Here, we present a method based on live-cell single-molecule imaging that allows us to measure the mean RT of a specific protein within condensates. We simultaneously visualize individual protein molecules and the condensates with which they associate, use single-particle tracking (SPT) to plot single-molecule trajectories, and then fit the trajectories to a model of protein-droplet binding to extract the mean RT of the protein. Finally, we show representative results where this single-molecule imaging method was applied to compare the mean RTs of a protein at its LLPS condensates when fused and unfused to an oligomerizing domain. This protocol is broadly applicable to measuring the interaction dynamics of any protein that participates in LLPS.

Autor destacado: Evaluación de la dinámica proteína-condensado en células humanas vivas

Many intrinsically disordered proteins have been shown to participate in the formation of highly dynamic biomolecular condensates, a behavior important for numerous cellular processes. Here, we present a single-molecule imaging-based method for quantifying the dynamics by which proteins interact with each other in biomolecular condensates in live cells.

Medición de una sola molécula de la dinámica de interacción de proteínas dentro de condensados biomoleculares

Biomolecular condensates formed via liquid-liquid phase separation (LLPS) have been considered critical in cellular organization and an increasing number ...

Medición de interacciones transcelulares a través de la agregación de proteínas en un sistema celular heterologoso

Resumen

Explorar más videos

Capítulos en este video

Tecnología de microarrays de proteínas extracelulares para detección de alto rendimiento de las interacciones ligando-Receptor de baja afinidad

Un análisis de espectroscopia de fluorescencia fluctuación de interacciones de proteínas en los contactos célula-célula

Grano de agregación Los ensayos para la caracterización de Putativos Moléculas de Adhesión Celular

Monitoreo de la cinética de agregación de proteínas in vivo mediante el conteo automatizado de inclusión en Caenorhabditis elegans

Ensayo pulldown junto con coexpresión en células bacterianas como una herramienta eficiente en el tiempo para probar interacciones desafiantes proteína-proteína

4D de imágenes de la agregación de proteínas en células vivas

Los enfoques genéticos y bioquímicos para

Monitoreo in situ de conjuntos de chaperona molecular formadas transitoriamente en bacterias, levaduras y células humanas

Medición de una sola molécula de la dinámica de interacción de proteínas dentro de condensados biomoleculares

Medición de una sola molécula de la dinámica de interacción de proteínas dentro de condensados biomoleculares