Name: site specific lysine acetylation of histones for nucleosome reconstitution using genetic code expansion in escherichia coli
Uploaded: 2020-12-26T14:00:00.000+00:00
Duration: 7 min 26 s
Description: Watch this Scientific Journal Video about Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli at JoVE.com

Wir danken Dr. Wesley Wang für die Grundlagen für dieses Protokoll und seine wertvolle Mentorenschaft. Diese Arbeit wurde teilweise von den National Institutes of Health (Grants R01GM127575 und R01GM121584) und der Welch Foundation (Grant A-1715) unterstützt.

1. Plasmidkonstruktion
<ol><li>Beginnen Sie mit der Entscheidung, welches Histonprotein acetyliert wird und an welcher Lysin-Stelle. Mutieren Sie die Seite zum Bernstein-Stop-Codon (TAG) mit Website gerichtet Etagenese. HINWEIS: Es gibt vier zuvor entwickelte Plasmide, die für die Expression von Histonproteinen verwendet werden. Alle vier Histonproteine wurden mit einem N-terminalen Histidin-Tag in den pETDuet-1-Vektor geklont. Histone H4 enthält auch ein SUMO-Tag, den Ursprung der Replikation colE1 mit einer Kopiernummer von etwa 40, Ampicillin-resistent, und ein T7-Promoter.<ol>
<li>Entwerfen Sie Vorwärts- und Rückwärtsprimer, die eine TAG-Mutation an der gewünschten Stelle enthalten (ersetzen eines vorhandenen Lysin-Codons durch das Bernstein-Stop-Codon) in einem der vier Histonproteinplasmide.</li>
		<li>Verwenden Sie Vollplasmid-PCR, um das TAG-haltige Plasmid zu verstärken. Bestimmen Sie eine geeignete Glühtemperatur für die Primer. Im Allgemeinen reicht die Schmelztemperatur (Tm) der Primer minus 5 °C aus. Bei Schwierigkeiten bei der Herstellung eines PCR-Produkts kann ein Temperaturgradient um Tm - 5 °C verwendet werden, um die Glühtemperatur für die Amplifikation zu optimieren. HINWEIS: In diesem Experiment wurde eine hauseigene pFU-Polymerase für 30 Zyklen mit folgenden Bedingungen verwendet: 94 °C für 30 s (Denaturierung), Glühtemperatur für 30 s und 72 °C für 6 min (oder 1 min pro Kilobase-Paar). Weitere Informationen zu dieser Art von PCR-Methode finden Sie unter Liu und Naismith7.</li>
		<li>Bereinigen Sie das PCR-Produkt mit einem PCR-Bereinigungskit, indem Sie das Herstellerprotokoll befolgen. Analysieren Sie das PCR-Produkt durch Agarose-Gel-Elektrophorese und anschließende Ethidiumbromidfärbung.</li>
		<li>Ligate das Plasmid durch Inkubieren mit T4 Ligase über Nacht bei 16 °C.</li>
	</ol>
</li>
	<li>Verwandeln Sie zunächst das TAG-haltige Plasmid (AmpR) in chemisch kompetente Escherichia coli. Wählen Sie mindestens 4 Kolonien aus der Transformation und reinigen Sie das Plasmid. Machen Sie Zellbestände mit Glycerin nach Standardmethoden und lagern Sie bei -80 °C. Senden Sie zur Sequenzierung, um die gewünschte TAG-Mutation zu bestätigen.</li>
	<li>Sobald die Sequenz bestätigt ist, transformieren Sie das TAG-haltige Plasmid (AmpR) mit pEVOL-AckRS (ChlR) in chemisch kompetentes CobB (das einzige in E. coli.) bekannte Histonlysin-Deacetylase, das BL21-Zellen mit der Wärmeschockmethode löscht. pEVOL ist ein Plasmid mit einer Mittleren Kopierzahl bis zum Ursprung p15A mit niedriger Kopiernummer. HINWEIS: Die pEVOL-Reihe von Plasmiden wurde auf der Grundlage früherer Studien erstellt, die zeigten, dass eine erhöhte Expression des orthogonalen AaRS/tRNATyr-Paares wirksam bei der Verringerung der Proteinkürzung und bei der Erhöhung der Gesamtausbeute mutierter Proteine8war. Wenn CobB-Deletionszellen nicht zugänglich sind, fahren Sie mit chemisch kompetenten BL21-Zellen fort. CobB ist ein Sirtuin-ähnliches Histon-Lysin-Deacetylase und Nicotinamid kann in einer Endkonzentration von 5 mM während der Histonproteinexpression zugesetzt werden, um CobB als alternativen Ansatz zu hemmen9.</li>
	<li>Machen Sie einen Zellbestand und lagern Sie bei -80 °C.</li>
</ol>2. Acetylatierte Histonproteinexpression
<ol><li>Bereiten Sie 1 L autoklavierte 2YT-Medien (oder Volumen ihrer Wahl) in einem Kulturkolben vor.</li>
	<li>20 ml 2YT-Medien mit den entsprechenden Antibiotika mit dem kotransformierten Zellbestand, der das TAG-haltige Plasmid (AmpR) und pEVOL-AckRS (ChlR) enthält, impfen und bei 37 °C bis OD = 0,6 (4-6 h) wachsen.</li>
