أيد هذا العمل منحة من "مؤسسة العلوم إسرائيل" 514415 (إلى ج. س.) وقوات أمن الحدود الهندية-جبهة الخلاص الوطني (المجلس) منحة 2016707 (ج. س.). دعم من سيغفريد وأولمان إيرما كرسي الأساتذة (إلى ج. س.) من المسلم به أيضا.

<ol>
	<li>Tsimring, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Noise+in+biology.">Noise in biology.</a> Reports Prog. Phys. 77 (2), 26601 (2014).</li><li>Arbel-Goren, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcript+degradation+and+noise+of+small+RNA-controlled+genes+in+a+switch+activated+network+in+Escherichia+coli.">Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli.</a> Nucleic Acids Res. 44 (14), 6707-6720 (2016).</li><li>Arbel-Goren, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+post-transcriptional+regulation+on+phenotypic+noise+in+Escherichia+coli.">Effects of post-transcriptional regulation on phenotypic noise in Escherichia coli.</a> Nucleic Acids Res. 41 (9), 4825-4834 (2013).</li><li>van Gijtenbeek, L. A., Robinson, A., van Oijen, A. M., Poolman, B., Kok, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+Spatial+Organization+of+mRNA,+Plasmids,+and+Ribosomes+in+a+Bacterial+Host+Overexpressing+Membrane+Proteins.">On the Spatial Organization of mRNA, Plasmids, and Ribosomes in a Bacterial Host Overexpressing Membrane Proteins.</a> PLOS Genet. 12 (12), e1006523 (2016).</li><li>Raj, A., vanden Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+individual+mRNA+molecules+using+multiple+singly+labeled+probes.">Imaging individual mRNA molecules using multiple singly labeled probes.</a> Nat. Methods. 5 (10), 877-879 (2008).</li><li>Raj, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+individual+endogenous+RNA+transcripts+in+situ+using+multiple+singly+labeled+probes.">Detection of individual endogenous RNA transcripts in situ using multiple singly labeled probes.</a> Methods Enzymol. 472 (10), (2010).</li><li>Skinner, S. O., La Sep&#250;lveda, ., Xu, H., Golding, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+mRNA+copy+number+in+individual+Escherichia+coli+cells+using+single-molecule+fluorescent+in+situ+hybridization.">Measuring mRNA copy number in individual Escherichia coli cells using single-molecule fluorescent in situ hybridization.</a> Nat. Protoc. 8 (6), 1100-1113 (2013).</li><li>Barakat, T. S., Gribnau, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combined+DNA-RNA+fluorescent+in+situ+hybridization+(FISH)+to+study+X+chromosome+inactivation+in+differentiated+female+mouse+embryonic+stem+cells.">Combined DNA-RNA fluorescent in situ hybridization (FISH) to study X chromosome inactivation in differentiated female mouse embryonic stem cells.</a> J. Vis. Exp. (88), e51628 (2014).</li><li>Chen, K. H., Boettiger, A. N., Moffitt, J. R., Wang, S., Zhuang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+imaging.+Spatially+resolved,+highly+multiplexed+RNA+profiling+in+single+cells.">RNA imaging. Spatially resolved, highly multiplexed RNA profiling in single cells.</a> Science. 348 (6233), aaa6090 (2015).</li><li>van Gijtenbeek, L. A., Kok, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Illuminating+messengers:+An+update+and+outlook+on+RNA+visualization+in+bacteria.">Illuminating messengers: An update and outlook on RNA visualization in bacteria.</a> Front. Microbiol. 8, 1-19 (2017).</li><li>Fei, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+in+vivo+target+search+kinetics+of+regulatory+noncoding+RNA.">Determination of in vivo target search kinetics of regulatory noncoding RNA.</a> Science. 347 (6228), 1371-1374 (2015).</li><li>Moffitt, J. R., Pandey, S., Boettiger, A. N., Wang, S., Zhuang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+organization+shapes+the+turnover+of+a+bacterial+transcriptome.">Spatial organization shapes the turnover of a bacterial transcriptome.</a> Elife. 5, 1-22 (2016).</li><li>Ong, W. Q., Citron, Y. R., Sekine, S., Huang, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live+Cell+Imaging+of+Endogenous+mRNA+Using+RNA-Based+Fluorescence+"Turn-On"+Probe.">Live Cell Imaging of Endogenous mRNA Using RNA-Based Fluorescence "Turn-On" Probe.</a> ACS Chem. Biol. , (2016).</li><li>Golding, I., Paulsson, J., Zawilski, S. M., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+kinetics+of+gene+activity+in+individual+bacteria.">Real-time kinetics of gene activity in individual bacteria.</a> Cell. 123 (6), 1025-1036 (2005).</li><li>Golding, I., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+8+Spatiotemporal+Dynamics+in+Bacterial+Cells:+Real-Time+Studies+with+Single-Event+Resolution.">Chapter 8 Spatiotemporal Dynamics in Bacterial Cells: Real-Time Studies with Single-Event Resolution.</a> Methods Cell Biol. 89 (8), (2008).</li><li>So, L. H., Ghosh, A., Zong, C., Sepulveda, L. A., Segev, R., Golding, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+properties+of+transcriptional+time+series+in+Escherichia+coli.">General properties of transcriptional time series in Escherichia coli.</a> Nat. Genet. 43 (6), 554-560 (2011).</li><li>Spahn, C., Endesfelder, U., Heilemann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Super-resolution+imaging+of+Escherichia+coli+nucleoids+reveals+highly+structured+and+asymmetric+segregation+during+fast+growth.">Super-resolution imaging of Escherichia coli nucleoids reveals highly structured and asymmetric segregation during fast growth.</a> J. Struct. Biol. 185 (3), 243-249 (2014).</li><li>Sliusarenko, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbetracker+software.">Microbetracker software.</a> Mol Microbiol. 80 (3), 612-627 (2012).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, 8 (2006).</li><li>Arbel-Goren, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcript+degradation+and+noise+of+small+RNA-controlled+genes+in+a+switch+activated+network+in+Escherichia+coli.">Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli.</a> Nucleic Acids Res. 44 (14), 6707-6720 (2016).</li><li>Brandt, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+two-state+stabilization-change+mechanism+for+proton-pumping+complex+I.">A two-state stabilization-change mechanism for proton-pumping complex I.</a> Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1807 (10), 1364-1369 (2011).</li></ol>

الكتاب ليس لها علاقة بالكشف عن.

