وقد تم دعم هذا العمل من قبل المنح من المعهد الوطني للصحة العقلية (R00MH103531 و R01MH116901 إلى J.A.) ، ومنحة تدريب ما قبل الدكتوراه من المعهد الوطني للطب العام (T32GM007635 إلى S.R.) ، وزمالات ليدا هيل جيليام للدراسة المتقدمة (GT11021 إلى S.R.). نشكر الدكتور كيفن وولفري على المساعدة في المجهر، والدكتور ك أولريش باير لاستخدام مجهره النيففلورسنت، وتوماس سودهوف (جامعة ستانفورد) لLRRTM2 بلاسميد.

1. خلية ثقافة وtransfection
<ol><li>جعل وسائط الخلية HEK مع DMEM، 1x (تعديل دولبيككو من المتوسط النسر) تكملها مع 4.5 ز / ل الجلوكوز، L-الجلوتامين والصوديوم بيروفات و 10٪ FBS. مرشح معقمة.</li>
	<li>يحدد مسبقاً الأحرف اللينة والمستقبلات المناسبة لتشايس التجميع. ملاحظة: Neurexin3α SS4+/ - وأحد اليغانات المعروفة، LRRTM2، تم استخدامه في هذه الدراسة. وأعرب عن اليغاندس والمستقبلات من الفائدة من cDNAs في pcDNA3.1. تم استخدام تجميع جيبسون لإدراج Neurexin3α فيpcDNA3.12. Neurexin3α F/R: TTTAAACTTAAGCTTGGTACCGAGCTCGGGCGCATCCCACCATGAGCCTCTCTCACCTCACCCACTC/ GAGCGGCCGCCACTGCTGCTGCTGGGGGGGGGGACCTTACACATAATAATACTCCTTCCTT.</li>
	<li>إعداد خلايا HEK293T.<ol>
<li>تنمو خلايا HEK293T إلى التقاء في واحدة T-75 قارورة.</li>
		<li>مرة واحدة التقاء، واستخدام 2 مل من التربسين ومكان في حاضنة 37 درجة مئوية لمدة 2 دقيقة. إضافة 6 مل من وسائط HEK إلى القارورة لإعادة تعليق الخلايا ونقل جميع 8 مل إلى أنبوب مخروطي 15 مل.</li>
		<li>بيليه في 500 س ز لمدة 5 دقائق و resuspend في وسائط الخلية HEK لمجموع 8 مل.</li>
		<li>عد الخلايا وإضافة 735،000 الخلايا في كل بئر من لوحة 6-جيدا. ضبط مستوى الصوت النهائي إلى 2 مل لكل بئر باستخدام وسائط خلية HEK.</li>
		<li>وضع في حاضنة 37 درجة مئوية والسماح للخلايا أن تنمو بين عشية وضحاها أو حتى تصل إلى 50-60٪ التقاء.</li>
	</ol></li>
	<li>Transfect خلايا HEK293T باستخدام طريقة فوسفات الكالسيوم13.<ol>
<li>Transfect جيدا-1 مع 3 ميكروغرام من البروتين من الفائدة وtransfect مع 1 ميكروغرام من البروتين الفلورسنت (3 ميكروغرام من pcDNA3.1-Neurexin3αWT SS4- و 1 ميكروغرام من mCherry).</li>
		<li>Transfect بشكل جيد-2 كما في الخطوة 1.4.1. ولكن مع البروتين المتحول من الفائدة (pcDNA3.1-Neurexin3αA687T SS4-).</li>
		<li>Transfect جيدا-3 مع 3 ميكروغرام من يغاند من الفائدة وtransfect مع 1 ميكروغرام من بروتين آخر الفلورسنت (3 ميكروغرام من pcDNA3.1 LRRTM2 و 1 ميكروغرام من GFP).</li>
		<li>Transfect جيدا-4 و-5 لتكون بمثابة ضوابط سلبية: جيدا-4 مع 1 ميكروغرام من GFP و-5 جيدا مع 1 ميكروغرام من mCherry.</li>
		<li>إعداد لوحة أخرى (كما هو الحال في الخطوة 1.4.1-1.4.4) إذا تطلبت شروطًا أو عناصر تحكم إضافية (Neurexin3αWT/A687T SS4+). ملاحظة: يتم تحليل كفاءة النقل 24 ساعة بعد transfection تحت مجهر epifluorescence وكميتها كعدد من الخلايا التي تعبر عن البروتين الفلورسنت أنها كانت مصابة. ومن شأن اتباع نهج أكثر تبسيطا أن يشمل نقل خلايا HEK مع ترميز ناقلات bicistronic لبروتين الفلورسنت ورابطة الاهتمام وينصح بشدة فوق co-transfection. في حالة هذه الدراسة، ألفا Neurexins هي ~ 4.3 كيلوبايت، ولوحظت كثافة الفلوريسنس منخفضة باستخدام نظام bicistronic مما يستلزم co-transfection.</li>
	</ol></li>
	<li>بعد 48 ساعة من عملية التهيّن، حصاد الخلايا من أجل التجميع.<ol>
<li>غسل كل جيدا مرتين مع برنامج تلفزيوني.</li>
		<li>أضف 1 مل من 10 mM EDTA في برنامج تلفزيوني في كل بئر إلى فصل بلطف التفاعلات بين الخلايا إلى الخلية ولوحة احتضان عند 37 درجة مئوية لمدة 5 دقائق. ملاحظة: لا ينصح التربسين للخطوة 1.5.2 بسبب الانقسام البروتيني المحتمل لجزيئات التصاق في الدراسة. بالإضافة إلى ذلك، بعد إضافة EDTA قد لا يتم إيقاف البروتوكول حتى اكتمال كما الخلايا الآن سيتم تعرضها للظروف المحيطة.</li>
		<li>بلطف اضغط لوحة لفصل الخلايا، وحصاد كل بئر في أنابيب مخروطية 15 مل منفصلة.</li>
		<li>أنابيب مخروطية للطرد المركزي عند 500 x g ودرجة حرارة الغرفة لمدة 5 دقائق.</li>
	</ol></li>