	<li>Fügen Sie die entsprechenden Antibiotika zu den 1 L autoklavierten 2YT-Medien hinzu und impfen Sie mit der 20 ml-Starterkultur. Wachsen bei 37 °C bis OD = 0,6-0,8 (2-3 h).</li>
	<li>Fügen Sie induzierende Mittel und Acetyllysin (AcK) zu den Endkonzentrationen von IPTG 1 mM, 0,2% Arabinose und AcK 5 mM hinzu.</li>
	<li>Wachsen Sie die Kultur bei 37 °C für 6-8 h.</li>
	<li>Pelletzellen bei 2.700 x g für 15 min.</li>
	<li>Lagern Sie das Zellpellet über Nacht bei -80 °C.</li>
	<li>Ab diesem Schritt halten Sie die Probe immer auf Eis. Lösen Sie das Zellpellet in 50 ml Histonlysepuffer pro 1 L Kultur.</li>
	<li>Beschallen nach dem folgenden Zyklus: 1 s an, 1 s aus, gesamtzeit: 3 min bei 60% Amplitude.</li>
	<li>Pellet-Einschlusskörper bei 41.600 x g für 45 min.</li>
	<li>Entsorgen Sie den Überstand und setzen Sie die Einschlusskörper in 30 ml Histonlysepuffer wieder aus. Pellet-Einschluss verheißt bei 41.600 x g für 30 min.</li>
	<li>Entsorgen Sie den Überstand und setzen Sie die Einschlusskörper in 30 ml Pelletwaschpuffer wieder aus. Pellet-Einschlusskörper bei 41.600 x g für 30 min.</li>
	<li>Entsorgen Sie den Überstand und lösen Sie die Einschlüsse in 25 ml von 6 M Guanidinhydrochlorid (GuHCl) Puffer auf. Mit Rührung bei 37 °C für 1 h inkubieren. HINWEIS: Bei Bedarf können Einschlusskörper über Nacht bei 4 °C mit Rührung inkubiert werden.</li>
	<li>Pellet-Einschluss verheißt 45 min. 41.600 x g. Inkubieren Sie den Überstand mit 1 ml Ni-NTA Harz, der mit 6 M GuHCl Puffer für 2 h ausgeglichen wird.</li>
	<li>Fahren Sie mit der Ni-NTA-Reinigung unter denaturierten Bedingungen fort. Waschen Sie die Spalte mit 3 Spaltenvolumen des Spaltenwaschpuffers. Elute acetylierte Stonprotein mit 10 ml Elutionspuffer. HINWEIS: Der Versuch, das Protein hier zu konzentrieren, ist eine Option, aber acetylierte Histone sind sehr unvorhersehbar und können leicht ausfallen. Es wird nicht empfohlen, sich über 2 ml gesamtvolumen zu konzentrieren.</li>
	<li>Extensiv dialysieren das acetylierte Histonprotein gegen 5% Essigsäurepuffer, um Salze zu entfernen. Dialyse für 3 h zu einer Zeit bei 4 °C, Austausch gegen frischen Puffer mindestens 6 mal. HINWEIS: Für eine verbesserte Proteinreinheit gibt es eine Option, gegen reines Wasser zu dialysieren. Dies führt jedoch zu einer erheblichen Niederschlagsmenge und Ertragsminderung, die bei ertragsarmen acetylierten Histonproteinen unerwünscht sein kann.</li>
	<li>Aliquot und Lyophilize Protein, und speichern sie unbegrenzt bei -80 °C. Wildtyp-Histonproteine ergeben in der Regel 10-50 mg/L, während acetylierte Histonproteine je nach spezifischer Lysin-Site weniger als 10 mg/L ergeben. H3K79Ac durchschnittlich 5 mg/L.</li>
</ol>3. Wildtyp-Histonproteinexpression
<ol><li>Um vollständige Nukleosomen zu montieren, drücken Sie alle 4 Histonproteine aus. Beim Ausdrücken und Reinigen von Wildtyphistonen ist das Protokoll mit den acetylierten Histonen identisch, mit Ausnahme der folgenden:<ol>
<li>Führen Sie keine Co-Transformation durch. Verwenden Sie pEVOL-AcKRS nicht für den Typ Histone-Ausdruck. Passen Sie Antibiotika entsprechend an.</li>
		<li>Verwenden Sie keine CobB-Deletionszelllinie oder fügen Sie Nicotinamid, AcK oder Arabinose während der Induktion der zellulären Expression hinzu.</li>
	</ol>
</li>
</ol>4. Herstellung von 601 DNA
HINWEIS: Eine zuvor entwickelte optimierte DNA-Sequenz zur direkten Nukleosompositionierung wird mit Histon-Okimatoren zusammengesetzt, um Mononukleosom mit hoher Effizienz zu produzieren. Diese Sequenz wird als 601 DNA oder die Widom-Sequenz bezeichnet. Diese Sequenz ist zur Standard-DNA-Sequenz für In-vitro-Studien von Nukleosomen von Chromatin-Remodeling-Assays bis hin zu Einzelmolekülmessungen10geworden.
<ol><li>Um signifikante Mengen von 601 DNA für die Nukleom-Montage vorzubereiten, transformieren Sie pGEM-3z/601 in Top 10 Zellen und wachsen 10 ml Kultur für die Plasmidverstärkung und Extraktion. Verwenden Sie ein Plasmid-Extraktionskit und folgen Sie der Empfehlung des Herstellers.</li>