وقد قمنا بقياس في المختبر عدد نسخة من جينات مختلفة في الخلايا كولاي باستخدام الأسلوب سمفيش2. باختصار، هذا الإجراء يتكون من الخطوات التالية: تثبيت الخلية، permeabilization الأغشية للسماح لاختراق التحقيق، التحقيق في التهجين، وعينه التصوير باستخدام مجهر الأسفار قياسية. ويستند هذ?...

ستوتشاستيسيتي هو أحد جوانب الأساسية والتي لا يمكن تجنبها للتعبير الجيني ويؤدي إلى الخلية الخلية التغايرية1، سواء على مستوى النصوص والبروتينات2،3. التحديد الكمي للتفاوت بين الخلايا تحت ظروف محددة جيدا توفر نافذة فريدة من نوعها في العمليات الأساسية التي تكمن وراء التعبير الجيني ولائحته. واحد مصدرا هاما للخلية عدم التجانس في البكتيريا تجري على المستوى النسخي. تتباين أرقام نسخة ليس فقط بسبب ستوتشاستيسيتي للنسخ، ولكن أيضا لعمليات بوستترانسكريبشونال مثل تنظيم الكشف ورناسيس صغيرة2. طريقة واحدة للوصول مباشرة إلى هذا التباين بطريقة كمية علامات النصوص الفردية لجين معين فلوريسسينتلي في سمفيش. هذه المنهجية يسمح بالكشف عن والتعريب سوبسيلولار من جزيئات الحمض النووي الريبي خاصة في ثابتة، الخلايا البكتيرية الفردية4. يتم تهجين مرناس مع مجموعة من المسمى فلوريسسينتلي ~ 20 قاعدة طويلة النوكليوتيد التي تهدف إلى ربط بشكل انتقائي للمحاضر الحرفية للفائدة5،6. العلامات متعددة تضمن الكشف أعلاه الخلفية الفلورية، والفرد مرناً الجزيئات تظهر كبقع حيود محدودة تحت مجهر الأسفار7 (انظر الشكل 1). وهناك نهج أخرى لوصف جزيئات مرناً، التي تحمل تحقيقات تكميلية oligomer haptens مترافق (مثلاً، البيوتين أو ديجوكسيجينين) التي تم الكشف عنها باستخدام تقنيات مراسل الثانوي المسمى فلوريسسينتلي8.
وهناك أساليب أخرى توفر معلومات كمية عن النصوص، بالإضافة إلى سمفيش. بعضها، مثل الشمالي لطخة أو PCR الكمي، التحقيق الجزء الأكبر وهكذا يمكن قياس عدد نسخ مرناً لا موقفهم في الخلايا الفردية. ولهذه الأساليب ليست مناسبة لقياس التغير خلية إلى خلية. تم تطوير تقنية المستندة إلى الصورة الأخيرة التي تسمح للتقدير الكمي لعدد نسخ الكشف داخل الخلايا، فضلا عن موقعها داخل الخلايا، ودعا متعدد الأسفار خطأ قوية في الموقع التهجين (ميرفيش). ميرفيش يستند تعيين رمز شريطي فريد يتألف من مجموعة محددة من عدد محدد من المسابر اليغنوكليوتيد المسمى فلوريسسينتلي. يتم قراءة هذه الرموز الشريطية في جولات متتابعة من القياسات سمفيش، مع فوتوبليتشينج بعد كل جولة من التهجين، وبالتالي زيادة الإنتاجية بأوامر اثنين من حجم9،10. يتطلب هذا الأسلوب سائل الآلي التعامل مع النظام والتصميم السليم لمجموعة التحقيق.
يتيح الجمع بين عدة fluorescence تسمية النصوص الفردية، جنبا إلى جنب مع تقنيات رواية القرار عظمى مثل التعمير البصرية العشوائية مجهرية (العاصفة)11، بزيادة عشرة إضعاف في القرار في سوبسيلولار ترجمة النصوص. في العاصفة، يسمح مزيج مناسب من المسابر الفلورسنت والمخزن المؤقت للتصوير لدورات متعددة من انبعاث الأسفار كل جزيء مسبار (وامض). كما يمكن استخدام العاصفة صورة الترنسكربيتوم كولاي ومراقبة منظمة الجينوم المنظومة المكانية من الجيش الملكي النيبالي، بوسم جميع وقائع الفائدة12في وقت واحد.
تستند كافة الأساليب وحيدة الخلية التي تم استعراضها أعلاه التصوير المحاضر في الخلايا الثابتة. ومن ثم فإنها لا توفر أية معلومات تتعلق بالخصائص الحركية للنصوص داخل الخلايا. متابعة المحاضر في الخلايا الحية13، يمكن أن تعتبرها مرناس انصهار الجينات التي تهم مجموعة من مواقع الربط. هذه الأخيرة هي ثم يقرها بروتين الحمض النووي الريبي ملزمة، مثل عاثية MS2 معطف البروتين، الذي هو تنصهر فيها بروتين فلوري مثل البروتينات الفلورية الخضراء (بروتينات فلورية خضراء)10،،من1415.
هنا يصف لنا طريقة لوسم مرناس الفردية مع مجموعة من المجسات الحمض النووي المسمى فلوريسسينتلي، لاستخدامها في التجارب سمفيش، ولا سيما في كولاي. وعلاوة على ذلك، نحن تظهر أنه يمكن استخدام نفس نظام وضع العلامات للقياسات العاصفة مع تعديلات طفيفة.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr >
			<td >Dextran sulfate sodium salt</td>
			<td >Sigma-Aldrich</td>
			<td >D8906</td>
			<td ></td>
		</tr>
		<tr >
			<td >Pure Ethanol, 99.5%, ACS reagent, absolute</td>
			<td >Mallinckrodt Baker - Avantor</td>
			<td >8025.25</td>
			<td ></td>
		</tr>
		<tr >
			<td >Diethylpyrocarbonate (DEPC)</td>
			<td >Sigma-Aldrich</td>
			<td >D5758</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free 20X SSC</td>
			<td >Life Technologies/Ambion</td>
			<td >AM9763</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free 10X PBS</td>
			<td >Life Technologies/Ambion</td>
			<td >AM9625</td>
			<td ></td>
		</tr>
		<tr >
			<td >TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) BioUltra, for molecular biology</td>
			<td >Sigma-Aldrich</td>
			<td >93283</td>
			<td ></td>
		</tr>
		<tr >
			<td >nuclease-free water</td>
			<td >Thermo Fisher Scientific</td>
			<td >10977035</td>
			<td ></td>
		</tr>
		<tr >
			<td >Formaldehyde solution for molecular biology, 36.5-38% in water</td>
			<td >Sigma-Aldrich</td>
			<td >F8775</td>
			<td ></td>
		</tr>
		<tr >
			<td >Deionized formamide, nuclease free</td>
			<td >Thermo Fisher Scientific/Ambion</td>
			<td >AM9342</td>
			<td ></td>
		</tr>
		<tr >
			<td >E. coli tRNA (ribonucleic acid, transfer type xx from escherichia)</td>
			<td >Sigma-Aldrich</td>
			<td >R1753-500UN</td>
			<td ></td>
		</tr>
		<tr >
			<td >UltraPure BSA (50mg/ml)</td>
			<td >Thermo Fisher Scientific/Ambion</td>
			<td >AM2616</td>
			<td ></td>
		</tr>
		<tr >
			<td >Vanadyl-ribonucleoside complex,VRC, 200 mM</td>
			<td >New England Biolab</td>
			<td >S1402S</td>
			<td ></td>
		</tr>
		<tr >
			<td >Poly-L-Lysine</td>
			<td>Sigma</td>
			<td >P4707</td>
			<td ></td>
		</tr>
		<tr >
			<td >Cysteamine and oxygen</td>
			<td >Sigma-Aldrich</td>
			<td >30070</td>
			<td ></td>
		</tr>
		<tr >
			<td >Glucose Oxidase from Aspergillus niger, Type VII, 50KU</td>
			<td >Sigma-Aldrich</td>
			<td >G2133</td>
			<td ></td>
		</tr>
		<tr >
			<td >Catalase</td>
			<td >Sigma-Aldrich</td>
			<td >C40</td>
			<td ></td>
		</tr>
		<tr >
			<td >D-glucose</td>
			<td >Sigma-Aldrich</td>
			<td >G8270</td>
			<td ></td>
		</tr>
		<tr >
			<td >D-fucose</td>
			<td >Sigma-Aldrich</td>
			<td >F8150</td>