	<li>في حين أن الخلايا هي تعبئة، وإعداد 6 أنابيب الحضانة عن طريق وضع العلامات على الجزء العلوي من كل أنبوب microcentrifuge مع كل حالة. ملاحظة: ينبغي استخدام كل تبديل في شروط GFP و mCherry لتشمل جميع الظروف التجريبية والضوابط المناسبة. على سبيل المثال: 1. GFP/mCherry، 2. mCherry/LRRTM2-GFP 3. GFP/Neurexin3αWT SS4--mCherry, 4. GFP/Neurexin3αA687T SS4- mCherry, 5. Neurexin3αWT SS4----mCherry/LRRTM2-GFP, 6. Neurexin3αA687T SS4- -mCherry/LRRTM2-GFP. جعل أنابيب إضافية لاستيعاب المزيد من الشروط والضوابط.</li>
	<li>إزالة الخلايا فائقة و resuspend في 500 ميكرولتر من وسائط HEK مع 10 mM CaCl2 و 10 mM MgCl2 2 الدفء إلى 37 درجة مئوية. ملاحظة: إضافة CaCl2 و MgCl2 يسمح جزيئات التصاق لإعادة الربط وهو مطلوب فقط إذا كان الشركاء التفاعل عبر الخلية في السؤال تتطلب الكاتيونات divalent للتصاق.</li>
	<li>عد الخلايا في كل أنبوب مخروطي 15 مل باستخدام مقياس للهيمويت و aliquot 200,000 خلية من كل حالة في أنبوب مناسب من الخطوة 1.6.1 لمزيج 1:1 في حجم إجمالي 500 ميكرولتر. ملاحظة: يجب أن يستغرق 5 دقائق فقط لكل شرط لحساب والمبالغ aliquot.</li>
	<li>احتضان الأنابيب في درجة حرارة الغرفة في دوار أنبوب بطيء.</li>
</ol>2. الحصول على صورة
<ol><li>تحسين المعلمات المجهر للحصول على عينات محددة. في هذا المثال، تم التقاط الصور على مجهر واسع المجال. استخدام هدف الهواء 5x (NA: 0.15; WD: 20000 μm) للحصول على حقل كبير بما فيه الكفاية للتحليل.</li>
	<li>تقييم تجميع خط الأساس مباشرة بعد خلط الشرطين خلايا HEK في الخطوة 1.8. هذه هي الآن 'الوقت صفر' الصور.<ol>
<li>Pipette 40 ميكرولتر من كل خليط عينة على شريحة المجهر المشحونة والصورة تحت الفلورانس في كل من القنوات 488 و 561.</li>
		<li>الحصول على ثلاثة حقول مختلفة من الرؤية في مستوى التركيز واحد لكل قطرة العينة.</li>
	</ol>
</li>
	<li>الحصول على الصور النهائية في 60 دقيقة كما صورة 'الوقت 60'.<ol>
<li>للحصول على صورة 'الوقت 60' من الخليط بعد 60 دقيقة حضانة، واتخاذ آخر 40 ميكرولتر عينة من كل حالة من أنابيب الدورية والماصات كل عينة على شريحة مشحونة. صورة كما في الخطوة 2.2.2. ملاحظة: يجب التحقق من تجميع الخلايا كل 15 دقيقة حتى يحدث التشبع. وسيتوقف توقيت التجميع على البروتينات التي يجري اختبارها.</li>
	</ol>
</li>
</ol>3. تحليل ImageJ/فيجي
<ol><li>لتحديد مدى التجميع باستخدام فيجي/ImageJ، احفظ ملفات التحليل.<ol>
<li>حفظ ملفات ترميز إضافية المتوفرة في مجلد imageJ وحدات الماكرو على الكمبيوتر.</li>
		<li>تثبيت ماكرو التجميع المتوفرة (الإضافات، وحدات الماكرو، تثبيت، وحدد ملف "AggregationAssay.txt").</li>
	</ol>
</li>
	<li>تحديد العتبات.<ol>
<li>تحميل ملف "وقت الصفر" .tif إلى imageJ وتقسيم القنوات (صورة | | اللون انقسام القنوات). ملاحظة: يتم استخدام الصورة 'الوقت صفر' لتحديد العتبة وأصغر حجم بونكتا للتجربة بأكملها.</li>
		<li>قناع كل قناة(الإضافات | | وحدات الماكرو AggregationAssay_MakeMask). جعل قناع من صورة نافذة سوف تظهر. خانات الاختيار بجوار تحديد عتبة الصورة وتحديد الكتل Params من مدرج التكراري وانقر فوق موافق.</li>
		<li>حدد عتبة الصورة باستخدام شريط الشرائح، وسجل الرقم إلى يمين شريط الشرائح، وانقر فوق موافق.</li>
		<li>سيظهر مدرج بياني لحجم الكتلة. حدد حجم كتلة من الرسم البياني الذي يناسب التجربة، اكتب هذا الرقم في المربع الحد الأدنى من حجم الكتلة: ثم انقر فوق موافق. لن يتم تحليل الكتل التي دون هذا الحجم.</li>
	</ol>
</li>
	<li>قم بتشغيل التحليل.<ol>
<li>فتح صورة 'الوقت 60' من حالة 1 في imageJ وتقسيم القنوات كما هو الحال في الخطوة 3.2.1.</li>
		<li>قناع كل قناة (الإضافات ، وحدات الماكرو ، AggregationAssay_MakeMask). استخدام نفس عتبة والحجم المحدد في الخطوة 3.2.3 والخطوة 3.2.4. إلغاء تحديد المربعات بجوار تحديد عتبة الصورة وتحديد الكتل Params من الرسم البياني ثم يدوياً اكتب الحجم وعتبات في الحقول المناسبة ثم انقر فوق موافق.</li>
		<li>حساب مؤشر التجميع(الإضافات | | وحدات الماكرو AggregationAssay_CalculateOverlap). حدد القنوات المقنعة التي سيتم مقارنتها والدليل الذي سيتم حفظ الملفات الناتجة فيه.</li>
		<li>كرر الخطوات 3.3.1-3.3.3 لكل صورة 'الوقت 60' في كل حالة. ملاحظة: يُعرَّف مؤشر التجميع بأنه منطقة التداخل الإجمالي مقسوماً على مجموع منطقتين للقناتين مطروحاً منها منطقة التداخل مضروبة في 100 (مؤشر التجميع = منطقة التداخل/[مساحة القناة 1 + مساحة القناة 2 – منطقة التداخل] x 100). هذا التهيئة عملية 'OR' بين القناتين المقنعين تمثل إجمالي البيكسلات في أي قناع.</li>
	</ol>
</li>
</ol>