	<li>Verwenden Sie für dieses Amplifikationsprotokoll eine im Eigenen Haus ausgedrückte PFU-Polymerase (effizienter). Einrichten einer PCR-Reaktion: Verwenden Sie für die 250-L-Reaktion 207,5 l autoklaviertes MQ H2O, 25 l 10x PFU-Puffer, 5 l Vorwärts-Primer: ctggagaatcccggtgccg, 5 l Reverse Primer: acaggatgtatatatctgacacg, 5 l dNTP-Mix, 2,5 l PFU-Enzym. Wir führen in der Regel 60 Reaktionen auf einmal aus, um genügend DNA zu erhalten, um sich zusammenzusetzen.</li>
	<li>Verwenden Sie eine Glühtemperatur von 52 °C für 30 s und eine Verlängerungszeit von 30 s bei Verwendung von PFU-Polymerase. Ansonsten folgen Sie den empfohlenen Bedingungen des Herstellers.</li>
	<li>Sobald PCR fertig ist, verwenden Sie ein PCR-Reinigungskit ihrer Wahl, um das PCR-Produkt zu reinigen.</li>
</ol>5. Montage des Histon-Oktobeers
<ol><li>Lösen Sie Aliquots der Histonproteinpellets H2A, H2B, H3 und H4 auf, so dass es einen separaten Vorrat an jedem Histonprotein in GuHCl Buffer mit einem Gesamtvolumen von 100 l gibt.</li>
	<li>Berechnen Sie die Konzentration jedes Histonproteins, indem Sie die A280-Absorption messen.</li>
	<li>Wenn die Absorption für jedes Protein größer als 1 ist, verdünnen Sie mit GuHCl-Puffer, um eine genauere Konzentration zu erhalten.</li>
	<li>Kombinieren Sie H2A- und H2B-Proteine in einem 1:1-Molarenverhältnis und verdünnen Sie sie auf eine Gesamtproteinkonzentration von 4 g/l. Wiederholen Sie dies für H3 und H4.</li>
	<li>Dialyse sequenziell bei 4 °C gegen 2 M TE Puffer über Nacht, 1 M TE Puffer für 2 h und 0,5 M TE Puffer für 5 h. HINWEIS: Der zweite und dritte Schritt der Dialyse bewirkt, dass instabile Konformationen des Proteins ausfallen. Es wird erwartet, dass es an diesen Stufen starke Niederschläge gibt.</li>
	<li>Ausscheide durch Zentrifugation bei 16.800 x g bei 4 °C entfernen.</li>
	<li>Berechnen Sie erneut die Konzentration von Histondimermen (H2A/H2B-Gemisch) und Tetrameren (H3/H4-Gemisch), die die A280-Absorption messen.</li>
	<li>Mischen Sie Dimere und Tetramere in einem 1:1-Molarenverhältnis und stellen Sie NaCl durch Zugabe von festem NaCl auf 2 M ein.</li>
	<li>Histon-Oktomater kann bei 4 °C gelagert werden und ist stabiler als Dimere und Tetramere. Niemals Histone-Okamer einfrieren, da dies zu Einer Demontage führen kann.</li>
	<li>Wenn Sie sich mit acetylierten Histonen zusammensetzen, ersetzen Sie einfach das Wildtyp-Protein durch das acetylierte Protein im Verfahren.</li>
</ol>6. Nukleosom-Montage
<ol><li>Verwenden Sie 100x TE-Puffer und soliden NaCl, um 601 DNA auf 2M TE-Puffer einzustellen. Fügen Sie die 601 DNA in 2M TE Puffer zu Histon-Okamer in einem Molaren-Verhältnis von 0,85:1 bis 0,90:1 hinzu. Ein niedrigeres Verhältnis von DNA kann hinzugefügt werden, wenn freie DNA in der Gelverschiebungsanalyse vorhanden ist.</li>
	<li>Das DNA-Histon-Gemisch einen Dialysebeutel übertragen und in ca. 200 ml 2M TE-Puffer (oder mehr bei der Montage mehrerer Proben) platzieren und bei 4 °C sehr sanft umrühren.</li>
	<li>Stellen Sie eine peristaltische Pumpe ein, um langsam in keinen SalzTE-Puffer zu tropfen. Wenn sich das Volumen ungefähr verdoppelt hat, gießen Sie die Hälfte des Volumens aus. Tun Sie dies mindestens 4 Mal insgesamt. Bei einer Pumpe kann dies je nach Startvolumen 4-8 h dauern. Nukleosomen bilden sich, wenn die Salzkonzentration auf 150 mM reduziert wird (gemessen am Salzgehaltsmesser).</li>
	<li>Nachdem die Salzkonzentration auf 150 mM reduziert wurde, dialysieren Sie gegen einen 20 mM TE Puffer über Nacht.</li>
	<li>Ausscheidungen durch Zentrifugation entfernen und die Konzentration der Nukleosomen miteinem Plattenleser messen.</li>
	<li>Fügen Sie His-TEV Protease (TEV: Nukleosome 1:30, w:w ) und inkubieren über Nacht bei 4 °C, um alle Histidin-Tags zu entfernen. Entfernen Sie die Histidin-Tag-Verunreinigungen aus der Nukleosomlösung durch Ni-NTA-Harz nach unten ziehen.</li>
	<li>Um das Nukleosom zu positionieren und die Probe zu homogenisieren, bei 60 °C für 1 h inkubieren. HINWEIS: Für acetylierte Standorte, die besonders instabil sind, ist dieser Schritt möglicherweise nicht ratsam.</li>
	<li>Nukleosomen kurzfristig (einige Wochen) bei 4 °C lagern.</li>
	<li>Zur Langzeitlagerung Nukleosomen gegen Speicherpuffer dialysieren und bei -80 °C lagern.</li>
</ol>