			<td ></td>
		</tr>
		<tr >
			<td >Vybrant DiO Cell-Labeling Solution</td>
			<td >Life Technologies</td>
			<td >V2286</td>
			<td ></td>
		</tr>
		<tr >
			<td >Agarose,low melting reagent</td>
			<td >Sigma-Aldrich</td>
			<td >A9414</td>
			<td ></td>
		</tr>
		<tr >
			<td >Adhesive silicone isolator 24-2mm Dia. X 1.8 mm depth JTR24R-A2-2.0</td>
			<td >Grace Bio-Labs</td>
			<td >JTR24R-A2-2.0 666208</td>
			<td ></td>
		</tr>
		<tr >
			<td >poly-D-lysine-coated glass bottom Glass Bottom Culture Dishes</td>
			<td >MatTek Corporation</td>
			<td >P35GC-1.5-14-C</td>
			<td ></td>
		</tr>
		<tr >
			<td >Super life nitrile powder free examination gloves</td>
			<td >Supermax</td>
			<td >TC-N-9889</td>
			<td ></td>
		</tr>
		<tr >
			<td >Brand sterilization incubator tape</td>
			<td >Sigma-Aldrich</td>
			<td >BR61750</td>
			<td ></td>
		</tr>
		<tr >
			<td >Microcentrifuge tubes (1.8 ml)</td>
			<td >Axygen - Corning Life Sciences</td>
			<td >MCT-175C</td>
			<td ></td>
		</tr>
		<tr >
			<td >Falcon round-bottom polypropylene tubes (14 ml)</td>
			<td >BD Biosciences</td>
			<td >352059</td>
			<td ></td>
		</tr>
		<tr >
			<td >Conical-bottom centrifuge polypropylene tubes (50 ml)</td>
			<td >Corning</td>
			<td >430828</td>
			<td ></td>
		</tr>
		<tr >
			<td >Serological pipettes (Corning 5 ml)</td>
			<td >Corning Life Sciences</td>
			<td >4051</td>
			<td ></td>
		</tr>
		<tr >
			<td >Serological pipettes (Corning 10 ml)</td>
			<td >Corning Life Sciences</td>
			<td >4488</td>
			<td ></td>
		</tr>
		<tr >
			<td >Serological pipettes (Corning 25 ml)</td>
			<td >Corning Life Sciences</td>
			<td >4251</td>
			<td ></td>
		</tr>
		<tr >
			<td >Spectrophotometer cuvettes</td>
			<td >Sarstedt</td>
			<td >67.742</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free pipette tips 0.2 - 20 &#956;l</td>
			<td >FroggaBio</td>
			<td >FT20</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free pipette tips 10 - 200 &#956;l</td>
			<td >Axigene/corning</td>
			<td >TF-200</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free pipette tips 100 - 1000 &#956;l</td>
			<td >FroggaBio</td>
			<td >FT1000</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free pipette tips 100 - 1000 &#956;l</td>
			<td>Sorenson</td>
			<td >14200</td>
			<td ></td>
		</tr>
		<tr >
			<td >Syringe disposile 10 mL needle G-21</td>
			<td>Becton Dickinson, Biosciences</td>
			<td >BD-309643</td>
			<td ></td>
		</tr>
		<tr >
			<td >Minisart 0.2 um Syringe Filter</td>
			<td >Sartorius</td>
			<td >16534 K</td>
			<td ></td>
		</tr>
		<tr >
			<td >Nikon instruments microscope type A immersion oil A, 8cc</td>
			<td >Nikon</td>
			<td >MXA20233</td>
			<td ></td>
		</tr>
		<tr >
			<td >Microscope slides 76 x26, 3&#34;x1&#34;x1mm</td>
			<td >Thermo Fisher Scientific</td>
			<td >421-004ET</td>
			<td ></td>
		</tr>
		<tr >
			<td >#0 coverslip slide 24x60</td>
			<td >Thermo Fisher Scientific/Menzel</td>
			<td >BNBB024060A0</td>
			<td ></td>
		</tr>
		<tr >
			<td >Orbital shaker</td>
			<td >M.R.C</td>
			<td >TOU-50</td>
			<td ></td>
		</tr>
		<tr >
			<td >Hot block</td>
			<td >M.R.C</td>
			<td ></td>
			<td ></td>
		</tr>
		<tr >
			<td >Vortex</td>
			<td >Fried Electric Company</td>
			<td >G-560-E</td>
			<td ></td>
		</tr>
		<tr >
			<td >Microcentrifuge</td>
			<td >Eppendorf</td>
			<td >5427R</td>
			<td ></td>
		</tr>
		<tr >
			<td >Centrifuge</td>
			<td >Eppendorf</td>
			<td >5810R</td>
			<td ></td>
		</tr>
		<tr >
			<td >Portable Pipet-Aid XP2, Pipette Controller</td>
			<td >Drummond Scientific Company</td>
			<td >4-000-501-I</td>
			<td ></td>
		</tr>
		<tr >
			<td >OD600 Spectrophotometer for Bacterial Growth Rates DiluPhotometer</td>
			<td >Midsci</td>
			<td >OD600-10</td>
			<td ></td>
		</tr>
		<tr >
			<td >iXon X3 EMCCD camera</td>
			<td >Andor</td>
			<td >DU-897E-CS0-#BV</td>
			<td > </td>
		</tr>
		<tr >
			<td >Eclipse Ti microscope</td>
			<td >Nikon</td>
			<td >MEA53100</td>
			<td > </td>
		</tr>
		<tr >
			<td >CFI plan apochromat DM 100X oil objective lambda PH-3 N.A 1.45 WD 0.13</td>
			<td >Nikon</td>
			<td >MRD31905</td>
			<td > </td>
		</tr>
		<tr >
			<td >Filter set (TRITC/CY3): EX - ET545/30X; EM - ET620/60M; BS - T570LP</td>
			<td >Nikon</td>
			<td >49005</td>
			<td > </td>
		</tr>
		<tr >
			<td >Filter set (CY5): EX - ET640/30X; EM - ET690/50M; BS - T660P</td>
			<td >Nikon</td>
			<td >49009</td>
			<td > </td>
		</tr>
		<tr >
			<td >Nis-elements AR auto reaserch software</td>
			<td >Nikon</td>
			<td >MQS31000</td>
			<td > </td>
		</tr>
		<tr >
			<td >STORM microscope</td>
			<td >Vutara</td>
			<td >SR-200</td>
			<td > </td>
		</tr>
		<tr >
			<td >NA 1.2 water immersion objective </td>
			<td >Olympus</td>
			<td > </td>
			<td > </td>
		</tr>
		<tr >
			<td >SRX image acquisition and analysis software</td>
			<td >Vutara</td>
			<td ></td>
			<td ></td>
		</tr>
		<tr >
			<td >Evolve 512 EMCCD camera</td>
			<td >Photometrics</td>
			<td ></td>
			<td ></td>
		</tr>
		<tr >
			<td >Stellaris&#174; FISH Probes, Custom Assay with CAL Fluor&#174; Red 590 Dye</td>
			<td >Biosearch Technologies Inc</td>
			<td >SMF-1083-5</td>
			<td ></td>
		</tr>
		<tr >