<ol>
	<li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroligins+and+neurexins+link+synaptic+function+to+cognitive+disease.">Neuroligins and neurexins link synaptic function to cognitive disease.</a> Nature. 455 (7215), 903-911 (2008).</li><li>Lakey, J. H., Raggett, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+protein-protein+interactions.">Measuring protein-protein interactions.</a> Current Opinion in Structural Biology. 8 (1), 119-123 (1998).</li><li>Aoto, J., Martinelli, D. C., Malenka, R. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Presynaptic+neurexin-3+alternative+splicing+trans-synaptically+controls+postsynaptic+AMPA+receptor+trafficking.">Presynaptic neurexin-3 alternative splicing trans-synaptically controls postsynaptic AMPA receptor trafficking.</a> Cell. 154 (1), 75-88 (2013).</li><li>Aoto, J., F&#246;ldy, C., Ilcus, S. M. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+circuit-dependent+functions+of+presynaptic+neurexin-3+at+GABAergic+and+glutamatergic+synapses.">Distinct circuit-dependent functions of presynaptic neurexin-3 at GABAergic and glutamatergic synapses.</a> Nature Neuroscience. 18 (7), 997-1007 (2015).</li><li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+Neurexin+Complexes:+A+Molecular+Code+for+the+Logic+of+Neural+Circuits.">Synaptic Neurexin Complexes: A Molecular Code for the Logic of Neural Circuits.</a> Cell. 171 (4), 745-769 (2017).</li><li>Dai, J., Aoto, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+Splicing+of+Presynaptic+Neurexins+Differentially+Controls+Postsynaptic+NMDA+and+AMPA+Receptor+Responses.">Alternative Splicing of Presynaptic Neurexins Differentially Controls Postsynaptic NMDA and AMPA Receptor Responses.</a> Neuron. 102 (5), 993-1008 (2019).</li><li>Restrepo, S., Langer, N. J., Nelson, K. A., Aoto, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+a+Neurexin-3&#945;+Human+Mutation+in+Mouse+Neurons+Identifies+a+Novel+Role+in+the+Regulation+of+Transsynaptic+Signaling+and+Neurotransmitter+Release+at+Excitatory+Synapses.">Modeling a Neurexin-3&#945; Human Mutation in Mouse Neurons Identifies a Novel Role in the Regulation of Transsynaptic Signaling and Neurotransmitter Release at Excitatory Synapses.</a> The Journal of Neuroscience. 39 (46), 9065-9082 (2019).</li><li>Ko, J., Fuccillo, M. V., Malenka, R. C., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Functions+as+a+Neurexin+Ligand+in+Promoting+Excitatory+Synapse+Formation.">LRRTM2 Functions as a Neurexin Ligand in Promoting Excitatory Synapse Formation.</a> Neuron. 64 (6), 791-798 (2009).</li><li>de Wit, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Interacts+with+Neurexin1+and+Regulates+Excitatory+Synapse+Formation.">LRRTM2 Interacts with Neurexin1 and Regulates Excitatory Synapse Formation.</a> Neuron. 64 (6), 799-806 (2009).</li><li>Linhoff, M. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Unbiased+Expression+Screen+for+Synaptogenic+Proteins+Identifies+the+LRRTM+Protein+Family+as+Synaptic+Organizers.">An Unbiased Expression Screen for Synaptogenic Proteins Identifies the LRRTM Protein Family as Synaptic Organizers.</a> Neuron. 61 (5), 734-749 (2009).</li><li>Siddiqui, T. J., Pancaroglu, R., Kang, Y., Rooyakkers, A., Craig, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTMs+and+Neuroligins+Bind+Neurexins+with+a+Differential+Code+to+Cooperate+in+Glutamate+Synapse+Development.">LRRTMs and Neuroligins Bind Neurexins with a Differential Code to Cooperate in Glutamate Synapse Development.</a> Journal of Neuroscience. 30 (22), 7495-7506 (2010).</li><li>Gibson, D. G., Young, L., Chuang, R. -. Y., Venter, J. C., Hutchison, C. A., Smith, H. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nature Methods. 6 (5), 343-345 (2009).</li><li>Bacchetti, S., Graham, F. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfer+of+the+gene+for+thymidine+kinase+to+thymidine+kinase-deficient+human+cells+by+purified+herpes+simplex+viral+DNA.">Transfer of the gene for thymidine kinase to thymidine kinase-deficient human cells by purified herpes simplex viral DNA.</a> Proceedings of the National Academy of Sciences of the United States of America. 74 (4), 1590-1594 (1977).</li><li>Cerchiari, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+strategy+for+tissue+self-organization+that+is+robust+to+cellular+heterogeneity+and+plasticity.">A strategy for tissue self-organization that is robust to cellular heterogeneity and plasticity.</a> Proceedings of the National Academy of Sciences of the United States of America. 112 (7), 2287-2292 (2015).</li><li>Burdick, M. M., McCarty, O. J. T., Jadhav, S., Konstantopoulos, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+inflammation+and+cancer+metastasis.">Cell-cell interactions in inflammation and cancer metastasis.</a> IEEE Engineering in Medicine and Biology Magazine. 20 (3), 86-91 (2001).</li><li>Fox, D. A., Gizinski, A., Morgan, R., Lundy, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+rheumatoid+arthritis+synovium.">Cell-cell interactions in rheumatoid arthritis synovium.</a> Rheumatic Diseases Clinics of North America. 36 (2), 311-323 (2010).</li><li>Yamagata, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+insights+into+modulation+and+selectivity+of+transsynaptic+neurexin-LRRTM+interaction.">Structural insights into modulation and selectivity of transsynaptic neurexin-LRRTM interaction.</a> Nature Communications. 9 (1), 3964 (2018).</li><li>Nguyen, T., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binding+properties+of+neuroligin+1+and+neurexin+1beta+reveal+function+as+heterophilic+cell+adhesion+molecules.">Binding properties of neuroligin 1 and neurexin 1beta reveal function as heterophilic cell adhesion molecules.</a> The Journal of Biological Chemistry. 272 (41), 26032-26039 (1997).</li><li>Boucard, A. A., Ko, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Affinity+Neurexin+Binding+to+Cell+Adhesion+G-protein-coupled+Receptor+CIRL1/Latrophilin-1+Produces+an+Intercellular+Adhesion+Complex.">High Affinity Neurexin Binding to Cell Adhesion G-protein-coupled Receptor CIRL1/Latrophilin-1 Produces an Intercellular Adhesion Complex.</a> Journal of Biological Chemistry. 287 (12), 9399-9413 (2012).</li></ol>

ليس لدى أصحاب البلاغ ما يكشفون عنه.