<ol>
	<li>Srinivasan, G., James, C. M., Krzycki, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysine+encoded+by+UAG+in+Archaea:+Charging+of+a+UAG-Decoding+specialized+tRNA.">Pyrrolysine encoded by UAG in Archaea: Charging of a UAG-Decoding specialized tRNA.</a> Science. 296 (5572), 1459-1462 (2002).</li><li>Wan, W., Tharp, J. M., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysyl-tRNA+synthetase:+an+ordinary+enzyme+but+an+outstanding+genetic+code+expansion+tool.">Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool.</a> Biochimica Et Biophysica Acta. 1844 (6), 1059-1070 (2014).</li><li>Umehara, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-Acetyl+lysyl-tRNA+synthetases+evolved+by+a+CcdB-based+selection+possess+N-acetyl+lysine+specificity+in+vitro+and+in+vivo.">N-Acetyl lysyl-tRNA synthetases evolved by a CcdB-based selection possess N-acetyl lysine specificity in vitro and in vivo.</a> FEBS Letters. 586 (6), 729-733 (2012).</li><li>Hsu, W. W., Wu, B., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sirtuins+1+and+2+are+universal+histone+deacetylases.">Sirtuins 1 and 2 are universal histone deacetylases.</a> ACS Chemical Biology. 11 (3), 792-799 (2016).</li><li>Wang, W. W., Zeng, Y., Wu, B., Deiters, A., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chemical+biology+approach+to+reveal+Sirt6-targeted+histone+H3+sites+in+nucleosomes.">A chemical biology approach to reveal Sirt6-targeted histone H3 sites in nucleosomes.</a> ACS Chemical Biology. 11 (7), 1973-1981 (2016).</li><li>Wang, W. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+click+chemistry+approach+reveals+the+chromatin-dependent+histone+H3K36+deacylase+nature+of+SIRT7.">A click chemistry approach reveals the chromatin-dependent histone H3K36 deacylase nature of SIRT7.</a> Journal of the American Chemical Society. 141 (6), 2462-2473 (2019).</li><li>Liu, H., Naismith, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+one-step+site-directed+deletion,+insertion,+single+and+multiple-site+plasmid+mutagenesis+protocol.">An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol.</a> BMC Biotechnology. 8 (1), 91 (2008).</li><li>Young, T. S., Ahmad, I., Yin, J. A., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+enhanced+system+for+unnatural+amino+acid+mutagenesis+in+E.+coli.">An enhanced system for unnatural amino acid mutagenesis in E. coli.</a> Journal of Molecular Biology. 395 (2), 361-374 (2010).</li><li>Gallego-Jara, J., &#201;cija Conesa, A., de Diego Puente, T., Lozano Terol, G., C&#225;novas D&#237;az, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+CobB+kinetics+and+inhibition+by+nicotinamide.">Characterization of CobB kinetics and inhibition by nicotinamide.</a> PLoS One. 12 (12), 0189689 (2017).</li><li>Lowary, P. T., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+DNA+sequence+rules+for+high+affinity+binding+to+histone+octamer+and+sequence-directed+nucleosome+positioning.">New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning.</a> Journal of Molecular Biology. 276 (1), 19-42 (1998).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+of+tight+nuclear+tethering+and+inactivation+of+cGAS.">The molecular basis of tight nuclear tethering and inactivation of cGAS.</a> Nature. 587 (7835), 673-677 (2020).</li><li>Burdette, D. L., Vance, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+and+the+innate+immune+response+to+nucleic+acids+in+the+cytosol.">STING and the innate immune response to nucleic acids in the cytosol.</a> Nature Immunology. 14 (1), 19-26 (2013).</li><li>Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+immune+DNA+sensing+pathways:+STING,+AIMII+and+the+regulation+of+interferon+production+and+inflammatory+responses.">Innate immune DNA sensing pathways: STING, AIMII and the regulation of interferon production and inflammatory responses.</a> Current Opinion in Immunology. 23 (1), 10-20 (2011).</li><li>Ablasser, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cGAS+produces+a+2'-5'-linked+cyclic+dinucleotide+second+messenger+that+activates+STING.">cGAS produces a 2'-5'-linked cyclic dinucleotide second messenger that activates STING.</a> Nature. 498 (7454), 380-384 (2013).</li><li>Gao, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+[G(2',5')pA(3',5')p]+is+the+metazoan+second+messenger+produced+by+DNA-activated+cyclic+GMP-AMP+synthase.">Cyclic [G(2',5')pA(3',5')p] is the metazoan second messenger produced by DNA-activated cyclic GMP-AMP synthase.</a> Cell. 153 (5), 1094-1107 (2013).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conserved+PLPLRT/SD+motif+of+STING+mediates+the+recruitment+and+activation+of+TBK1.">A conserved PLPLRT/SD motif of STING mediates the recruitment and activation of TBK1.</a> Nature. 569 (7758), 718-722 (2019).</li></ol>