			<td >Probe Sequence for galK mRNA:</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtgttttttctttcagactc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tagccaaatgcgttggcaaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ctgaatggtgtgagtggcag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >caccaatcaaattcacgcgg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acgaaaccgtcgttgtagtc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgataatcaatcgcgcaggg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtggtgcacaactgatcacg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acgcgaactttacggtcatc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gctgattttcataatcggct</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gcatcgagggaaaactcgtc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gttttcatgtgcgacaatgg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >cacgccacgaacgtagttag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttacgcagttgcagatgttt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tccagtgaagcggaagaact</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgctgcaatacggttccgac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtccagcggcagatgataaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgaccgttaagcgcgatttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >agcctacaaactggttttct</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gcggaaattagctgatccat</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >aaggcatgatctttcttgcc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >cagtgagcggcaatcgatca</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgggcatggaaactgctttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gatgatgacgacagccacac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gggtacgtttgaagttactg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtgttgtattcgctgccaac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggtttcgcactgttcacgac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tggctgctggaagaaacgcg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttcaatggtgacatcacgca</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >catgcgcaacagcgttgaac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggcgttttcagtcagtatat</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >atacgtttcaggtcgccttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgagactccgccatcaactc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gaaatcatcgcgcatagagg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >caatttgcggcacggtgatt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttgacgatttctaccagagt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acctttgtcgccaatcacag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggatcagcgcgacgatacag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >atattgttcagcgacagctt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtctctttaatacctgtttt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ctccttgtgatggtttacaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >Stellaris&#174; FISH Probes, Custom Assay with Quaser Fluor&#174; Red 670 Dye</td>
			<td >Biosearch Technologies Inc</td>
			<td >SMF-1083-5</td>
			<td ></td>
		</tr>
		<tr >
			<td >Probe Sequence for sodB mRNA:</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtgttttttctttcagactc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tagccaaatgcgttggcaaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ctgaatggtgtgagtggcag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >caccaatcaaattcacgcgg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acgaaaccgtcgttgtagtc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgataatcaatcgcgcaggg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtggtgcacaactgatcacg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acgcgaactttacggtcatc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gctgattttcataatcggct</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gcatcgagggaaaactcgtc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gttttcatgtgcgacaatgg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >cacgccacgaacgtagttag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttacgcagttgcagatgttt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tccagtgaagcggaagaact</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgctgcaatacggttccgac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtccagcggcagatgataaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgaccgttaagcgcgatttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >agcctacaaactggttttct</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gcggaaattagctgatccat</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >aaggcatgatctttcttgcc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >cagtgagcggcaatcgatca</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgggcatggaaactgctttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gatgatgacgacagccacac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gggtacgtttgaagttactg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtgttgtattcgctgccaac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggtttcgcactgttcacgac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tggctgctggaagaaacgcg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttcaatggtgacatcacgca</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >catgcgcaacagcgttgaac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggcgttttcagtcagtatat</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >atacgtttcaggtcgccttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgagactccgccatcaactc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gaaatcatcgcgcatagagg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >caatttgcggcacggtgatt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttgacgatttctaccagagt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acctttgtcgccaatcacag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggatcagcgcgacgatacag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >atattgttcagcgacagctt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtctctttaatacctgtttt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ctccttgtgatggtttacaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
	</tbody>
</table>