تشريح البروتين البروتينية التفاعلات التي تحدث في عبر خلال التصاق الخلية يمكن أن يؤدي إلى فهم أفضل للآليات الجزيئية الكامنة في العمليات الخلوية الأساسية بما في ذلك تشكيل وظيفة وصيانة نقاط الاشتباك العصبي أثناء النضج وإعادة عرض. الآثار المترتبة على التفاعلات من خلية إلى خلية توسيع نطاقها ...

التفاعلات متشابك تسهيلها من قبل جزيئات التصاق متشابك هي الأساس لتطوير وتنظيم ومواصفات وصيانة وظيفة من نقاط الاشتباك العصبي وتوليد الشبكات العصبية. ويتزايد بسرعة تحديد جزيئات التصاق الخلايا المتحولة؛ وبالتالي، من المهم بشكل أساسي تحديد الشركاء الملزمين وفهم كيفية تفاعل جزيئات الالتصاق الجديدة هذه مع بعضها البعض. بالإضافة إلى ذلك، حددت تسلسل الجينوم الطفرات في العديد من هذه الجزيئات التصاق التي ترتبط عادة إلى العديد من الاضطرابات العصبية النمائية، العصبية والنفسية،والإدمان 1. الطفرات في الجينات التي رمز لجزيئات التصاق الخلايا متشابك قد تغير بشكل ضار التفاعلات عبر وقد تسهم في التعديلات فيزيائية المرضية في تشكيل المشبك أو الصيانة.
توجد مقايسات متعددة لتقييم كمي تفاعلات البروتين والبروتين مثل قياس السعرات الحرارية isothermal، dichroism دائري، الرنين البلازمونالسطحي 2 وعلى الرغم من الكمية في الطبيعة، لديهم عدة قيود. أولاً، تتطلب بروتيناً مؤتلفاً، وتطالب أحياناً بخطوات تنقية طويلة ومملة. ثانيا، تتطلب هذه الكفاءات معدات متخصصة متطورة وخبرة فنية. ثالثاً، يمكن أن تبالغ في تقدير مدى الربط لأنها تسمح لكل من رابطة الدول المستقلة والتفاعلات العابرة بين البروتينات المربوطة بشكل طبيعي إلى غشاء في الجسم الحي. هنا نقترح اختبار بسيط وسريع نسبيا أن الاختبارات حصرا التفاعلات عبر.
للتحايل على العديد من المضاعفات المرتبطة بمقايس البروتين النقي، قمنا بتحسين تحليل تفاعل البروتين القائم على الخلايا الذي يلخص التفاعلات عبر في نظام الخلايا غير المغايرة. وقد سبق استخدام هذا الفحص في أشكال مختلفة لدراسة التفاعلات عبر الخلايا. في هذا النهج، يتم نقل جزيئات التصاق الخلية المرشحة إلى خلايا HEK293T. في الظروف الفسيولوجية، خلايا HEK293T لا تظهر التجميع الذاتي، مما يجعلها نماذج مثالية لهذا الفحص. ومع ذلك، عندما يتم الجمع بين مجموعات من الأفراد من خلايا HEK التعبير عن مستقبلات ويغاند، فإن ربط المستقبلات وقواد ليغاند تجميع خلايا HEK أن يحدث. ويتم هذا التجميع حصرياً عن طريق التفاعلات عبر، وعادة ما يكون قابلاً للملاحظة في عشرات الدقائق. لا يلزم اتخاذ خطوات لتنقية البروتين في هذه الطريقة، وتعتمد كفاءة الطريقة على النموذج الذي يتم فيه دمج مجموعات خلايا HEK التي تعبر عن جزيئات التصاقها، ثم يتم تصويرها بعد عشرات الدقائق فقط. بالإضافة إلى ذلك، هذه الطريقة غير مكلفة نسبيا، حيث لا الأجسام المضادة ولا معدات مكلفة مطلوبة. المعدات الوحيدة المطلوبة للحصول على البيانات هي مجهر فلوري قياسي. ميزة إضافية لهذا المقايسة القائمة على الخلية هي القدرة على فحص بسرعة تأثير الطفرات نقطة ذات الصلة المرض على التفاعلات عبر. ويمكن إجراء ذلك عن طريق نقل خلايا HEK مع cDNAs من المتغيرات المتحولة من البروتين من الفائدة.
في هذا البروتوكول، نقدم مثالاً نتحقق فيه مما إذا كانت طفرة الميزنس في Neurexin3α (Neurexin3αA687T)،التي تم تحديدها في مريض تم تشخيصه بإعاقة ذهنية عميقة والصرع، يغير التفاعلات في ترانس مع بروتين تكرار الغشاء اللين الغني باليوسين 2 (LRRTM2). Neurexin3α هو عضو في الأسرة المحفوظة تطوريا من الجزيئات presynaptic الخلية التصاق وبينما عمل مؤخرا قد حددت أدوار متعددة في المشبك3,4,5,6,7, فهمنا متشابك من هذا الجزيء وجميع أعضاء الأسرة neurexin لا تزال غير مكتملة. LRRTM2 هو عبارة عن بروتين التصاق الخلايا بعد التصاقات ما بعد التصاقات التي تشارك في تشكيل المشبك العصبي والصيانة8,9,10. الأهم من ذلك، LRRTM2 يتفاعل حصرا مع isoforms neurexin التي تفتقر إلى موقع لصق 4 exon البديل (SS4-) ولكن ليس مع isoforms neurexin التي تحتوي على موقع لصق 4 البديلة exon (SS4 +). يقع الطفرة البشرية (A687T) التي تم تحديدها في Neurexin3α في منطقة خارج الخلية غير مدروسة يتم حفظها تطورياً ويتم الحفاظ عليها بين جميع نويات ألفا7. كما تم تأسيس التفاعل بين هذين الجزيئات8,9,11, طرحنا السؤال: هل القدرة على الربط من Neurexin3α SS4- إلى LRRTM2 غيرت بواسطة A687T نقطة طفرة؟ وكشفت هذه الأقوال أن طفرة نقطة A687T عززت بشكل غير متوقع تجميع Neurexin3α إلى LRRTM2 مما يشير إلى أن المنطقة خارج الخلية التي تقع فيها الطفرة النقطة، تلعب دورا في التوسط التفاعلات عبرسينابتيك.