Es gibt keine konkurrierenden finanziellen Interessen, die von einem der Autoren zu erklären sind.

Es ist wichtig, dieses Protokoll während eines Experiments bis ins kleinste Detail zu befolgen. Nukleosomen sind nicht sehr stabil und viel Versuch und Irrtum ist in die Bestimmung dieses Protokolls gegangen. Es ist der Schlüssel, um Ausscheidungen bei jedem Schritt (oder wann immer beobachtet) zu entfernen, da Partikel leicht die Montageprozesse stören können. Halten Sie seine Tonproben immer auf Eis. Werden Nukleosomen zu lange bei 4 °C gelagert, können sie sich spontan zerlegen. Achten Sie darauf, alle Proben vo...

Wir haben PylRS und tRNAPyl verwendet, um rekonstituierte Mononukleosomen mit standortspezifischen acetylierten Histonen zu synthetisieren und zusammenzusetzen. PylRS hat sich als genetisches Codeerweiterungstool zur Herstellung von Proteinen mit posttranslationalen Modifikationen (PTMs) als unschätzbar erwiesen und wurde genetisch weiterentwickelt, um etwa 200 verschiedene ncAAs zu integrieren. PylRS enthält an einem Bernstein-Stop-Codon, wodurch die Konkurrenz von anderen Aminosäuren während der Übersetzung entfernt wird. PylRS wurde zuerst in methanogenen Archaeen entdeckt und wird seitdem in der chemischen Biologie verwendet, um neuartige reaktive chemische Gruppen in Proteine1,2zu integrieren.
MmAcKRS1 wurde aus Methanosarcina mazei PylRS entwickelt und häufig in unserem Labor für die Synthese von acetylierten Proteinen3,4,5,6verwendet. MmAcKRS1 liefert AcK an einer Bernsteinmutationsstelle in der mRNA der Wahl während der Übersetzung in Escherichia coli. Diese Technik wurde bisher verwendet, um AcK an K4, K9, K14, K18, K23, K27, K36, K56, K64 und K79 Histon H3 Lysin-Sites zu integrieren, um die Aktivität von Sirtuin 1, 2, 6 und 7 auf acetylierten Mononukleosomen4,5,6zu untersuchen. Hier beschreiben wir diese Methode, um acetylierte Histone auszudrücken und acetylierte Nukleosomen zu rekonstruieren.

<table><tbody><tr><td>0.5 M TE Buffer</td><td>NA</td><td>NA</td><td>0.5 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td></tr><tr><td>1 M TE Buffer</td><td>NA</td><td>NA</td><td>1 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td></tr><tr><td>100x TE Buffer</td><td>NA</td><td>NA</td><td></td></tr><tr><td>2 M TE Buffer</td><td>NA</td><td>NA</td><td>2 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td></tr><tr><td>20 mM TE Buffer</td><td>NA</td><td>NA</td><td>20 mM NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td></tr><tr><td>6 M GuHCl</td><td></td><td></td><td>6M guanidinium chloride, 20 mM Tris, 500 mM NaCl, pH 8.0</td></tr><tr><td>Acetyllysine</td><td></td><td></td><td></td></tr><tr><td>Column Wash Buffer</td><td>NA</td><td>NA</td><td>6 M urea, 500 mM NaCl, 20 mM Tris, 20 mM imidazole pH 7.8</td></tr><tr><td>Elution Buffer</td><td>NA</td><td>NA</td><td></td></tr><tr><td>Fisherbrand&amp;nbsp;Variable-Flow Chemical Transfer Pump</td><td>Fischer Scientific</td><td>15-077-67</td><td></td></tr><tr><td>His-TEV protease</td><td></td><td></td><td></td></tr><tr><td>Histone Lysis Buffer</td><td>NA</td><td>NA</td><td>60 mM Tris, 100 mM NaCl, 0.5% Triton-X100 (v/v), 1 mM PMSF pH 8.0</td></tr><tr><td>Ni-NTA Resin</td><td></td><td></td><td>6 M urea, 500 mM NaCl, 20 mM Tris, 250 mM imidazole, pH 7.8</td></tr><tr><td>PCR Clean-Up Kit</td><td>Epoch Life Sicences</td><td>2360050</td><td></td></tr><tr><td>Pellet Wash Buffer</td><td>NA</td><td>NA</td><td>60 mM Tris, 100 mM NaCl, pH 8.0</td></tr><tr><td>petDUET-His-SUMO-TEV-H4</td><td></td><td></td><td></td></tr><tr><td>petDUET-His-TEV-H2A</td><td></td><td></td><td></td></tr><tr><td>petDUET-His-TEV-H2B</td><td></td><td></td><td></td></tr><tr><td>petDUET-His-TEV-H3</td><td></td><td></td><td></td></tr><tr><td>pEVOL-AckRS</td><td>Addgene</td><td>137976</td><td></td></tr><tr><td>pGEM-3z/601</td><td>Addgene</td><td>26656</td><td></td></tr><tr><td>Storage Buffer</td><td>NA</td><td>NA</td><td>20 mM NaCl, 20 mM Tris, 20 mM NaCl, 1 mM EDTA, 20% glycerol, pH 7.8</td></tr><tr><td>Thermocycler</td><td></td><td></td><td></td></tr></tbody></table>

site specific lysine acetylation of histones for nucleosome reconstitution using genetic code expansion in escherichia coli

Acetylatierte Histonproteine können leicht in Escherichia coli exprimiert werden, die eine Mutante, Nε-Acetyl-Lysin (AcK)-spezifische Methanosarcina mazi pyrrolysinttRNA-Synthetase (MmAcKRS1) und ihre kognade tRNA (tRNAPyl) zur Zusammenstellung rekonstituierter Mononukleosomen mit MmAcKRS1 und tRNAPyl liefern AcK an einer Bernsteinmutationsstelle in der mRNA der Wahl während der Translation in Escherichia coli. Diese Technik wurde ausgiebig verwendet, um AcK an H3-Lysin-Standorten zu integrieren. Pyrrolysyl-tRNA-Synthetase (PylRS) kann auch leicht entwickelt werden, um andere nichtkanonische Aminosäuren (ncAAs) für die standortspezifische Proteinmodifikation oder -funktionalisierung zu integrieren. Hier beschreiben wir eine Methode, AcK mit dem MmAcKRS1-System in Histon H3 zu integrieren und acetylierte H3-Proteine in rekonstituierte Mononukleosomen zu integrieren. Acetylierte rekonstituierte Mononukleosomen können in biochemischen und verbindlichen Assays, Strukturbestimmung und mehr verwendet werden. Die Beschaffung modifizierter Mononukleosomen ist entscheidend für die Entwicklung von Experimenten im Zusammenhang mit der Entdeckung neuer Wechselwirkungen und dem Verständnis der Epigenetik.