method for labeling transcripts in individual escherichia coli cells for single-molecule fluorescence in situ hybridization experiments

يتم وصف أسلوب لوصف النصوص الفردية رسول من الحمض النووي الريبي (مرناً) في البكتيريا الثابتة للاستخدام في الأسفار جزيء واحد في الموقع تجارب التهجين (سمفيش) في كولاي. يسمح سمفيش قياس التغير خلية إلى خلية في عدد النسخ مرناً للجينات للفائدة، فضلا عن موقع سوبسيلولار للنصوص. الخطوات الرئيسية التي تنطوي عليها هي تثبيت ثقافة الخلية البكتيرية، permeabilization أغشية الخلايا، والتهجين النصوص المستهدفة مع مجموعات من المسابر اليغنوكليوتيد المسمى فلوريسسينتلي القصيرة المتاحة تجارياً. يمكن أن تسمح سمفيش تصوير وقائع جينات متعددة في نفس الخلية، مع القيود التي فرضتها التداخل الطيفي بين علامات مضيئة مختلفة. وعقب انتهاء البروتوكول هو موضح أدناه، خلايا يمكن سهولة تصويرها استخدام مجهر مقترنة بكاميرا مناسبة للأسفار المنخفضة الكثافة. هذه الصور، جنبا إلى جنب مع ملامح الخلية التي تم الحصول عليها من تجزئة المرحلة التباين الإطارات، أو تلطيخ غشاء الخلية، السماح لحساب توزيع مرناً نسخة رقم عينة خلايا باستخدام برمجيات المصدر المفتوح أو كتب مخصصة. يمكن أيضا تطبيق الأسلوب وضع العلامات الموصوفة هنا لنسخ الصورة مع التعمير البصرية العشوائية مجهرية (العاصفة).

قمنا بتنفيذ قياسات سمفيش النصوص جالك وسودب في الخلايا كولاي . تم تهجين النصوص مع مجموعة من تسلسل معين مكملة لتسلسل المستهدفة، كل التحقيق يجري مترافق لجزيء فلوري واحد (انظر الجدول للمواد). الأسفار والمرحلة على النقيض من الصور من MG1655 البرية من نوع سلالة كولاي (WT) أ?...

Watch this Scientific Journal Video about Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments at JoVE.com

Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

طريقة لتصنيف النصوص في الخلايا الفردية الإشريكيّة القولونية للأسفار جزيء واحد في الموقع تجارب التهجين

ويصف هذه المخطوطة أسلوب لوصف النصوص الفردية رسول من الحمض النووي الريبي (مرناً) مع تحقيقات الحمض النووي المسمى فلوريسسينتلي، لاستخدامها في الأسفار جزيء واحد في الموقع تجارب التهجين (سمفيش) في كولاي. سمفيش هو أسلوب تصور يسمح الكشف المتزامن، والترجمة، والتقدير الكمي لواحد مرناً الجزيئات في الخلايا الفردية الثابتة.