<table><tbody><tr><td>1.5 mL disposable microtubes with snap caps</td><td>VWR</td><td>89000-028</td><td>Incubation of mixed population of HEK cells</td></tr><tr><td>1000 mL Rapid&amp;mdash;Flow Filter Unit, 0.2 um aPES membrane</td><td>Thermo Fisher</td><td>567-0020</td><td>Sterilization of HEK media</td></tr><tr><td>15 mL SpectraTube centrifuge tubes</td><td>Ward&amp;rsquo;s Science</td><td>470224-998</td><td>Harvesting HEK cells</td></tr><tr><td>6 well sterile tissue culture plates</td><td>VWR</td><td>100062-892</td><td>culturing HEK cells</td></tr><tr><td>Calcium Chloride</td><td>Sigma</td><td>223506-500G</td><td>Calcium phosphate transfection, HEK cell resuspension</td></tr><tr><td>Centrifuge- Sorvall Legend RT</td><td>Kendro Laboratory Products</td><td>75004377</td><td>Harvesting HEK cells</td></tr><tr><td>CO2 cell incubator</td><td>Thermo Scientific</td><td>HERACELL 150i</td><td>Incubation of HEK cells during growth</td></tr><tr><td>DMEM, 1x (Dulbecco&#039;s Modification of Eagle&#039;s Medium) with 4.5 g/L glucose, L-glutamine &amp;amp; sodium pyruvate</td><td>Corning</td><td>10-013-CV</td><td>HEK cell maintenance</td></tr><tr><td>Dulbecco&amp;rsquo;s Phosphate Buffered Saline PBS (1X)</td><td>Gibco</td><td>14190-144</td><td>Passaging/harvesting HEK cell</td></tr><tr><td>Ethylenediaminetetraacetic acid</td><td>Sigma</td><td>ED-500G</td><td>Harvesting HEK cells</td></tr><tr><td>Falcon Vented culture flasks, 75cm&lt;sup&gt;2&lt;/sup&gt; growth area</td><td>Corning</td><td>9381M26</td><td>Culturing HEK cells</td></tr><tr><td>Fetal Bovine Serum</td><td>Sigma</td><td>17L184</td><td>HEK cell maintenance</td></tr><tr><td>HEK293T cells</td><td>ATCC</td><td></td><td>Model system</td></tr><tr><td>ImageJ</td><td>NIH</td><td>V: 2.0.0-rc-69/1.52p</td><td>Image analysis</td></tr><tr><td>Magnesium Chloride hexahydrate</td><td>Sigma</td><td>M9272-500G</td><td>HEK cell resuspension</td></tr><tr><td>Sodium phosphate dibasic anhydrous</td><td>Fisher BioReagents</td><td>BP332-500</td><td>Calcium phosphate transfection</td></tr><tr><td>Trypsin 0.25% (1X) Solution</td><td>GE Healthcare Life Sciences</td><td>SH30042.01</td><td>Passaging HEK cells</td></tr><tr><td>Tube rotator</td><td></td><td></td><td>Incubation of mixed population of HEK cells</td></tr><tr><td>UltraClear Microscope slides. White Frosted, Positive Charged</td><td>Denville Scientific Inc.</td><td>M1021</td><td>Image acquisition</td></tr><tr><td>Wide-field microscope</td><td>Zeiss</td><td>Axio Vert 200M</td><td>Image acquisition</td></tr></tbody></table>

measuring transcellular interactions through protein aggregation in a heterologous cell system

التفاعلات البروتينية في الواجهات الخلوية تملي العديد من النتائج البيولوجية التي تتراوح بين تطوير الأنسجة وتطور السرطان إلى تشكيل المشبك العصبي والصيانة. العديد من هذه التفاعلات الأساسية تحدث في مغايرة وعادة ما يتم الناجمة عن التفاعلات غير المتغايرة أو المثلية بين الخلايا التي تعبر عن أزواج الربط الراسية الغشاء. توضيح كيف الطفرات المرض ذات الصلة تعطيل هذه التفاعلات البروتين الأساسية يمكن أن توفر نظرة ثاقبة في عدد لا يحصى من حقول بيولوجيا الخلايا. العديد من البروتين البروتين التفاعل المقايسة لا عادة توضيح بين رابطة الدول المستقلة والتفاعلات عبر, مما قد يؤدي إلى المبالغة في تقدير مدى الربط الذي يحدث في الجسم الحي وينطوي على تنقية كثيفة العمالة من البروتين و / أو معدات الرصد المتخصصة. هنا، نقدم بروتوكول بسيط الأمثل الذي يسمح لمراقبة وكمية التفاعلات عبر فقط دون الحاجة إلى تنقية البروتين طويلة أو المعدات المتخصصة. يتضمن فحص تجميع خلايا HEK خلط مجموعتين مستقلتين من خلايا HEK، يعبر كل منهما عن أربطة مزدوجة مُلزمة بالغشاء. بعد فترة حضانة قصيرة، يتم تصوير العينات ويتم تحديد المجاميع الناتجة.

طفرة A687T يزيد Neurexin3α SS4- ملزمة LRRTM27 للتحقيق في كيفية تأثر التفاعلات بين الخلايا من اثنين من البروتينات متشابك المعروفة من خلال إدخال طفرة نقطة وجدت في المريض مع الإعاقة الفكرية والصرع، استخدمنا أعلاه هيك خلية تجميع المقايسة(الشكل 1). وقد تم نقل الخلايا وفقا ل...

Watch this Scientific Journal Video about Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System at JoVE.com

Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

هنا، نقدم بروتوكول الأمثل لقياس بسرعة وشبه متزامنة التفاعلات مستقبلات رابطة في trans في نظام خلية غير متغايرة باستخدام المجهر الفلورية.

قياس التفاعلات عبر الخلية من خلال تجميع البروتين في نظام الخلايا heterologous

Protein interactions at cellular interfaces dictate a multitude of biological outcomes ranging from tissue development and cancer progression to synapse ...

measuring-transcellular-interactions-through-protein-aggregation

Universidad de Cartagena UDEC

Research

JoVE Journal

Neuroscience

3.4K Views.  University of Colorado Denver School of Medicine. هنا، نقدم بروتوكول الأمثل لقياس بسرعة وشبه متزامنة التفاعلات مستقبلات رابطة في trans في نظام خلية غير متغايرة باستخدام المجهر الفلورية.