Dimere, Tetramere und Okmamer können mit einem 12% SDS PAGE Gel bewertet werden (Abbildung 1 und Abbildung 2). Hier können Sie sehen, dass einige der acetylierten Tetramere eine geringere Ausbeute haben als andere (Abbildung 1). In der Tat, je näher an der Kernregion, desto niedriger der Ertrag beobachtet. Dies ist höchstwahrscheinlich auf die Acetylierung zurückzuführen, die die Zusammenstellu...

Watch this Scientific Journal Video about Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli at JoVE.com

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Hier präsentieren wir eine Methode, um acetylierte Histonproteine mittels genetischer Codeerweiterung auszudrücken und rekonstituierte Nukleosomen in vitro zusammenzusetzen.

Ortsspezifische Lysin-Acetylierung von Histonen zur Nukleosomen-Rekonstitution mit genetischer Codeerweiterung bei Escherichia coli

Acetylated histone proteins can be easily expressed in Escherichia coli encoding a mutant, N&#949;-acetyl-lysine (AcK)-specific Methanosarcina mazi ...

site-specific-lysine-acetylation-histones-for-nucleosome

Universidad de Cartagena UDEC

Research

Education

JoVE Journal

JoVE Core

Cell Biology

Biochemistry

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Unit 1

Structure and Organization of DNA

SCIENTISTS IN ACTION

3.9K Aufrufe.  Texas A&M University. Hier präsentieren wir eine Methode, um acetylierte Histonproteine mittels genetischer Codeerweiterung auszudrücken und rekonstituierte Nukleosomen in vitro zusammenzusetzen.

Serie: Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Reconstitution of Nucleosomes with Differentially Isotope-labeled Sister Histones

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications (PTMs). They are newly identified species with unknown means of establishment and functional implications. Current analytical methods are inadequate to detect the copy-specific occurrence of PTMs on the nucleosomal sister histones. This protocol presents a biochemical method for the in vitro reconstitution of nucleosomes containing differentially isotope-labeled sister histones. The generated complex can be also asymmetrically modified, after including a premodified histone pool during refolding of histone subcomplexes. These asymmetric nucleosome preparations can be readily reacted with histone-modifying enzymes to study modification cross-talk mechanisms imposed by the asymmetrically pre-incorporated PTM using nuclear magnetic resonance (NMR) spectroscopy. Particularly, the modification reactions in real-time can be mapped independently on the two sister histones by performing different types of NMR correlation experiments, tailored for the respective isotope type. This methodology provides the means to study crosstalk mechanisms that contribute to the formation and propagation of asymmetric PTM patterns on nucleosomal complexes.

This protocol describes the reconstitution of nucleosomes containing differentially isotope-labeled sister histones. At the same time, asymmetrically post-translationally modified nucleosomes can be generated after using a premodified histone copy. These preparations can be readily used to study modification crosstalk mechanisms, simultaneously on both sister histones, by using high-resolution NMR spectroscopy.

Rekonstitution von Nukleosomen mit differentiell isotopenmarkierten Schwester Histone

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications ...

Forschung

Biochemie

Analysis of Histone Antibody Specificity with Peptide Microarrays

Post-translational modifications (PTMs) on histone proteins are widely studied for their roles in regulating chromatin structure and gene expression. The mass production and distribution of antibodies specific to histone PTMs has greatly facilitated research on these marks. As histone PTM antibodies are key reagents for many chromatin biochemistry applications, rigorous analysis of antibody specificity is necessary for accurate data interpretation and continued progress in the field. This protocol describes an integrated pipeline for the design, fabrication and use of peptide microarrays for profiling the specificity of histone antibodies. The design and analysis aspects of this procedure are facilitated by ArrayNinja, an open-source and interactive software package we recently developed to streamline the customization of microarray print formats. This pipeline has been used to screen a large number of commercially available and widely used histone PTM antibodies, and data generated from these experiments are freely available through an online and expanding Histone Antibody Specificity Database. Beyond histones, the general methodology described herein can be applied broadly to the analysis of PTM-specific antibodies.

This manuscript describes methods for applying peptide microarray technology to specificity profiling of antibodies that recognize histones and their post-translational modifications.

Analyse der Histon-Antikörper-Spezifität mit Peptid-Microarrays

Post-translational modifications (PTMs) on histone proteins are widely studied for their roles in regulating chromatin structure and gene expression. The ...

Optimizing the Genetic Incorporation of Chemical Probes into GPCRs for Photo-crosslinking Mapping and Bioorthogonal Chemistry in Live Mammalian Cells

The genetic incorporation of non-canonical amino acids (ncAAs) via amber stop codon suppression is a powerful technique to install artificial probes and reactive moieties onto proteins directly in the live cell. Each ncAA is incorporated by a dedicated orthogonal suppressor-tRNA/amino-acyl-tRNA-synthetase (AARS) pair that is imported into the host organism. The incorporation efficiency of different ncAAs can greatly differ, and be unsatisfactory in some cases. Orthogonal pairs can be improved by manipulating either the AARS or the tRNA. However, directed evolution of tRNA or AARS using large libraries and dead/alive selection methods are not feasible in mammalian cells. Here, a facile and robust fluorescence-based assay to evaluate the efficiency of orthogonal pairs in mammalian cells is presented. The assay allows screening tens to hundreds of AARS/tRNA variants with a moderate effort and within a reasonable time. Use of this assay to generate new tRNAs that significantly improve the efficiency of the pyrrolysine orthogonal system is described, along with the application of ncAAs to the study of G-protein coupled receptors (GPCRs), which are challenging objects for ncAA mutagenesis. First, by systematically incorporating a photo-crosslinking ncAA throughout the extracellular surface of a receptor, binding sites of different ligands on the intact receptor are mapped directly in the live cell. Second, by incorporating last-generation ncAAs into a GPCR, ultrafast catalyst-free receptor labeling with a fluorescent dye is demonstrated, which exploits bioorthogonal strain-promoted inverse Diels Alder cycloaddition (SPIEDAC) on the live cell. As ncAAs can be generally applied to any protein independently on its size, the method is of general interest for a number of applications. In addition, ncAA incorporation does not require any special equipment and is easily performed in standard biochemistry labs.