A method is described for labeling individual messenger RNA (mRNA) transcripts in fixed bacteria for use in single-molecule fluorescence in situ ...

method-for-labeling-transcripts-individual-escherichia-coli-cells-for

Universidad de Cartagena UDEC

Research

JoVE Journal

Biology

Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

8.1K Views.  Weizmann Institute of Science. ويصف هذه المخطوطة أسلوب لوصف النصوص الفردية رسول من الحمض النووي الريبي (مرناً) مع تحقيقات الحمض النووي المسمى فلوريسسينتلي، لاستخدامها في الأسفار جزيء واحد في الموقع تجارب التهجين (سمفيش) في كولاي. سمفيش هو أسلوب تصور يسمح الكشف المتزامن، والترجمة، و...

Video: Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

Pyrosequencing: A Simple Method for Accurate Genotyping

Pharmacogenetic research benefits first-hand from the abundance of information provided by the completion of the Human Genome Project. With such a tremendous amount of data available comes an explosion of genotyping methods. Pyrosequencing(R) is one of the most thorough yet simple methods to date used to analyze polymorphisms. It also has the ability to identify tri-allelic, indels, short-repeat polymorphisms, along with determining allele percentages for methylation or pooled sample assessment. In addition, there is a standardized control sequence that provides internal quality control. This method has led to rapid and efficient single-nucleotide polymorphism evaluation including many clinically relevant polymorphisms. The technique and methodology of Pyrosequencing is explained.


Pyrosequencing(R) is one of the most thorough yet simple methods to date used to analyze polymorphisms. This method has led to rapid and efficient single-nucleotide polymorphism evaluation including many clinically relevant polymorphisms. The technique and methodology of Pyrosequencing is explained.

Pyrosequencing : طريقة بسيطة لالتنميط الجيني دقيقة

Pharmacogenetic research benefits first-hand from the abundance of information provided by the completion of the Human Genome Project. With such a ...

Double Whole Mount in situ Hybridization of Early Chick Embryos

The chick embryo is a valuable tool in the study of early embryonic development. Its transparency, accessibility and ease of manipulation, make it an ideal tool for studying  gene expression in brain, neural tube, somite and heart primordia formation. This video demonstrates the different steps in 2-color whole mount in situ hybridization; First, the embryo is dissected from the egg and fixed in paraformaldehyde. Second, the embryo is processed for prehybridization. The embryo is then hybridized with two different probes, one coupled to DIG, and one coupled to FITC.  Following overnight hybridization, the embryo is incubated with DIG coupled antibody. Color reaction for DIG substrate is performed, and the region of interest appears blue. The embryo is then incubated with FITC coupled antibody. The embryo is processed for color reaction with FITC, and the region of interest appears red. Finally, the embryo is fixed and processed for phtograph and sectioning. A troubleshooting guide is also presented.

This video demonstrates 2-color whole mount in situ hybridization, a method by which the spatial and temporal expression pattern of 2 different genes can be visualized in young chick embryos. This method was originally introduced by David Wilkinson, Domingos Henrique, Phil Ingham and David Ish -Horowicz.

الجامعة جبل مزدوجة في الموقع التهجين لافراخ الدجاج في وقت مبكر

The chick embryo is a valuable tool in the study of early embryonic development. Its transparency, accessibility and ease of manipulation, make it an ...

Fluorescence in situ hybridization (FISH) Protocol in Human Sperm

Aneuploidies are the most frequent chromosomal abnormalities in humans. Most of these abnormalities result from meiotic errors during the gametogenic process in the parents. In human males, these errors can lead to the production of spermatozoa with numerical chromosome abnormalities which represent an increased risk of transmitting these anomalies to the offspring.
For this reason, the technique of fluorescence in situ hybridization (FISH) on sperm nuclei has become a protocol widely incorporated in the context of clinical diagnosis. This practice provides an estimate of the frequencies of numerical chromosome abnormalities in the gametes of the patients that seek for genetic reproductive advice.
To date, the chromosomes most frequently included in sperm FISH analysis are chromosomes X, Y, 13, 18 and 21.
This video-article describes, step by step, how to process and fix a human semen sample, how to decondense and denature the sperm chromatin, how to proceed to obtain sperm FISH preparations, and how to visualize the results at the microscope. Special remarks of the most relevant steps are given to achieve the best results.

Fluorescence in situ hybridization FISH Protocol in Human Sperm

This video-article describes, step by step, how to process a semen sample to achieve good-quality fluorescence in situ hybridization on human spermatozoa. Preparations obtained can be used for aneuploidy screening in the context of clinical diagnosis.

مضان في الموقع التهجين (FISH) البروتوكول في الحيوانات المنوية البشرية

Aneuploidies are the most frequent chromosomal abnormalities in humans. Most of these abnormalities result from meiotic errors during the gametogenic ...

Automated System for Single Molecule Fluorescence Measurements of Surface-immobilized Biomolecules

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, such as nucleic acids and proteins. Single molecule FRET (sm-FRET) measurements on immobilized molecules permit long observations of the system -effectively until both dyes photobleach- resulting in time-traces that report on biomolecular dynamics with a broad range of timescales from milliseconds to minutes. To facilitate the acquisition of large number of traces for statistical analyses, the process must be automated and the sample environment should be tightly controlled over the entire measurement time (~12 hours). This is accomplished using an automated scanning confocal microscope that allows the interrogation of thousands of single molecules overnight, and a microfluidic cell that permits the controlled exchange of buffer, with restricted oxygen content and maintains a constant temperature throughout the entire measuring period. Here we show how to assemble the microfluidic device and how to activate its surface for DNA immobilization. Then we explain how to prepare a buffer to maximize the photostability and lifetime of the fluorophores. Finally, we show the steps involved in preparing the setup for the automated acquisition of time-resolved single molecule FRET traces of DNA molecules.