Video: Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Extracellular Protein Microarray Technology for High Throughput Detection of Low Affinity Receptor-Ligand Interactions

Secreted factors, membrane-tethered receptors, and their interacting partners are main regulators of cellular communication and initiation of signaling cascades during homeostasis and disease, and as such represent prime therapeutic targets. Despite their relevance, these interaction networks remain significantly underrepresented in current databases; therefore, most extracellular proteins have no documented binding partner. This discrepancy is primarily due to the challenges associated with the study of the extracellular proteins, including expression of functional proteins, and the weak, low affinity, protein interactions often established between cell surface receptors. The purpose of this method is to describe the printing of a library of extracellular proteins in a microarray format for screening of protein-protein interactions. To enable detection of weak interactions, a method based on multimerization of the query protein under study is described. Coupled to this microbead-based multimerization approach for increased multivalency, the protein microarray allows robust detection of transient protein-protein interactions in high throughput. This method offers a rapid and low sample consuming-approach for identification of new interactions applicable to any extracellular protein. Protein microarray printing and screening protocol are described. This technology will be useful for investigators seeking a robust method for discovery of protein interactions in the extracellular space.

Here, we present a protocol to screen extracellular protein microarrays for identification of novel receptor-ligand interactions in high throughput. We also describe a method to enhance detection of transient protein-protein interactions by using protein-microbead complexes.

البروتين خارج الخلية ميكرواري تكنولوجيا للكشف عن ارتفاع الإنتاجية منخفضة تقارب مستقبلات-يجند التفاعلات

Secreted factors, membrane-tethered receptors, and their interacting partners are main regulators of cellular communication and initiation of signaling ...

Biochemistry

A Fluorescence Fluctuation Spectroscopy Assay of Protein-Protein Interactions at Cell-Cell Contacts

A variety of biological processes involves cell-cell interactions, typically mediated by proteins that interact at the interface between neighboring cells. Of interest, only few assays are capable of specifically probing such interactions directly in living cells. Here, we present an assay to measure the binding of proteins expressed at the surfaces of neighboring cells, at cell-cell contacts. This assay consists of two steps: mixing of cells expressing the proteins of interest fused to different fluorescent proteins, followed by fluorescence fluctuation spectroscopy measurements at cell-cell contacts using a confocal laser scanning microscope. We demonstrate the feasibility of this assay in a biologically relevant context by measuring the interactions of the amyloid precursor-like protein 1 (APLP1) across cell-cell junctions. We provide detailed protocols on the data acquisition using fluorescence-based techniques (scanning fluorescence cross-correlation spectroscopy, cross-correlation number and brightness analysis) and the required instrument calibrations. Further, we discuss critical steps in the data analysis and how to identify and correct external, spurious signal variations, such as those due to photobleaching or cell movement.
In general, the presented assay is applicable to any homo- or heterotypic protein-protein interaction at cell-cell contacts, between cells of the same or different types and can be implemented on a commercial confocal laser scanning microscope. An important requirement is the stability of the system, which needs to be sufficient to probe diffusive dynamics of the proteins of interest over several minutes.

This protocol describes a fluorescence fluctuation spectroscopy-based approach to investigate interactions among proteins mediating cell-cell interactions, i.e. proteins localized in cell junctions, directly in living cells. We provide detailed guidelines on instrument calibration, data acquisition and analysis, including corrections to possible artefact sources.

تحليل الطيفي تقلب Fluorescence من تفاعلات البروتين البروتين في الخلية جهات الاتصال

A variety of biological processes involves cell-cell interactions, typically mediated by proteins that interact at the interface between neighboring ...

Bead Aggregation Assays for the Characterization of Putative Cell Adhesion Molecules

Cell-cell adhesion is fundamental to multicellular life and is mediated by a diverse array of cell surface proteins. However, the adhesive interactions for many of these proteins are poorly understood. Here we present a simple, rapid method for characterizing the adhesive properties of putative homophilic cell adhesion molecules. Cultured HEK293 cells are transfected with DNA plasmid encoding a secreted, epitope-tagged ectodomain of a cell surface protein. Using functionalized beads specific for the epitope tag, the soluble, secreted fusion protein is captured from the culture medium. The coated beads can then be used directly in bead aggregation assays or in fluorescent bead sorting assays to test for homophilic adhesion. If desired, mutagenesis can then be used to elucidate the specific amino acids or domains required for adhesion. This assay requires only small amounts of expressed protein, does not require the production of stable cell lines, and can be accomplished in 4 days.

Here we present a simple, rapid method for characterizing the intrinsic adhesive properties of putative cell adhesion molecules. The secreted, epitope-tagged ectodomain of a cell adhesion molecule is captured from the culture medium on small, uniform functionalized beads. These beads can then be used immediately in simple bead aggregation assays.

حبة تجميع فحوصات لتوصيف المزعومين خلية التصاق جزيئات

Cell-cell adhesion is fundamental to multicellular life and is mediated by a diverse array of cell surface proteins. However, the adhesive interactions ...

Bioengineering

Monitoring Protein Aggregation Kinetics In Vivo using Automated Inclusion Counting in Caenorhabditis elegans

Protein aggregation into insoluble inclusions is a hallmark of a variety of human diseases, many of which are age-related. The nematode Caenorhabditis elegans is a well-established model organism that has been widely used in the field to study protein aggregation and toxicity. Its optical transparency enables the direct visualization of protein aggregation by fluorescence microscopy. Moreover, the fast reproductive cycle and short lifespan make the nematode a suitable model to screen for genes and molecules that modulate this process.
However, the quantification of aggregate load in living animals is poorly standardized, typically performed by manual inclusion counting under a fluorescence dissection microscope at a single time point. This approach can result in high variability between observers and limits the understanding of the aggregation process. In contrast, amyloid-like protein aggregation in vitro is routinely monitored by thioflavin T fluorescence in a highly quantitative and time-resolved fashion.
Here, an analogous method is presented for the unbiased analysis of aggregation kinetics in living C. elegans, using a high-throughput confocal microscope combined with custom-made image analysis and data fitting. The applicability of this method is demonstrated by monitoring inclusion formation of a fluorescently labeled polyglutamine (polyQ) protein in the body wall muscle cells. The image analysis workflow allows the determination of the numbers of inclusions at different timepoints, which are fitted to a mathematical model based on independent nucleation events in individual muscle cells. The method described here may prove useful to assess the effects of proteostasis factors and potential therapeutics for protein aggregation diseases in a living animal in a robust and quantitative manner.