A facile fluorescence assay is presented to evaluate the efficiency of amino-acyl-tRNA-synthetase/tRNA pairs incorporating non-canonical amino-acids (ncAAs) into proteins expressed in mammalian cells. The application of ncAAs to study G-protein coupled receptors (GPCRs) is described, including photo-crosslinking mapping of binding sites and bioorthogonal GPCR labeling on live cells.

Optimierung der genetischen Einbeziehung der chemischen Sonden in GPCRs für Foto-Vernetzung-Mapping und Bioorthogonal Chemie in Live Säugerzellen

The genetic incorporation of non-canonical amino acids (ncAAs) via amber stop codon suppression is a powerful technique to install artificial probes and ...

Chemie

Detection of Post-translational Modifications on Native Intact Nucleosomes by ELISA

The genome of eukaryotes exists as chromatin which contains both DNA and proteins. The fundamental unit of chromatin is the nucleosome, which contains 146 base pairs of DNA associated with two each of histones H2A, H2B, H3, and H41. The N-terminal tails of histones are rich in lysine and arginine and are modified post-transcriptionally by acetylation, methylation, and other post-translational modifications (PTMs). The PTM configuration of nucleosomes can affect the transcriptional activity of associated DNA, thus providing a mode of gene regulation that is epigenetic in nature 2,3. We developed a method called nucleosome ELISA (NU-ELISA) to quantitatively determine global PTM signatures of nucleosomes extracted from cells. NU-ELISA is more sensitive and quantitative than western blotting, and is useful to interrogate the epiproteomic state of specific cell types. This video journal article shows detailed procedures to perform NU-ELISA analysis.

Nucleosome ELISA (NU-ELISA) is a sensitive and quantitative method to detect global patterns of post-translational modifications in preparations of native, intact nucleosomes. These modifications include methylations, acetylations, and phosphorylations at specific histone amino acid residues, and hence NU-ELISA provides a global proteomic assay of the overall chromatin modification states of specific cell types.

Erkennung von Post-translationale Modifikationen auf Native Intact Nukleosomen mittels ELISA

The genome of eukaryotes exists as chromatin which contains both DNA and proteins. The fundamental unit of chromatin is the nucleosome, which contains 146 ...

Biologie

Repressing Gene Transcription by Redirecting Cellular Machinery with Chemical Epigenetic Modifiers

Regulation of chromatin compaction is an important process that governs gene expression in higher eukaryotes. Although chromatin compaction and gene expression regulation are commonly disrupted in many diseases, a locus-specific, endogenous, and reversible method to study and control these mechanisms of action has been lacking. To address this issue, we have developed and characterized novel gene-regulating bifunctional molecules. One component of the bifunctional molecule binds to a DNA-protein anchor so that it will be recruited to an allele-specific locus. The other component engages endogenous cellular chromatin-modifying machinery, recruiting these proteins to a gene of interest. These small molecules, called chemical epigenetic modifiers (CEMs), are capable of controlling gene expression and the chromatin environment in a dose-dependent and reversible manner. Here, we detail a CEM approach and its application to decrease gene expression and histone tail acetylation at a Green Fluorescent Protein (GFP) reporter located at the Oct4 locus in mouse embryonic stem cells (mESCs). We characterize the lead CEM (CEM23) using fluorescent microscopy, flow cytometry, and chromatin immunoprecipitation (ChIP), followed by a quantitative polymerase chain reaction (qPCR). While the power of this system is demonstrated at the Oct4 locus, conceptually, the CEM technology is modular and can be applied in other cell types and at other genomic loci.

Regulation of the chromatin environment is an essential process required for proper gene expression. Here, we describe a method for controlling gene expression through the recruitment of chromatin-modifying machinery in a gene-specific and reversible manner.

Gentranskription durch Umleiten zellulären Maschinerie mit chemischen epigenetische Modifikatoren zu unterdrücken

Regulation of chromatin compaction is an important process that governs gene expression in higher eukaryotes. Although chromatin compaction and gene ...

Biotechnik

<meta charset="utf8"></head><body>In situ Nukleosomenrekonstitution für Einzelmolekülstudien

In Situ Nucleosome Assembly for Single-Molecule Correlative Force and Fluorescence Microscopy

Nucleosomes constitute the primary unit of eukaryotic chromatin and have been the focus of numerous informative single-molecule investigations regarding their biophysical properties and interactions with chromatin-binding proteins. Nucleosome reconstitution on DNA for these studies typically involves a salt dialysis procedure that provides precise control over the placement and number of nucleosomes formed along a DNA tether. However, this protocol is time-consuming and requires a substantial amount of DNA and histone octamers as inputs. To offer an alternative strategy, an in situ nucleosome reconstitution method for single-molecule force and fluorescence microscopy that utilizes the histone chaperone Nap1 is described. This method enables users to assemble nucleosomes on any DNA template without the need for strong nucleosome positioning sequences, adjust nucleosome density on demand, and use fewer reagents. In situ nucleosome formation occurs within seconds, offering a simpler experimental workflow and a convenient transition into single-molecule measurements. Examples of two downstream assays for probing nucleosome mechanics and visualizing the behavior of individual proteins on chromatin are further described.