In this article we describe how we obtain FRET traces from individual DNA molecules immobilized to a surface using an automated scanning confocal microscope.

النظام الآلي للقياسات واحدة الإسفار جزيء من الجزيئات الحيوية سطح يجمد

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, ...

In Situ Hybridization for the Precise Localization of Transcripts in Plants

With the advances in genomics research of the past decade, plant biology has seen numerous studies presenting large-scale quantitative analyses of gene expression. Microarray and next generation sequencing approaches are being used to investigate developmental, physiological and stress response processes, dissect epigenetic and small RNA pathways, and build large gene regulatory networks1-3. While these techniques facilitate the simultaneous analysis of large gene sets, they typically provide a very limited spatiotemporal resolution of gene expression changes. This limitation can be partially overcome by using either profiling method in conjunction with lasermicrodissection or fluorescence-activated cell sorting4-7. However, to fully understand the biological role of a gene, knowledge of its spatiotemporal pattern of expression at a cellular resolution is essential. Particularly, when studying development or the effects of environmental stimuli and mutants can the detailed analysis of a gene's expression pattern become essential. For instance, subtle quantitative differences in the expression levels of key regulatory genes can lead to dramatic phenotypes when associated with the loss or gain of expression in specific cell types. 
Several methods are routinely used for the detailed examination of gene expression patterns. One is through analysis of transgenic reporter lines. Such analysis can, however, become time-consuming when analyzing multiple genes or working in plants recalcitrant to transformation. Moreover, an independent validation to ensure that the transgene expression pattern mimics that of the endogenous gene is typically required. Immunohistochemical protein localization or mRNA in situ hybridization present relatively fast alternatives for the direct visualization of gene expression within cells and tissues. The latter has the distinct advantage that it can be readily used on any gene of interest. In situ hybridization allows detection of target mRNAs in cells by hybridization with a labeled anti-sense RNA probe obtained by in vitro transcription of the gene of interest. 
Here we outline a protocol for the in situ localization of gene expression in plants that is highly sensitivity and specific. It is optimized for use with paraformaldehyde fixed, paraffin-embedded sections, which give excellent preservation of histology, and DIG-labeled probes that are visualized by immuno-detection and alkaline-phosphatase colorimetric reaction. This protocol has been successfully applied to a number of tissues from a wide range of plant species, and can be used to analyze expression of mRNAs as well as small RNAs8-14.

In Situ Hybridization for the Precise Localization of Transcripts in Plants

The in situ hybridization protocol described here allows a direct localization of mRNA and small RNA expression at the cellular level with high sensitivity and specificity. The procedure is optimized for paraffin-embedded plant tissue sections, is applicable to a wide range of plants and tissues, and can be completed within ten days.

في الموقع التهجين لتوطين دقيقة من النصوص في النباتات

With the advances in genomics research of the past decade, plant biology has seen numerous studies presenting large-scale quantitative analyses of gene ...

Detection of Viral RNA by Fluorescence in situ Hybridization (FISH)

Viruses that infect cells elicit specific changes to normal cell functions which serve to divert energy and resources for viral replication. Many aspects of host cell function are commandeered by viruses, usually by the expression of viral gene products that recruit host cell proteins and machineries. Moreover, viruses engineer specific membrane organelles or tag on to mobile vesicles and motor proteins to target regions of the cell (during de novo infection, viruses co-opt molecular motor proteins to target the nucleus; later, during virus assembly, they will hijack cellular machineries that will help in the assembly of viruses). Less is understood on how viruses, in particular those with RNA genomes, coordinate the intracellular trafficking of both protein and RNA components and how they achieve assembly of infectious particles at specific loci in the cell. The study of RNA localization began in earlier work. Developing lower eukaryotic embryos and neuronal cells provided important biological information, and also underscored the importance of RNA localization in the programming of gene expression cascades. The study in other organisms and cell systems has yielded similar important information. Viruses are obligate parasites and must utilise their host cells to replicate. Thus, it is critical to understand how RNA viruses direct their RNA genomes from the nucleus, through the nuclear pore, through the cytoplasm and on to one of its final destinations, into progeny virus particles 1.
FISH serves as a useful tool to identify changes in steady-state localization of viral RNA. When combined with immunofluorescence (IF) analysis 22, FISH/IF co-analyses will provide information on the co-localization of proteins with the viral RNA3. This analysis therefore provides a good starting point to test for RNA-protein interactions by other biochemical or biophysical tests 4,5, since co-localization by itself is not enough evidence to be certain of an interaction. In studying viral RNA localization using a method like this, abundant information has been gained on both viral and cellular RNA trafficking events 6. For instance, HIV-1 produces RNA in the nucleus of infected cells but the RNA is only translated in the cytoplasm. When one key viral protein is missing (Rev) 7, FISH of the viral RNA has revealed that the block to viral replication is due to the retention of the HIV-1 genomic RNA in the nucleus 8. 
Here, we present the method for visual analysis of viral genomic RNA in situ. The method makes use of a labelled RNA probe. This probe is designed to be complementary to the viral genomic RNA. During the in vitro synthesis of the antisense RNA probe, the ribonucleotide that is modified with digoxigenin (DIG) is included in an in vitro transcription reaction. Once the probe has hybridized to the target mRNA in cells, subsequent antibody labelling steps (Figure 1) will reveal the localization of the mRNA as well as proteins of interest when performing FISH/IF.