Monitoring Protein Aggregation Kinetics In Vivo using Automated Inclusion Counting in Caenorhabditis elegans

Here, a method is presented for the analysis of protein aggregation kinetics in the nematode Caenorhabditis elegans. Animals from an age-synchronized population are imaged at different time points, followed by semiautomated inclusion counting in CellProfiler and fitting to a mathematical model in AmyloFit.

مراقبة حركية تجميع البروتين في الجسم الحي باستخدام عد التضمين الآلي في Caenorhabditis elegans

Protein aggregation into insoluble inclusions is a hallmark of a variety of human diseases, many of which are age-related. The nematode Caenorhabditis ...

Pulldown Assay Coupled with Co-Expression in Bacteria Cells as a Time-Efficient Tool for Testing Challenging Protein-Protein Interactions

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble effectively in vitro. Such complexes may require co-translational assembly and the presence of molecular chaperones; either they form stable oligomers which cannot dissociate and re-associate in vitro or are unstable without a binding partner. To overcome these problems, it is possible to use a method based on the bacterial co-expression of differentially tagged proteins using a set of compatible vectors followed by the conventional pulldown techniques. The workflow is more time-efficient compared to traditional pulldown because it lacks the time-consuming steps of separate purification of interacting proteins and their following incubation. Another advantage is a higher reproducibility due to a significantly smaller number of steps and a shorter period of time in which proteins that exist within the in vitro environment are exposed to proteolysis and oxidation. The method was successfully applied for studying a number of protein-protein interactions when other in vitro techniques were found to be unsuitable. The method can be used for batch testing protein-protein interactions. Representative results are shown for studies of interactions between BTB domain and intrinsically disordered proteins, and of heterodimers of zinc-finger-associated domains.

Here, we describe a method for the bacterial co-expression of differentially tagged proteins using a set of compatible vectors, followed by the conventional pulldown techniques to study protein complexes that cannot assemble in vitro.

مقايسة السحب إلى جانب التعبير المشترك في خلايا البكتيريا كأداة فعالة من حيث الوقت لاختبار التفاعلات الصعبة بين البروتين والبروتين

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble ...

4D Imaging of Protein Aggregation in Live Cells

One of the key tasks of any living cell is maintaining the proper folding of newly synthesized proteins in the face of ever-changing environmental conditions and an intracellular environment that is tightly packed, sticky, and hazardous to protein stability1. The ability to dynamically balance protein production, folding and degradation demands highly-specialized quality control machinery, whose absolute necessity is observed best when it malfunctions. Diseases such as ALS, Alzheimer's, Parkinson's, and certain forms of Cystic Fibrosis have a direct link to protein folding quality control components2, and therefore future therapeutic development requires a basic understanding of underlying processes. Our experimental challenge is to understand how cells integrate damage signals and mount responses that are tailored to diverse circumstances.
The primary reason why protein misfolding represents an existential threat to the cell is the propensity of incorrectly folded proteins to aggregate, thus causing a global perturbation of the crowded and delicate intracellular folding environment1. The folding health, or "proteostasis," of the cellular proteome is maintained, even under the duress of aging, stress and oxidative damage, by the coordinated action of different mechanistic units in an elaborate quality control system3,4. A specialized machinery of molecular chaperones can bind non-native polypeptides and promote their folding into the native state1, target them for degradation by the ubiquitin-proteasome system5, or direct them to protective aggregation inclusions6-9.
In eukaryotes, the cytosolic aggregation quality control load is partitioned between two compartments8-10: the juxtanuclear quality control compartment (JUNQ) and the insoluble protein deposit (IPOD) (Figure 1 - model). Proteins that are ubiquitinated by the protein folding quality control machinery are delivered to the JUNQ, where they are processed for degradation by the proteasome. Misfolded proteins that are not ubiquitinated are diverted to the IPOD, where they are actively aggregated in a protective compartment.
Up until this point, the methodological paradigm of live-cell fluorescence microscopy has largely been to label proteins and track their locations in the cell at specific time-points and usually in two dimensions. As new technologies have begun to grant experimenters unprecedented access to the submicron scale in living cells, the dynamic architecture of the cytosol has come into view as a challenging new frontier for experimental characterization. We present a method for rapidly monitoring the 3D spatial distributions of multiple fluorescently labeled proteins in the yeast cytosol over time. 3D timelapse (4D imaging) is not merely a technical challenge; rather, it also facilitates a dramatic shift in the conceptual framework used to analyze cellular structure.
We utilize a cytosolic folding sensor protein in live yeast to visualize distinct fates for misfolded proteins in cellular aggregation quality control, using rapid 4D fluorescent imaging. The temperature sensitive mutant of the Ubc9 protein10-12 (Ubc9ts) is extremely effective both as a sensor of cellular proteostasis, and a physiological model for tracking aggregation quality control. As with most ts proteins, Ubc9ts is fully folded and functional at permissive temperatures due to active cellular chaperones. Above 30 &deg;C, or when the cell faces misfolding stress, Ubc9ts misfolds and follows the fate of a native globular protein that has been misfolded due to mutation, heat denaturation, or oxidative damage. By fusing it to GFP or other fluorophores, it can be tracked in 3D as it forms Stress Foci, or is directed to JUNQ or IPOD.

Cellular viability depends on timely and efficient management of protein misfolding. Here we describe a method for visualizing the different potential fates of a misfolded protein: refolding, degradation, or sequestration in inclusions. We demonstrate the use of a folding sensor, Ubc9ts, for monitoring proteostasis and aggregation quality control in live cells using 4D microscopy.

4D التصوير التجميع البروتين في الخلايا الحية

One of the key tasks of any living cell is maintaining the proper folding of newly synthesized proteins in the face of ever-changing environmental ...