<meta charset="utf8"></head><body>Autor im Rampenlicht: Effiziente Nukleosomenrekonstitution für Einzelmolekültechniken

This article presents a detailed experimental procedure for reconstituting nucleosome-containing DNA tethers for single-molecule correlative force and fluorescence microscopy. It further describes several downstream experiments that can be conducted to visualize the binding behavior of chromatin-interacting proteins and analyze changes in the physical properties of nucleosomes.

In-situ-Nukleosomenassemblierung für die Einzelmolekül-Korrelativkraft- und Fluoreszenzmikroskopie

Nucleosomes constitute the primary unit of eukaryotic chromatin and have been the focus of numerous informative single-molecule investigations regarding ...

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. Among them, reversible lysine acetylation is one of the most widely distributed in all domains of life. Although numerous mass spectrometry-based acetylome studies have been performed, further characterization of these putative acetylation targets has been limited. One possible reason is that it is difficult to generate purely acetylated proteins at desired positions by most classic biochemical approaches. To overcome this challenge, the genetic code expansion technique has been applied to use the pair of an engineered pyrrolysyl-tRNA synthetase variant, and its cognate tRNA from Methanosarcinaceae species, to direct the cotranslational incorporation of acetyllysine at the specific site in the protein of interest. After first application in the study of histone acetylation, this approach has facilitated acetylation studies on a variety of proteins. In this work, we demonstrated a facile protocol to produce site-specifically acetylated proteins by using the model bacterium Escherichia coli as the host. Malate dehydrogenase was used as a demonstration example in this work.

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Genetic code expansion serves as a powerful tool to study a wide range of biological processes, including protein acetylation. Here we demonstrate a facile protocol to exploit this technique for generating homogeneously acetylated proteins at specific sites in Escherichia coli cells.

Eine einfache Protokoll ortspezifisch generieren acetyliert Proteine in Escherichia Coli

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. ...

Immunologie und Infektion

Application of MassSQUIRM for Quantitative Measurements of Lysine Demethylase Activity

Recently, epigenetic regulators have been discovered as key players in many different diseases 1-3. As a result, these enzymes are prime targets for small molecule studies and drug development 4. Many epigenetic regulators have only recently been discovered and are still in the process of being classified. Among these enzymes are lysine demethylases which remove methyl groups from lysines on histones and other proteins. Due to the novel nature of this class of enzymes, few assays have been developed to study their activity. This has been a road block to both the classification and high throughput study of histone demethylases. Currently, very few demethylase assays exist. Those that do exist tend to be qualitative in nature and cannot simultaneously discern between the different lysine methylation states (un-, mono-, di- and tri-). Mass spectrometry is commonly used to determine demethylase activity but current mass spectrometric assays do not address whether differentially methylated peptides ionize differently. Differential ionization of methylated peptides makes comparing methylation states difficult and certainly not quantitative (Figure 1A). Thus available assays are not optimized for the comprehensive analysis of demethylase activity.
Here we describe a method called MassSQUIRM (mass spectrometric quantitation using isotopic reductive methylation) that is based on reductive methylation of amine groups with deuterated formaldehyde to force all lysines to be di-methylated, thus making them essentially the same chemical species and therefore ionize the same (Figure 1B). The only chemical difference following the reductive methylation is hydrogen and deuterium, which does not affect MALDI ionization efficiencies. The MassSQUIRM assay is specific for demethylase reaction products with un-, mono- or di-methylated lysines. The assay is also applicable to lysine methyltransferases giving the same reaction products. Here, we use a combination of reductive methylation chemistry and MALDI mass spectrometry to measure the activity of LSD1, a lysine demethylase capable of removing di- and mono-methyl groups, on a synthetic peptide substrate 5. This assay is simple and easily amenable to any lab with access to a MALDI mass spectrometer in lab or through a proteomics facility. The assay has ~8-fold dynamic range and is readily scalable to plate format 5.

We present a method for using MALDI mass spectrometry and reductive methylation chemistry to quantify changes in lysine methylation.

Die Anwendung des MassSQUIRM für quantitative Messungen von Lysin-Demethylase

Recently, epigenetic regulators have been discovered as key players in many different diseases 1-3. As a result, these enzymes are prime targets for small ...

Ortsspezifische Lysin-Acetylierung von Histonen zur Nukleosomen-Rekonstitution mit genetischer Codeerweiterung bei Escherichia coli

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Rekonstitution von Nukleosomen mit differentiell isotopenmarkierten Schwester Histone

Analyse der Histon-Antikörper-Spezifität mit Peptid-Microarrays

Optimierung der genetischen Einbeziehung der chemischen Sonden in GPCRs für Foto-Vernetzung-Mapping und Bioorthogonal Chemie in Live Säugerzellen

Erkennung von Post-translationale Modifikationen auf Native Intact Nukleosomen mittels ELISA

Gentranskription durch Umleiten zellulären Maschinerie mit chemischen epigenetische Modifikatoren zu unterdrücken

In-situ-Nukleosomenassemblierung für die Einzelmolekül-Korrelativkraft- und Fluoreszenzmikroskopie

In-situ-Nukleosomenassemblierung für die Einzelmolekül-Korrelativkraft- und Fluoreszenzmikroskopie

In-situ-Nukleosomenassemblierung für die Einzelmolekül-Korrelativkraft- und Fluoreszenzmikroskopie

Eine einfache Protokoll ortspezifisch generieren acetyliert Proteine in Escherichia Coli

Die Anwendung des MassSQUIRM für quantitative Messungen von Lysin-Demethylase