Detection of Viral RNA by Fluorescence in situ Hybridization FISH

A fluorescence in situ hybridization (FISH) method was developed to visually detect viral genomic RNA using fluorescence microscopy. A probe is made with specificity to the viral RNA that can then be identified using a combination of hybridization and immunofluorescence techniques. This technique offers the advantage of identifying the localization of the viral RNA or DNA at steady-state, providing information on the control of intracellular virus trafficking events.

الكشف عن الحمض النووي الريبي الفيروسي بواسطة الإسفار<em&gt; في الموقع</em&gt; التهجين (FISH)

Viruses  that infect cells elicit specific changes to normal cell functions which serve  to divert energy and resources for viral replication. Many ...

Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae

The Fluorescence in situ Hybridization (FISH) method allows one to detect nucleic acids in the native cellular environment. Here we provide a protocol for using FISH to quantify the number of mRNAs in single yeast cells. Cells can be grown in any condition of interest and then fixed and made permeable. Subsequently, multiple single-stranded deoxyoligonucleotides conjugated to fluorescent dyes are used to label and visualize mRNAs. Diffraction-limited fluorescence from single mRNA molecules is quantified using a spot-detection algorithm to identify and count the number of mRNAs per cell. While the more standard quantification methods of northern blots, RT-PCR and gene expression microarrays provide information on average mRNAs in the bulk population, FISH facilitates both the counting and localization of these mRNAs in single cells at single-molecule resolution.

Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae

This protocol describes an experimental procedure for performing Fluorescence in situ Hybridization (FISH) for counting mRNAs in single cells at single-molecule resolution.

التصور والتحليل من جزيئات الرنا المرسال عن طريق الإسفار<em&gt; في الموضع</em&gt; التهجين في<em&gt; خميرة الخباز</em

The Fluorescence in situ Hybridization (FISH) method allows one to detect nucleic acids in the native cellular environment. Here we provide a protocol for ...

MicroRNA In situ Hybridization for Formalin Fixed Kidney Tissues

In this article we describe a method for colorimetric detection of miRNA in the kidney through in situ hybridization with digoxigenin tagged microRNA probes. This protocol, originally developed by Kloosterman and colleagues for broad use with Exiqon miRNA probes1, has been modified to overcome challenges inherent in miRNA analysis in kidney tissues. These include issues such as structure identification and hard to remove residual probe and antibody. Use of relatively thin, 5 mm thick, tissue sections allowed for clear visualization of kidney structures, while a strong probe signal was retained in cells. Additionally, probe concentration and incubation conditions were optimized to facilitate visualization of microRNA expression with low background and nonspecific signal. Here, the optimized protocol is described, covering the initial tissue collection and preparation through the mounting of slides at the end of the procedure. The basic components of this protocol can be altered for application to other tissues and cell culture models.

MicroRNA In situ Hybridization for Formalin Fixed Kidney Tissues

This article describes an in situ hybridization protocol optimized for colormetric detection of microRNA expression in formalin fixed kidney sections.

الرنا الميكروي<em&gt; في الوضع الطبيعي</em&gt; التهجين للأنسجة الكلى الفورمالين الثابتة

In this article we describe a method for colorimetric detection of miRNA in the kidney through in situ hybridization with digoxigenin tagged microRNA ...

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. coli O157:H7 by targeting ORF Z3276. With this assay, we can detect as low as a few copies of the genome of DNA of E. coli O157:H7. The sensitivity and specificity of the assay were confirmed by intensive validation tests with a large number of E. coli O157:H7 strains (n = 369) and non-O157 strains (n = 112). Furthermore, we have combined propidium monoazide (PMA) procedure with the newly developed qPCR protocol for selective detection of live cells from dead cells. Amplification of DNA from PMA-treated dead cells was almost completely inhibited in contrast to virtually unaffected amplification of DNA from PMA-treated live cells. Additionally, the protocol has been modified and adapted to a 96-well plate format for an easy and consistent handling of a large number of samples. This method is expected to have an impact on accurate microbiological and epidemiological monitoring of food safety and environmental source.

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A qPCR assay was developed for detection of Escherichia coli O157:H7 targeting a unique genetic marker, Z3276. The qPCR was combined with propidium monoazide (PMA) treatment for live cell detection. This protocol has been modified and adapted to a 96-well plate format for easy and consistent handling of numerous samples

الكشف عن لايف<em&gt; كولاي</em&gt; O157: H7 من قبل خلايا PMA-QPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

التنميط الفردية الخلايا الجذعية الجنينية البشرية من خلال الكمي RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

طريقة لتصنيف النصوص في الخلايا الفردية الإشريكيّة القولونية للأسفار جزيء واحد في الموقع تجارب التهجين

Summary

Explore More Videos

Chapters in this video

Pyrosequencing : طريقة بسيطة لالتنميط الجيني دقيقة

الجامعة جبل مزدوجة في الموقع التهجين لافراخ الدجاج في وقت مبكر

مضان في الموقع التهجين (FISH) البروتوكول في الحيوانات المنوية البشرية

النظام الآلي للقياسات واحدة الإسفار جزيء من الجزيئات الحيوية سطح يجمد

في الموقع التهجين لتوطين دقيقة من النصوص في النباتات

الكشف عن الحمض النووي الريبي الفيروسي بواسطة الإسفار

التصور والتحليل من جزيئات الرنا المرسال عن طريق الإسفار

الرنا الميكروي

الكشف عن لايف

التنميط الفردية الخلايا الجذعية الجنينية البشرية من خلال الكمي RT-PCR