Biology

Genetic and Biochemical Approaches for In Vivo and In Vitro Assessment of Protein Oligomerization: The Ryanodine Receptor Case Study

Oligomerization is often a structural requirement for proteins to accomplish their specific cellular function. For instance, tetramerization of the ryanodine receptor (RyR) is necessary for the formation of a functional Ca2+ release channel pore. Here, we describe detailed protocols for the assessment of protein self-association, including yeast two-hybrid (Y2H), co-immunoprecipitation (co-IP) and chemical cross-linking assays. In the Y2H system, protein self-interaction is detected by &#946;-galactosidase assay in yeast co-expressing GAL4 bait and target fusions of the test protein. Protein self-interaction is further assessed by co-IP using HA- and cMyc-tagged fusions of the test protein co-expressed in mammalian HEK293 cells. The precise stoichiometry of the protein homo-oligomer is examined by cross-linking and SDS-PAGE analysis following expression in HEK293 cells. Using these different but complementary techniques, we have consistently observed the self-association of the RyR N-terminal domain and demonstrated its intrinsic ability to form tetramers. These methods can be applied to protein-protein interaction and homo-oligomerization studies of other mammalian integral membrane proteins.

Genetic and Biochemical Approaches for In Vivo and In Vitro Assessment of Protein Oligomerization: The Ryanodine Receptor Case Study

Oligomerization of the ryanodine receptor, a homo-tetrameric ion channel mediating Ca2+ release from intracellular stores, is critical for skeletal and cardiac muscle contraction. Here, we present complementary in vivo and in vitro methods to detect protein self-association and determine homo-oligomer stoichiometry.

النهج الوراثية والبيوكيميائية ل<em&gt; في فيفو</em&gt; و<em&gt; في المختبر</em&gt; تقييم Oligomerization البروتين: دراسة حالة Ryanodine مستقبلات

Oligomerization is often a structural requirement for proteins to accomplish their specific cellular function. For instance, tetramerization of the ...

In Situ Monitoring of Transiently Formed Molecular Chaperone Assemblies in Bacteria, Yeast, and Human Cells

J-domain proteins (JDPs) form the largest and the most diverse co-chaperone family in eukaryotic cells. Recent findings show that specific members of the JDP family could form transient heterocomplexes in eukaryotes to fine-tune substrate selection for the 70 kDa heat shock protein (Hsp70) chaperone-based protein disaggregases. The JDP complexes target acute/chronic stress induced aggregated proteins and presumably help assemble the disaggregases by recruiting multiple Hsp70s to the surface of protein aggregates. The extent of the protein quality control (PQC) network formed by these physically interacting JDPs remains largely uncharacterized in vivo. Here, we describe a microscopy-based in situ protein interaction assay named the proximity ligation assay (PLA), which is able to robustly capture&#160;these transiently formed chaperone complexes in distinct cellular compartments of eukaryotic cells. Our work expands the employment of PLA from human cells to yeast (Saccharomyces cerevisiae) and bacteria (Escherichia coli), thus rendering an important tool to monitor the dynamics of transiently formed protein assemblies in both prokaryotic and eukaryotic cells.

Cognate J-domain proteins cooperate with the Hsp70 chaperone to assist in a myriad of biological processes ranging from protein folding to degradation. Here, we describe an in situ proximity ligation assay, which allows the monitoring of these transiently formed chaperone machineries in bacterial, yeast and human cells.

الرصد في الموقع للجمعيات النكّيّازة الجزيئية المشكلة بشكل عابر في البكتيريا والخميرة والخلايا البشرية

J-domain proteins (JDPs) form the largest and the most diverse co-chaperone family in eukaryotic cells. Recent findings show that specific members of the ...

القياس الكمي القائم على التصوير أحادي الجزيء للخلية الحية لتفاعلات البروتين

Single-Molecule Measurement of Protein Interaction Dynamics Within Biomolecular Condensates

Biomolecular condensates formed via liquid-liquid phase separation (LLPS) have been considered critical in cellular organization and an increasing number of cellular functions. Characterizing LLPS in live cells is also important because aberrant condensation has been linked to numerous diseases, including cancers and neurodegenerative disorders. LLPS is often driven by selective, transient, and multivalent interactions between intrinsically disordered proteins. Of great interest are the interaction dynamics of proteins participating in LLPS, which are well-summarized by measurements of their binding residence time (RT), that is, the amount of time they spend bound within condensates. Here, we present a method based on live-cell single-molecule imaging that allows us to measure the mean RT of a specific protein within condensates. We simultaneously visualize individual protein molecules and the condensates with which they associate, use single-particle tracking (SPT) to plot single-molecule trajectories, and then fit the trajectories to a model of protein-droplet binding to extract the mean RT of the protein. Finally, we show representative results where this single-molecule imaging method was applied to compare the mean RTs of a protein at its LLPS condensates when fused and unfused to an oligomerizing domain. This protocol is broadly applicable to measuring the interaction dynamics of any protein that participates in LLPS.

تسليط الضوء على المؤلف: تقييم ديناميكيات مكثفات البروتين في الخلايا البشرية الحية

Many intrinsically disordered proteins have been shown to participate in the formation of highly dynamic biomolecular condensates, a behavior important for numerous cellular processes. Here, we present a single-molecule imaging-based method for quantifying the dynamics by which proteins interact with each other in biomolecular condensates in live cells.

قياس جزيء واحد لديناميكيات تفاعل البروتين داخل المكثفات الجزيئية الحيوية

Biomolecular condensates formed via liquid-liquid phase separation (LLPS) have been considered critical in cellular organization and an increasing number ...

قياس التفاعلات عبر الخلية من خلال تجميع البروتين في نظام الخلايا heterologous

Summary

Explore More Videos

Chapters in this video

البروتين خارج الخلية ميكرواري تكنولوجيا للكشف عن ارتفاع الإنتاجية منخفضة تقارب مستقبلات-يجند التفاعلات

تحليل الطيفي تقلب Fluorescence من تفاعلات البروتين البروتين في الخلية جهات الاتصال

حبة تجميع فحوصات لتوصيف المزعومين خلية التصاق جزيئات

مراقبة حركية تجميع البروتين في الجسم الحي باستخدام عد التضمين الآلي في Caenorhabditis elegans

مقايسة السحب إلى جانب التعبير المشترك في خلايا البكتيريا كأداة فعالة من حيث الوقت لاختبار التفاعلات الصعبة بين البروتين والبروتين

4D التصوير التجميع البروتين في الخلايا الحية

النهج الوراثية والبيوكيميائية ل

الرصد في الموقع للجمعيات النكّيّازة الجزيئية المشكلة بشكل عابر في البكتيريا والخميرة والخلايا البشرية

قياس جزيء واحد لديناميكيات تفاعل البروتين داخل المكثفات الجزيئية الحيوية

قياس جزيء واحد لديناميكيات تفاعل البروتين داخل المكثفات الجزيئية الحيوية